KR20240111933A - Anti-inflammatory composition comprising herb extracts - Google Patents

Abstract

The present invention relates to an anti-inflammatory composition containing mixed extracts of coleus leaves, pine leaves, loquat leaves, green tea leaves, and German chamomile, specifically for NO production and PGE2, IL-1β, IL-6, and TNF-α. , it can contribute to public health by providing a safe and effective anti-inflammatory composition by suppressing the production of iNOS and COX-2.

Description

Anti-inflammatory composition comprising herb extracts}

The present invention relates to an anti-inflammatory composition containing herbal extracts, and specifically, to an anti-inflammatory composition containing extracts of coleus leaf, pine tree leaf, loquat leaf, green tea leaf, and German chamomile extract.

Inflammation is the body's response to irritation, injury, or infection. It is the body's normal protective response to infectious organisms such as bacteria or viruses, antigens (substances foreign to the body), or tissue damage. In general, inflammation is a process that helps with healing, but if the inflammation that occurs does not stop or is not controlled after a certain period of time, it can damage the body.

The inflammatory process is initiated by external or internal stress. The human body's macrophages respond to external stimuli or invading pathogens and produce cytokines such as inflammatory factors such as TNF-α, interleukin 1-β (IL-1β), and IL-6, as well as induced oxidation. It synthesizes inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) to produce nitric oxide (NO) and prostaglandin E2 (PGE2). . The NO produced through this process performs the role of removing tumors and bacteria, but when NO is produced excessively in the body, it causes tissue damage, gene mutation, and increased blood vessel permeability, causing inflammatory reactions such as edema. It causes damage to the human body.

Accordingly, anti-inflammatory drugs have become a frequently consumed medicine for modern people. Nonsteroidal anti-inflammatory analgesics (NSAIDs) are one of the most widely used medicines worldwide, and the domestic anti-inflammatory analgesic market size in 2017 is known to be approximately 400 billion won. However, these anti-inflammatory analgesics not only cause decreased gastrointestinal function, mucosal damage, and bleeding, but are also pointed out as the cause of leaky gut syndrome (LGS). In addition, it reduces the amount of blood flowing to the kidneys, reducing the blood that is filtered, and also affects the secretion of antidiuretic hormone. Accordingly, interest in natural products that suppress inflammatory responses is increasing.

As a conventional prior art, Korean Patent No. 10-2438276 describes an anti-inflammatory and anti-obesity composition containing extract of the Chinese oxalis, and Korean Patent No. 10-0530843 describes an anti-inflammatory composition containing Cordyceps sinensis extract as an active ingredient. This is listed. In addition, Korean Patent No. 10-2076001 discloses an anti-inflammatory composition containing soybean leaf extract, and Korean Patent No. 10-2070655 discloses an anti-inflammatory composition using water hyacinth extract. However, there is still a need to develop new drugs with anti-inflammatory activity, fewer side effects, and long-lasting effects.

Korean Patent No. 10-2438276, Anti-inflammatory and anti-obesity composition containing extract of Chrysanthemum moss and its manufacturing method, August 25, 2022. registration. Korean Patent No. 10-0530843, Anti-inflammatory composition containing Cordyceps sinensis extract as an active ingredient, November 17, 2005. registration. Korean Patent No. 10-2076001, Anti-inflammatory composition containing soybean leaf extract, February 5, 2020. registration. Korean Patent No. 10-2070655, Anti-inflammatory composition using water hyacinth extract, January 21, 2020. registration.

The purpose of the present invention is to provide an anti-inflammatory composition containing extracts of coyote, pine leaf, loquat leaf, green tea leaf, and German chamomile.

In order to solve the above problems, the present invention provides an anti-inflammatory composition containing mixed extracts of coleus leaves, pine leaves, loquat leaves, green tea leaves, and German chamomile.

The mixed extract of the leaf, pine tree leaves, loquat leaves, green tea leaves and German chamomile is composed of leaf leaves, pine leaves, loquat leaves, green tea leaves and German chamomile in a weight ratio of 1~2:1~2:1~2:1~ It is an extract of a mixture mixed in a ratio of 2:1~2. If one or more compositions are larger or smaller than the above ratio, the anti-inflammatory activity of the mixed extract of coleus leaf, pine tree leaf, loquat leaf, green tea leaf, and German chamomile may be reduced and may not be effective. The anti-inflammatory activity shows similar anti-inflammatory activity at the weight ratio of coleus leaves, pine leaves, loquat leaves, green tea leaves and German chamomile at a weight ratio of 1 to 2:1 to 2:1 to 2:1 to 2:1 to 2, most preferably The weight ratio of coir leaves, pine tree leaves, loquat leaves, green tea leaves, and German chamomile is 2:2:1:1:1. The weight ratio is the dry weight ratio.

The anti-inflammatory composition containing the leaf of the present invention, the leaf of the pine tree, the leaf of the loquat tree, the leaf of the green tea leaf, and the extract of German chamomile, can be obtained by extracting from herbal medicine or its dried product, and the raw materials for the extract are those grown or reared, or Commercially available products can be used without restrictions.

In the present invention, leaf refers to generally edible mugwort, including yellow sea mugwort (Artemisia argyi Lev. et Vant.), mugwort (Artemisia princeps Pampanini), sagebrush (Artemisia montana Pampani), or variants and improved species thereof of the Asteraceae family. Refers to the leaves and young stems of mugwort. The components contained in the leaves include terpene compounds such as artemisinin and artemisinic acid, and it has been reported that there are differences in the components contained in the leaves depending on the species collected and the cultivation method. . The anti-inflammatory effects of leaf extracts and leaf components have already been widely reported, and Professor Tu Youyou of China developed a malaria treatment manufactured using artemisinin, an active ingredient isolated from Artemisia annua (Asteraceae). won the 2015 Nobel Prize in Physiology or Medicine. On the other hand, the extract of the leaf is known to have excellent effects such as inhibiting blood coagulation and inhibiting the induction of osteoporosis.

In the present invention, Guju pine ( Pinus Sylvestris ) is a type of coniferous tree belonging to the genus Pine. It is planted throughout Korea and grows or is cultivated in various places such as Europe, Asia, and North America. It is an evergreen needle-leaved tree with long, twisted leaves. The fruit is similar in length to the leaves and does not bend. It is used as building material, ship material, and furniture material. It is also called European pine, European red pine, and forest pine.

In the present invention, the loquat tree ( Eriobotrya japonica ) is an evergreen broad-leafed tree of the Rosaceae family, produced in all regions south of the Yangtze River, and native to Hubei and Sichuan provinces in southwestern China. There is a record that loquat tree leaves were traditionally used for edema, bronchitis, clear lung, cough, expectoration, dry stomach, diuresis, thirst, and vomiting.

In the present invention, green tea ( Camellia sinensis ) is the oldest tea species consumed by mankind and is a representative tea that is widely consumed around the world along with coffee, and is known to contain many polyphenols. Green tea, which has been found to contain a large amount of polyphenols called catechins, has been reported to have various physiological activities such as antioxidant activity, antibacterial activity, cavity prevention, obesity suppression, blood sugar lowering effect, and anti-allergy effect.

In the present invention, German chamomile ( Matricaria chamomilla ) is a medicinal plant belonging to the Asteraceae family. It may be Roman or German chamomile. It is traditionally taken as a tea and is known to be effective in treating colds.

The extract may be obtained in a conventional manner from leaflets, pine leaves, loquat leaves, green tea leaves, and German chamomile. For example, all conventionally known extraction methods such as solvent extraction, ultrasonic extraction, filtration, and reflux extraction can be used. Preferably, it can be prepared by using solvent extraction or reflux extraction. The extraction process can be repeated several times, and then additional steps such as concentration or freeze-drying can be performed. Specifically, the obtained extract can be concentrated under reduced pressure to obtain a concentrate, the concentrate can be freeze-dried, and then a high-concentration extract powder can be prepared using a grinder.

When preparing the extract, it may be extracted using water, an organic solvent, or a mixture thereof as an extraction solvent. The organic solvent is alcohol, preferably C1-C4 alcohol, hexane (n-hexane), ether, glycerol, propylene glycol, butylene glycol, ethyl acetate, methyl acetate, dichloromethane, chloroform, ethyl acetate, benzene and these. It may be any one selected from the group consisting of mixed solvents, but is not limited thereto. Preferably, water or ethanol can be used as the extraction solvent, and water is more preferably used.

When preparing the extract, the extraction temperature may be carried out at 50°C to 100°C, preferably at 70°C to 100°C, and more preferably at 90°C to 100°C, but is limited thereto. It doesn't work. Extraction may be performed for 2 hours to 12 hours, preferably for 2 hours to 10 hours, and more preferably for 2 hours to 8 hours, but is not limited thereto. Extraction may be performed 1 to 8 times, preferably 1 to 6 times, and more preferably 1 to 4 times, but is not limited thereto.

In the present invention, the extract may be obtained as a fraction by additionally performing a conventional fractionation process. For example, a typical fractionation process can be performed using an organic solvent, and the organic solvent may include lower alcohols of C1 to 4, ethyl acetate, hexane, and methylene chloride, and the lower alcohols of C1 to 4 may include Alcohol may include methanol, ethanol, propanol, isopropanol, butanol, etc.

The anti-inflammatory activity of the anti-inflammatory composition of the present invention may be to directly inhibit NO production. The anti-inflammatory activity of the anti-inflammatory composition of the present invention is due to the presence of prostaglandin E2 (PGE2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor- It may inhibit the expression of one or more inflammatory cytokines selected from the group consisting of α (tumor necrosis factor α, TNF-α). In addition, the anti-inflammatory activity of the anti-inflammatory composition of the present invention may be to inhibit the expression of inducible nitric oxide synthase (iNOS) or prostaglandin-endoperoxide synthase 2 (Prostaglandin-endoperoxide synthase 2). there is.

The mixed extract of leaf, pine tree leaf, loquat leaf, green tea leaf and German chamomile according to the present invention can be provided as a therapeutic pharmaceutical composition for improving skin condition containing pharmaceutically acceptable excipients.

The mixed extract of the leaf, pine tree leaf, loquat leaf, green tea leaf and German chamomile is preferably 0.001 to 99% by weight, more preferably 0.001 to 70% by weight, and most preferably 0.001% by weight, based on the total weight of the entire pharmaceutical composition. It can be added at ~50% by weight.

The pharmaceutical composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, solutions, aerosols, external preparations, suppositories, and sterile injection solutions according to conventional methods. You can. Carriers, excipients, and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, sweeteners, and acidulants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one or more of the mixed extracts of the leaf, pine tree leaf, loquat tree leaf, green tea leaf, and German chamomile of the present invention. It is prepared by mixing excipients, such as starch, calcium carbonate, sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, etc. In addition to the commonly used simple diluents such as water and liquid paraffin, they contain various excipients such as wetting agents, sweeteners, fragrances, preservatives, and acidulants. may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween-61, cacao, laurin, glycerogeratin, etc. can be used.

The dosage of the pharmaceutical composition of the present invention will vary depending on the age, gender, and weight of the subject to be treated, the specific disease or pathological state to be treated, the severity of the disease or pathological state, the route of administration, and the judgment of the prescriber. Dosage determinations based on these factors are within the level of one skilled in the art, and dosages generally range from 0.01 mg/kg/day to approximately 500 mg/kg/day. A preferred dosage is 0.1 mg/kg/day to 200 mg/kg/day, and a more preferred dosage is 1 mg/kg/day to 200 mg/kg/day. Administration may be administered once a day, or may be administered several times. The above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, and humans through various routes. All modes of administration are contemplated, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection and dermal application. The mixed extract of leaf, pine tree leaf, loquat leaf, green tea leaf and German chamomile of the present invention has almost no toxicity and side effects, so it is a medicine that can be safely used even when taken for a long period of time for preventive purposes.

The composition provides a health functional food for improving skin condition containing mixed extracts of coleus leaves, pine leaves, loquat leaves, green tea leaves and German chamomile, and food supplements that are acceptable food additives.

The health functional food is preferably 0.001 to 50% by weight, more preferably 0.001 to 30% by weight, and most preferably 0.001 to 50% by weight, based on the total weight of the entire food, including leaf leaves, pine leaves, loquat leaves, green tea leaves and German chamomile mixed extract. In other words, it can be added at 0.001 to 10% by weight.

The health functional food includes the form of tablets, capsules, pills, or liquid, and foods to which the extract of the present invention can be added include, for example, various foods, beverages, gum, tea, vitamin complexes, and health products. There are functional foods, etc.

The composition provides a cosmetic composition for improving skin condition containing mixed extracts of coleus leaves, pine leaves, loquat leaves, green tea leaves and German chamomile, and additives acceptable for external use. The cosmetic composition of one embodiment of the present invention contains ingredients commonly used in cosmetics, such as moisturizers, antioxidants, oily ingredients, ultraviolet absorbers, emulsifiers, surfactants, thickeners, and alcohols, within the range that does not impair the effect of the present invention. , powder ingredients, colorants, water-based ingredients, water, various skin nutrients, etc. can be appropriately mixed as needed.

The cosmetic composition includes skin ointment, cream, softening lotion, nourishing lotion, pack, essence, hair tonic, shampoo, rinse, hair conditioner, hair treatment, gel, skin lotion, skin softener, skin toner, astringent, lotion, milk. A formulation selected from the group consisting of lotion, moisture lotion, nutritional lotion, massage cream, nutritional cream, moisture cream, hand cream, foundation, nutritional essence, sunscreen, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser. may have, but is not limited thereto. The composition of each of these formulations may contain various bases and additives necessary and appropriate for the formulation of the formulation, and the types and amounts of these components can be easily selected by those skilled in the art.

When the formulation of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier ingredient. You can.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier ingredient. In particular, when the formulation is a spray, chlorofluorohydrocarbon and propane may be used as carrier ingredients. /May contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 , 3-butyl glycol oil, fatty esters of glycerol, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, the carrier ingredients include water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, and fatty acid amide. Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linoline derivative, or ethoxylated glycerol fatty acid ester can be used.

The formulation of the present invention may additionally contain excipients including fluorescent substances, fungicides, hydrotropes-inducing substances, moisturizers, fragrances, fragrance carriers, proteins, solubilizers, sugar derivatives, sunscreens, vitamins, plant extracts, etc. .

The present invention relates to an anti-inflammatory composition containing mixed extracts of coleus leaves, pine leaves, loquat leaves, green tea leaves, and German chamomile, specifically for NO production and PGE2, IL-1β, IL-6, and TNF-α. , it can contribute to public health by providing a safe and effective anti-inflammatory composition by suppressing the production of iNOS and COX-2.

Figure 1 is a graph showing the cell survival rate of RAW264.7 cells according to the concentration of mixed extracts of leaf, pine tree leaf, loquat tree leaf, green tea leaf, and German chamomile according to the present invention.
Figure 2 is a graph showing the amount of NO production in LPS-induced RAW264.7 cells according to the concentration of mixed extracts of leaf, pine tree leaf, loquat leaf, green tea leaf, and German chamomile according to the present invention.
Figure 3 shows PGE2 (A), IL-1β (B), IL- according to the concentration of mixed extracts of leaf, pine leaf, loquat leaf, green tea leaf, and German chamomile according to the present invention in LPS-induced RAW264.7 cells. This is a graph showing the expression of 6 (C) and TNF-α (D).
Figure 4 shows iNOS (A), COX-2 (B), IL- in LPS-induced RAW264.7 cells according to the concentration of mixed extracts of leaf, pine leaf, loquat leaf, green tea leaf, and German chamomile according to the present invention. This is a graph showing gene expression of 1β (C), IL-6 (D), and TNF-α (E).

The inventor of the present invention was researching the anti-inflammatory activity of natural products that have been traditionally used in oriental medicine, and among the many natural products with anti-inflammatory activity, especially mixed extracts containing Aleaf, pine leaves, loquat leaves, green tea leaves, and German chamomile. The present invention was completed after confirming that the anti-inflammatory activity has a significant synergistic effect compared to a single extract. Aster leaves, pine tree leaves, loquat leaves, green tea leaves, and German chamomile have been partially used for inflammation-related diseases, but the strong anti-inflammatory synergistic effect of these mixtures has not been reported.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms, and the content introduced here is provided to sufficiently convey the spirit of the present invention.

<Manufacture of herbal extract>

As shown in Table 1 below, 1 L of distilled water was added to 35 g each of shade-dried leaves, pine leaves, loquat leaves, green tea leaves, and German chamomile, or 35 g of a mixture thereof, and extraction was performed at 100°C for 3 hours, and the extract was extracted with filter paper. The extract was filtered using. The filtered extract was concentrated under reduced pressure using a rotary vacuum evaporator (EYELA, Japan) and freeze-dried using a freeze dryer (ilShinbiobase, Korea). Freeze-dried leaflets, pine tree leaves, loquat leaves, green tea leaves, and German chamomile extracts were stored at -20°C, divided into portions on the day of the experiment, and dissolved in distilled water for use.

division Love (g) Kuju pine leaves (g) Loquat leaves (g) Green tea leaves (g) German Chamomile (g) Comparative Example 1 35 - - - - Comparative Example 2 - 35 - - - Comparative Example 3 - - 35 - - Comparative Example 4 - - - 35 - Comparative Example 5 - - - - 35 Example 1 20 15 - - - Example 2 15 10 10 - - Example 3 15 10 5 5 - Example 4 15 5 5 5 5 Example 5 10 10 5 5 5 Example 6 - 20 15 - - Example 7 - 15 10 10 - Example 8 - 15 10 5 5 Example 9 5 15 5 5 5 Example 10 5 10 10 5 5 Example 11 - - 20 15 - Example 12 15 10 10 Example 13 5 - 15 10 5 Example 14 5 5 15 5 5 Example 15 5 5 10 10 5 Example 16 - - - 20 15 Example 17 10 - - 15 10 Example 18 5 5 - 15 10 Example 19 5 5 5 15 5 Example 20 5 5 5 10 10

<Determination of optimal ratio of herb extract>

The anti-inflammatory effect of Comparative Examples and Examples 1 to 16 was confirmed in mouse macrophages (RAW 264.7 cells) induced with inflammation by LPS.

RAW264.7 cells were distributed in a 6 well plate at 1×10 ⁵ cells/well, cultured for 24 hours, treated with 200 μg/mL of the extract of the comparative light example, and then 200 ng/mL of LPS was added and incubated again for 24 hours. It was cultured for some time. The group treated with distilled water instead of the sample was designated as the control group, and the group not treated with LPS or the sample was designated as the normal group. IL-1β in RAW264.7 cells was analyzed using the mouse IL-1β ELISA kit (Komabiotech, Korea). After all cultures were completed, 100 μL of the separated cell culture was added to a 96 well plate and reacted at room temperature for 2 hours. After reaction, the reagents on the plate were discarded and washed four times with washing buffer. After washing, 100 μL of each detection antibody was added and reacted at room temperature for 2 hours. After the reaction, 100 μL of streptavidin-HRP was added to each plate and reacted at room temperature for 30 minutes. After reaction, 100 μL of TMB or pink-ONE solution was added to each well, reacted for 15 minutes, 100 μL of stop solution was added, and absorbance was measured at 450 nm using a micro reader. The results are expressed as a ratio to the control group and are shown in the table. It is shown in 2.

division IL- 1β /β-actin division IL- 1β /β-actin division IL- 1β /β-actin Normal 4.5 Example 3 58.12 Example 12 70.52 Control 100 Example 4 57.09 Example 13 63.3 Comparative Example 1 70.22 Example 5 33.33 Example 14 59.68 Comparative Example 2 78.29 Example 6 72.37 Example 15 40.55 Comparative Example 3 90.41 Example 7 70.63 Example 16 81.44 Comparative Example 4 73.36 Example 8 68.46 Example 17 75.28 Comparative Example 5 82.96 Example 9 62.45 Example 18 68.88 Example 1 68.89 Example 10 38.21 Example 19 67.25 Example 2 61.47 Example 11 81.49 Example 20 43.49

As shown in Table 2, the IL-1β inhibitory activity of the leaf extract was the highest among the single extracts of pine leaf, pine leaf, loquat leaf, green tea leaf, and German chamomile. The IL-1β inhibitory activity of the mixed extract containing both and German chamomile was the highest. In addition, high IL-1β inhibitory activity was shown at a weight ratio of 1 ~ 2:1 ~ 2:1 ~ 2:1 ~ 2:1 ~ 2 of coyote, pine tree leaves, loquat leaves, green tea leaves, and German chamomile. . Accordingly, the subsequent experiment was conducted using a mixed extract (hereinafter referred to as HrMx) with a weight ratio of 2:2:1:1:1 of coleus leaves, cypress pine leaves, loquat leaves, green tea leaves, and German chamomile, which had the highest IL-1β inhibitory activity. It was used in subsequent experiments.

< HrMx Check the effect on cell viability>

The effect of the herbal extract (HrMx) obtained above on the cell viability of mouse macrophages (RAW 264.7 cells) was confirmed. RAW264.7 cells were distributed at 2×10 ⁴ cells/well in a 48 well plate, cultured for 24 hours, and treated with HrMx at concentrations of 0 (Control), 50, 100, 200, and 400 μg/mL for another 24 hours. Cultured. After all cultures were completed, 10 μL of EZ-Cytox (Daeilab, Korea) solution was added per 100 μL of culture medium and incubated for 30 minutes in a cell incubator. After the reaction, the absorbance was measured at 450 nm, and the cell viability relative to the control group was expressed as a percentage and is shown in Figure 1 and Table 3.

Statistical processing of the experimental results was expressed as mean ± standard error using SPSS Statistics Version 21.0 (IBM, U.S.A.). First, statistical comparison between two groups was performed using an independent samples t-test, and statistical comparison between multiple groups was performed using analysis of variance (ANOVA). Afterwards, significance was tested by setting the significance level to 0.05 through a post hoc test (Tukey’s HSD test), and it was divided into three significance levels: p < 0.05, p < 0.01, and p < 0.001.

Concentration ( μg/mL ) Cell viability (compared to control group) % ) Control 100.00±0.65 50 103.03±1.15 100 101.58±1.02 200 100.03±0.91 400 89.56±1.24

As shown in Figure 1 and Table 3, the survival rate was 100.03% up to 200 μg/mL of HrMx, and the survival rate was 89.56% even at the concentration of 400 μg/mL. Accordingly, in the following experiments, experiments were conducted up to HrMx 200 μg/mL.

< Example 3. HrMx LPS Judo RAW264 .7 Confirmation of effect on NO production in cells>

RAW264.7 cells were distributed at 2×10 ⁴ cells/well in a 48 well plate and cultured for 24 hours, treated with HrMx at concentrations of 0 (Control), 50, 100, and 200 μg/mL, and 200 ng/mL of LPS. was added and cultured again for 24 hours. The group to which LPS and HrMx were not added was considered the normal control group (Normal). NO production was measured using the Nitrix Oxide plus detection kit (Intronbio, Korea), and NO production was measured according to the manufacturer's manual. After all incubations were completed, 100 μL of N1 buffer in the kit was added and reacted at room temperature for 10 minutes. After reaction, 100 μL of N2 buffer in the kit was added and reacted at room temperature for 10 minutes. After the reaction, the absorbance was measured at 540 nm and the results are shown in Figure 2 and Table 4.

Concentration ( μg/mL ) NO production amount ( μM ) Normal 1.38±0.06 Control 12.99±0.46 50 9.22±0.37*** 100 7.35±0.19*** 200 4.60±0.54***

As shown in Figure 2 and Table 4, as a result of measuring NO production, HrMx was concentration dependent at a concentration of 50 μg/mL or more and showed a significant decrease compared to the control group.

< Example 4. HrMx LPS Judo RAW264 .7 Confirmation of effects on cytokine production in cells>

RAW264.7 cells were distributed in a 6 well plate at 1×10 ⁵ cells/well, cultured for 24 hours, treated with HrMx at concentrations of 0 (Control), 50, 100, and 200 μg/mL, and 200 ng/mL of LPS. was added and cultured again for 24 hours. The group to which LPS and HrMx were not added was considered the normal control group (Normal). Cytokine production in RAW264.7 cells was performed using the Prostaglandin E2 Parameter Assay Kit (R&D Systems, USA), mouse IL-1β ELISA kit (Komabiotech, Korea), and mouse IL-6 ELISA kit (Komabiotech, Korea). and mouse TNF-α ELISA kit (Komabiotech, Korea), respectively. After all cultures were completed, 100 μL of the separated cell culture was added to a 96 well plate and reacted at room temperature for 2 hours. After reaction, the reagents on the plate were discarded and washed four times with washing buffer. After washing, 100 μL of each detection antibody was added and reacted at room temperature for 2 hours. After the reaction, 100 μL of streptavidin-HRP was added to each plate and reacted at room temperature for 30 minutes. After reaction, 100 μL of TMB or pink-ONE solution was added to each well, reacted for 15 minutes, 100 μL of stop solution was added, and the absorbance was measured at 450 nm using a micro reader. Absorbance was measured as an absolute value based on the reference curve in Figures 3A to 3A. Shown in Figure 3D and Table 5.

density
( μg /mL) Cytokine production amount ( pg /mL) Prostaglandin E2 IL- 1β IL-6 TNF -α Normal 128.56±7.84 17.76±3.35 64.76±4.48 9.50±2.33 Control 851.27±21.03 521.01±22.96 1772.58±79.61 1750.54±106.88 50 760.90±48.39 366.00±24.68** 1770.25±116.75 1739.61±80.50 100 683.16±39.54** 313.81±33.87** 1418.77±116.67* 1492.51±72.83* 200 617.74±13.66*** 173.65±15.97*** 793.73±21.61*** 1368.48±90.55**

As shown in Figures 3A to 3D and Table 5, the inflammatory cytokines Prostaglandin E2 (PGE2), Interleukin-1β (IL-1β), and Interleukin-6 (IL-6) And tumor necrosis factor α (TNF-α) was significantly increased in RAW264.7 cells induced by inflammation with LPS, and decreased in a concentration-dependent manner by the HrMx of the present invention. In the case of PGE2, IL-6, and TNF-α, a significant decrease was observed compared to the control group at HrMx concentrations above 200 μg/mL, and IL-1β was significantly decreased compared to the control group at HrMx concentrations above 100 μg/mL. appear.

< Example 4. HrMx LPS Judo RAW264 .7 Confirmation of effects on gene expression in cells>

RAW264.7 cells were distributed in a 6 well plate at 1×10 ⁵ cells/well, cultured for 24 hours, treated with HrMx at concentrations of 50, 100, and 200 μg/mL, and 200 ng/mL of LPS was added and incubated again for 24 hours. It was cultured for some time. The group to which LPS and HrMx were not added was considered the normal control group (Normal). Gene expression in RAW264.7 cells was PCR cycler (alpha cycler 1 PCRmax: PCRmax, UK) was performed using a real-time PCR cycler (Exicycler™ 96: Bioneer, Korea), accupower ^® cyclescript RT premix (dT20) (Bioneer, Korea), qPCRBIO SyGreen Blue Mix This was performed using Lo-ROX (PCR Biosystems, USA) according to the manufacturer's manual. After all cultures were completed, RNA was extracted from cells obtained by centrifugation using a total RNA prep kit. The extracted RNA was mixed with the reverse transcription premix in the kit and incubated at 45°C for 60 minutes and 95°C for 5 minutes using a PCR cycler. cDNA was synthesized through a brief reaction. Real-time PCR was performed to amplify and confirm a specific gene from the synthesized cDNA. cDNA, primers suitable for the specific gene, and SYBR green premix were mixed and reacted at 95°C for 2 minutes, at 95°C for 5 seconds, and at 62.5°C. A specific gene was amplified by repeating 30 seconds 40 times. The gene expression level was relative quantified based on the gene expression level of the control group and is shown in Figures 4A to 4E and Table 6. Information on the primers used is shown in Table 7.

density
( μg /mL) mRNA fold change iNOS /β-actin COX-2/β-actin IL- 1β /β-actin IL-6/β-actin TNF -α/β-actin Normal 0.50±0.02 0.01±0.00 0.04±0.00 0.01±0.00 0.21±0.01 Control 1.00±0.00 1.00±0.00 1.00±0.00 1.00±0.00 1.00±0.00 50 0.85±0.06* 0.90±0.02* 0.68±0.03** 0.93±0.06 0.99±0.01 100 0.73±0.04** 0.87±0.02** 0.49±0.01*** 0.68±0.02** 0.91±0.03* 200 0.51±0.04*** 0.72±0.03** 0.28±0.01*** 0.32±0.03*** 0.82±0.03**

Gene name Size(bp) F/R Sequences iNOS 108 F CTTGGTGAAGGGACTGAGCTG R CAACGTTCTCCGTTCTCTTGC COX-2 93 F CAACACCTGAGCGGTTACCA R TTCAGAGGCAATGCGGTTCT IL-1β 94 F GCCACCTTTTGACAGTGATGAG R GACAGCCCAGGTCAAAGGTT IL-6 92 F AGCCAGAGTCCTTCAGAGAGAT R GAGAGCATTGGAAAATTGGGGT TNF-α 144 F ATGGCCTCCCTCTCATCAGT R TTTGCTACGACGTGGGCTAC Beta actin 141 F CACTGTCGAGTCGCGTCC R CGCAGCGATATCGTCATCCA

Inducible Nitric Oxide Synthase (iNOS) is a Ca ²⁺ -independent NOS. Its expression is induced in ^a wide range of cells and tissues by cytokines and other agents, and iNOS continues to act until the enzyme is decomposed. Since NO is produced and causes an inflammatory response, abnormal and excessive induction of iNOS causes various problems such as asthma, arthritis, multiple sclerosis, and colitis.

COX-2 is known as prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase), and is not expressed in most cells under normal conditions, but is expressed at high levels during inflammation, causing damage to the heart. It is known to significantly increase the risk of cardiovascular events such as seizures and stroke.

As shown in Figures 4A to 4B and Table 6, when RAW264.7 cells are treated with LPS, inducible nitric oxide synthase (iNOS), cyclooxygenase-2, The expression level of the COX-2) gene rapidly increased, and as a result of treatment with HrMx, a significant decrease was observed in a concentration-dependent manner compared to the control group at concentrations of HrMx 50 μg/mL or higher.

In addition, as shown in Figures 4C to 4E and Table 6, the gene expression levels of inflammatory cytokines IL-1β, IL-6, and TNF-α were also rapidly increased in RAW264.7 cells by treatment with LPS, and HrMx As a result of treatment, in the case of IL-1β, HrMx was concentration-dependent and significantly decreased compared to the control group at a concentration of 50 μg/mL or higher, and in the case of IL-6 and TNF-α, HrMx was observed at a concentration of 50 μg/mL or higher. There was a concentration-dependent and significant decrease in concentration compared to the control group.

These results confirmed that HrMx according to the present invention exhibits anti-inflammatory activity by suppressing gene expression of inflammation-related genes iNOS and COX-2 and inflammatory cytokines IL-1β, IL-6, and TNF-α in an inflammation-inducing environment. did.

Claims (9)

An anti-inflammatory composition containing mixed extracts of coleus leaf, pine tree leaf, loquat leaf, green tea leaf, and German chamomile. According to paragraph 1,
The mixed extract of pine leaves, loquat leaves, loquat leaves, green tea leaves and German chamomile is composed of pine leaves, loquat leaves, green tea leaves and German chamomile in a dry weight ratio of 1 to 2:1 to 2:1 to 2:1 to 2. :An anti-inflammatory composition characterized in that it is an extract of a mixture of 1 to 2. According to paragraph 1,
An anti-inflammatory composition, characterized in that the mixed extract of the leaf, pine tree leaf, loquat leaf, green tea leaf, and German chamomile is selected from the group consisting of water, C1-C4 alcohol, and mixed solvents thereof. According to paragraph 1,
The anti-inflammatory composition is characterized in that it inhibits NO production. According to paragraph 1,
The anti-inflammatory composition includes prostaglandin E2 (PGE2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (tumor necrosis factor-α). An anti-inflammatory composition, characterized in that it inhibits the expression of one or more inflammatory cytokines selected from the group consisting of α, TNF-α). According to paragraph 1,
The anti-inflammatory composition is an anti-inflammatory composition characterized in that it inhibits the expression of inducible nitric oxide synthase (iNOS) or prostaglandin-endoperoxide synthase 2. . A cosmetic composition comprising the anti-inflammatory composition of any one of claims 1 to 6. In clause 7,
The cosmetic composition includes skin ointment, cream, softening lotion, nourishing lotion, pack, essence, hair tonic, shampoo, rinse, hair conditioner, hair treatment, gel, skin lotion, skin softener, skin toner, astringent, lotion, milk. Selected from the group consisting of lotion, moisture lotion, nutritional lotion, massage cream, nutritional cream, moisture cream, hand cream, foundation, nutritional essence, sunscreen, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser. A cosmetic composition characterized in that it is formulated in one or more formulations. A health functional food containing the anti-inflammatory composition of any one of claims 1 to 6.