KR20240072348A - Biomarkers for diagnosing lung cancer and uses thereof - Google Patents

Abstract

The present invention relates to a composition and kit for diagnosing lung cancer using a new miRNA biomarker, and a method for providing information for diagnosing lung cancer using the same. A composition for diagnosing lung cancer is provided by presenting a new biomarker that can predict the lung cancer. and kits to quickly and accurately diagnose lung cancer or the progress of each stage of lung cancer, and provide treatment tailored to the patient's condition.

Description

Biomarkers for diagnosing lung cancer and uses thereof {Biomarkers for diagnosing lung cancer and uses thereof}

The present invention relates to a lung cancer diagnostic composition and kit for diagnosing lung cancer using a novel miRNA biomarker, and a method of providing information for lung cancer diagnosis using the same.

Lung cancer ranks first in cancer mortality in Korea and is one of the cancers with a high mortality rate not only in Korea but also around the world. Despite the rapid progress of modern medicine, the incidence and mortality rates of lung cancer continue to increase. In the case of lung cancer, it is mostly discovered at a late stage because there are few or mild initial symptoms, which limits the application of various treatments after diagnosis.

Currently, imaging methods such as X-ray, CT, and MRI are mainly used to diagnose lung cancer. However, these methods are difficult to diagnose lung cancer early or determine the exact stage, and the test method is also cumbersome and has the problem of being exposed to radiation during regular tests. This also has the disadvantage of low sensitivity.

Therefore, in order to detect lung cancer early, before symptoms occur, when treatment is possible through screening, and to accurately determine the stage of each lung cancer, the development of a new lung cancer diagnosis method that is simple and has a high diagnosis rate is urgently needed.

Republic of Korea Patent No. 10-1720050 Republic of Korea Patent No. 10-2415457

The purpose of the present invention is to provide a composition and kit for diagnosing lung cancer using a novel miRNA biomarker.

Additionally, the present invention aims to provide a method of providing information for lung cancer diagnosis using a novel miRNA biomarker.

One aspect of the present invention is hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1229-3p, hsa-miR- 1246, hsa-miR-125a-5p, hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1273c, hsa-miR-128-1- 5p, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa- miR-130a-3p, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR- 144-3p, hsa-miR-150-3p, hsa-miR-150-5p, hsa-miR-155-5p, hsa-miR-15b-5p, hsa-miR-181c-5p, hsa-miR-181d- 3p, hsa-miR-185-5p, hsa-miR-188-5p, hsa-miR-18a-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-194-5p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a- 3p, hsa-miR-19b-3p, hsa-miR-200b-5p, hsa-miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-2110, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR- 2278, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30c-1-3p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-337-3p, hsa- miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4685-3p, hsa- miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR- 4753-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-491-5p, hsa-miR-497-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR- 519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa- miR-627-5p, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511a-3p, hsa-miR-6511b-3p, hsa-miR-6516-3p, hsa-miR- 652-5p, hsa-miR-660-5p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6804-5p, hsa-miR-6807- 5p, hsa-miR-6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-762, hsa-miR-765, hsa-miR- 766-3p, hsa-miR-766-5p, hsa-miR-769-3p, hsa-miR-7704, hsa-miR-7847-3p, hsa-miR-7854-3p, hsa-miR-8485, hsa- miR-874-5p, hsa-miR-885-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1655, Provided is a composition for diagnosing lung cancer comprising an agent for measuring the expression level of one or more types of miRNA selected from the group consisting of Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684 and Mature_787.

“Lung cancer” as used in the present invention refers to a malignant tumor in the lung, which may occur in the lung itself (primary lung cancer) or may occur when cancer originating in another organ spreads to the lung (metastatic lung cancer). Primary lung cancer is largely divided into non-small cell lung cancer and small cell lung cancer based on histopathological criteria such as the size and shape of cancer cells, and most lung cancers fall under non-small cell lung cancer.

In the present invention, miRNA can be used as a biomarker for diagnosing lung cancer, especially non-small cell lung cancer. Here, a biomarker is a substance that can generally be detected in a biological sample and includes all organic biomolecules such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, glycoproteins, and sugars that can detect biological changes.

"miRNA" used in the present invention is also called micro RNA, and is a 21 to 23 non-coding RNA that regulates gene expression post-transcriptionally by promoting the degradation of target RNA or suppressing their translation. It means RNA. Generally, miRNA is transcribed into a precursor about 70-80 nt (nucleotide) long with a hairpin structure called pre-miRNA, and then cleaved by Dicer, an RNAse III enzyme, to produce a mature form. More than 30% of human miRNAs exist in clusters, and are transcribed as a single precursor and then undergo a cleavage process to form the final mature miRNA.

These miRNAs consist of specific miRNAs that show specific expression level changes in lung cancer patients identified through next-generation sequencing (NGS), and can be presented as biomarkers for lung cancer diagnosis.

The NGS has the multiplexing ability to perform hundreds of thousands of reactions simultaneously, and sequencing is possible even with a small amount of sample. NGS has somewhat different specific application techniques depending on the commercialized technology, but generally uses clonal amplification, massively parallel sequencing, and a new sequencing method that has a different mechanism of action from the Sanger method. Commercialized technologies include the 454 GS improved FLX model sequencer released by Roche in 2007, Genome Analyzer HiSeq released by Illumina in 2006, and SOLiD released by Applied Biosystems in 2007. These three platforms have in common the adoption of clone amplification technology, abandoning complex library construction and cloning processes, massively parallel sequencing technology that can process large quantities at once, and cyclic sequencing. By determining the base sequence through sequencing by synthesis, a complicated electrophoresis process was eliminated. In addition, short reads read using the shotgun method are arranged by a computer, and an algorithm is used to find duplicated parts and complete the whole.

These 174 miRNAs for lung cancer diagnosis include not only previously identified miRNAs but also novel miRNAs first identified as miRNAs by the present inventors.

The new miRNAs have not been reported in existing references and include Mature_1143, Mature_1175, Mature_1655, Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684, and Mature_787.

According to one embodiment of the present invention, Mature_1143 is represented by SEQ ID NO: 1, Mature_1175 is represented by SEQ ID NO: 2, Mature_1655 is represented by SEQ ID NO: 3, and Mature_1719 is represented by SEQ ID NO: 4 Mature_1813 is represented by SEQ ID NO: 5, Mature_1850 is represented by SEQ ID NO: 6, Mature_2015 is represented by SEQ ID NO: 7, Mature_2474 is represented by SEQ ID NO: 8, and Mature_2598 is represented by SEQ ID NO: It is represented by SEQ ID NO: 9, Mature_405 is represented by SEQ ID NO: 10, Mature_684 is represented by SEQ ID NO: 11, and Mature_787 may be represented by SEQ ID NO: 12.

These 174 miRNAs can be used alone or in combination of two or more types as biomarkers for lung cancer diagnosis.

More specifically, for more accurate lung cancer diagnosis among the 174 miRNAs, it is desirable to use either a single miRNA or a combination of miRNAs with a statistically significant expression difference (|fc| > 2).

According to one embodiment of the present invention, the miRNA is hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1260a, hsa-miR-1268a, hsa-miR- 1270, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-132-3p, hsa-miR-140-5p, hsa- miR-150-5p, hsa-miR-155-5p, hsa-miR-181c-5p, hsa-miR-181d-3p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR- 194-5p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-200b-5p, hsa- miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-223-3p, hsa-miR-2278, hsa-miR-2355- 5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-337-3p, hsa-miR-3605-3p, hsa-miR-3682-3p, hsa- miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-455- 3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa- miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4753-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR- 483-5p, hsa-miR-486-5p, hsa-miR-491-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-6125, hsa-miR-627-5p, hsa-miR-642b-3p, hsa-miR-652-5p, hsa-miR-660-5p, hsa-miR-6779-5p, hsa-miR- 6804-5p, hsa-miR-6807-5p, hsa-miR-6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-762, hsa-miR-765, hsa- miR-769-3p, hsa-miR-7704, hsa-miR-7854-3p, hsa-miR-885-5p, hsa-miR-940, Mature_1143, Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405 and It may be one or more types selected from the group consisting of Mature_787.

The expression level of miRNA according to the present invention can be measured in biological samples.

“Biological samples” used in the present invention include cells and tissues as well as organic biomolecules such as nucleic acids, genes, peptides, amino acids, proteins, lipids, sugars, glycolipids, and glycoproteins that are derived from living organisms and can detect biological changes. It refers to the sample containing. In the present invention, there is no limitation as long as the sample contains miRNA.

According to one embodiment of the present invention, the biological sample may be one or more types selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.

The agent may be a substance that binds to miRNA.

According to one embodiment of the present invention, the agent may be one or more selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA.

As used in the present invention, “specifically binding” means that the binding ability to the target substance is superior to that of other substances to the extent that the presence of the target substance can be detected by binding.

As used herein, a “primer” is a nucleic acid sequence with a short free 3-terminal hydroxyl group, a single-stranded oligomer that can base pair with a complementary template and serves as a starting point for copying the template strand. It means nucleotide (single strand oligonucleotide). The primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. In addition, the primer consists of sense and antisense nucleic acids with a 7 to 50 nucleotide sequence, and contains 15 to 30 nucleotides at a level that does not change the basic properties of the primer, which serves as the starting point for DNA synthesis. It may have a nucleotide sequence.

As used herein, “probe” refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, and specifically hybridizing to the target nucleotide sequence. It can exist naturally or be artificially synthesized.

Such a composition for diagnosing lung cancer can effectively diagnose lung cancer or whether lung cancer has progressed to each stage by measuring the expression level of the biomarker, that is, miRNA.

According to one embodiment of the present invention, the composition includes hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-1229-3p, and hsa-miR-125a-5p, hsa-miR-126-3p, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa- miR-1307-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR- 144-3p, hsa-miR-150-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-1976, hsa- miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-21-5p, hsa-miR-2355-5p, hsa-miR- 301a-3p, hsa-miR-301b-3p, hsa-miR-30d-5p, hsa-miR-32-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605- 3p, hsa-miR-3615, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4444, hsa-miR-4685-3p, hsa-miR-4732- 3p, hsa-miR-4787-3p, hsa-miR-484, hsa-miR-497-5p, hsa-miR-532-3p, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR- 574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511b-3p, hsa-miR-6807-5p, hsa-miR-6873-3p, 1 species selected from the group consisting of hsa-miR-766-3p, hsa-miR-769-3p, hsa-miR-7854-3p, hsa-miR-874-5p, Mature_1143, Mature_1813, Mature_2015, Mature_2474, Mature_2598 and Mature_684 It may include an agent that measures the expression level of the above-mentioned miRNA.

In particular, to improve the accuracy and reliability of stage 1 lung cancer diagnosis in benign lung tumors, hsa-miR-128-1-5p, hsa-miR-140-5p, hsa-miR-150-5p, hsa-miR-190a -5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR -2355-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p, hsa-miR-337-3p, hsa-miR-3605-3p, hsa-miR-4444 , hsa-miR-4732-3p, hsa-miR-4787-3p, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-642b-3p, hsa-miR-6807 -5p, hsa-miR-6873-3p, hsa-miR-769-3p, hsa-miR-7854-3p, Mature_1143, Mature_1813, Mature_2015, Mature_2474 and Mature_2598. It is desirable to include an agent.

According to one embodiment of the present invention, the composition includes hsa-miR-150-5p, hsa-miR-181c-5p, hsa-miR-194-5p, and hsa-miR-1972, hsa-miR-1976, hsa-miR-202-3p, hsa-miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-3605-3p, hsa-miR-4449, It may include an agent for measuring the expression level of one or more types of miRNA selected from the group consisting of hsa-miR-652-5p, hsa-miR-885-5p, Mature_1143, Mature_1719, Mature_1813 and Mature_2474.

In particular, to improve the accuracy and reliability of lung cancer stage Ⅱ diagnosis in benign lung tumors, hsa-miR-181c-5p, hsa-miR-194-5p, hsa-miR-1972, hsa-miR-1976, hsa-miR -202-3p, hsa-miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-3605-3p, hsa-miR-4449, hsa-miR-652-5p, hsa-miR-885-5p , Mature_1143, Mature_1719, Mature_1813, and Mature_2474. It is preferable to include an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of

According to one embodiment of the present invention, the composition is used to diagnose whether lung cancer has progressed from benign lung tumor to stage III. hsa-miR-101-3p, hsa-miR-122-3p, hsa-miR-1260a, hsa- miR-1268a, hsa-miR-1270, hsa-miR-128-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa-miR-132-3p, hsa-miR-144-3p, hsa- miR-155-5p, hsa-miR-15b-5p, hsa-miR-185-5p, hsa-miR-188-5p, hsa-miR-194-5p, hsa-miR-197-3p, hsa-miR- 197-5p, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20b-5p, hsa-miR-223-3p, hsa-miR-2278, hsa- miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30c-1-3p, hsa-miR-32-5p, hsa- miR-369-3p, hsa-miR-4429, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4772-5p, hsa-miR-491-5p, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-5p, hsa-miR-627-5p, hsa-miR-660-5p, hsa-miR- It may include an agent for measuring the expression level of one or more types of miRNA selected from the group consisting of 6855-5p, hsa-miR-940, Mature_1143, Mature_1719, and Mature_405.

In particular, to improve the accuracy and reliability of lung cancer stage Ⅲ diagnosis in benign lung tumors, hsa-miR-122-3p, hsa-miR-1260a, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1290 , hsa-miR-132-3p, hsa-miR-155-5p, hsa-miR-194-5p, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR -223-3p, hsa-miR-2278, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p , hsa-miR-369-3p, hsa-miR-4429, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4772 -5p, hsa-miR-491-5p, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-627-5p, hsa-miR-660-5p, hsa-miR-6855-5p, hsa -It is preferable to include an agent for measuring the expression level of at least one type of miRNA selected from the group consisting ofmiR-940, Mature_1143, Mature_1719 and Mature_405.

According to one embodiment of the present invention, the composition is used to diagnose whether lung cancer has progressed from a benign lung tumor to stage IV lung cancer. 3p, hsa-miR-1290, hsa-miR-181c-5p, hsa-miR-185-5p, hsa-miR-18a-5p, hsa-miR-193b-3p, hsa-miR-196b-5p, hsa- miR-1972, hsa-miR-200b-5p, hsa-miR-205-5p, hsa-miR-27b-5p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR-375- 3p, hsa-miR-378h, hsa-miR-4449, hsa-miR-4646-5p, hsa-miR-4732-5p, hsa-miR-4753-5p, hsa-miR-4787-3p, hsa-miR- 483-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa- miR-627-5p, hsa-miR-6516-3p, hsa-miR-6735-5p, hsa-miR-6804-5p, hsa-miR-6837-5p, hsa-miR-6873-3p, hsa-miR- 762, hsa-miR-765, hsa-miR-7847-3p, hsa-miR-8485, Mature_1175, Mature_1719, and Mature_787.

In particular, to improve the accuracy and reliability of lung cancer stage Ⅳ diagnosis in benign lung tumors, hsa-miR-1246, hsa-miR-1273c, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-181c -5p, hsa-miR-193b-3p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-200b-5p, hsa-miR-205-5p, hsa-miR-27b-5p, hsa -miR-301b-3p, hsa-miR-3158-5p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-4646-5p, hsa-miR-4732-5p, hsa-miR-4753 -5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa -miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-6125, hsa In the group consisting of -miR-627-5p, hsa-miR-6804-5p, hsa-miR-6837-5p, hsa-miR-6873-3p, hsa-miR-762, hsa-miR-765, Mature_1719 and Mature_787 It is desirable to include an agent that measures the expression level of one or more selected types of miRNA.

According to one embodiment of the present invention, the composition includes hsa-miR-101-3p, hsa-miR-122-3p, hsa-miR-1246, and hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-128-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-144-3p, hsa-miR-150-5p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa- miR-193b-3p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR- 3158-5p, hsa-miR-32-5p, hsa-miR-3605-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-423-3p, hsa-miR-4286, hsa-miR-4449, hsa-miR-4716-3p, hsa-miR-4749-5p, hsa-miR-4787-3p, hsa-miR-532-5p, hsa-miR-5585- 3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-627-5p, hsa-miR-642b-3p, hsa-miR- A group consisting of 660-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-769-3p, Mature_1143, Mature_1719, Mature_1813, Mature_2474, Mature_405 and Mature_787. It may include an agent that measures the expression level of one or more types of miRNA selected from.

In particular, to improve the accuracy and reliability of lung cancer stage I to IV diagnosis in benign lung tumors, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-128-1-5p, hsa-miR-1290 , hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-301b-3p, hsa-miR-3605 -3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-4749-5p, hsa-miR-4787-3p, hsa-miR-5585-3p, hsa-miR-610, hsa -An agent for measuring the expression level of at least one type of miRNA selected from the group consisting ofmiR-6125, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-769-3p, Mature_1143, Mature_1719 and Mature_787 It is desirable to include it.

According to one embodiment of the present invention, the composition is used to diagnose whether lung cancer progresses from benign lung tumor to stage I or II lung cancer. hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-128- 1-5p, hsa-miR-1292-5p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-150- 5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR- 202-3p, hsa-miR-20a-3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-301a-3p, hsa-miR-301b- 3p, hsa-miR-30d-5p, hsa-miR-32-5p, hsa-miR-335-5p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa- miR-369-3p, hsa-miR-423-3p, hsa-miR-4286, hsa-miR-4444, hsa-miR-4685-3p, hsa-miR-4732-3p, hsa-miR-484, hsa- miR-532-3p, hsa-miR-5585-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511b- 1 species selected from the group consisting of 3p, hsa-miR-6807-5p, hsa-miR-6873-3p, hsa-miR-769-3p, hsa-miR-874-5p, Mature_1143, Mature_1813, Mature_2474, Mature_2598 and Mature_684 It may include an agent that measures the expression level of the above-mentioned miRNA.

In particular, to improve the accuracy and reliability of lung cancer stage I and II diagnosis in benign lung tumors, hsa-miR-128-1-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, and hsa-miR -1972, hsa-miR-1976, hsa-miR-202-3p, hsa-miR-20a-3p, hsa-miR-2355-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa -miR-3605-3p, hsa-miR-369-3p, hsa-miR-4444, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-6807-5p, hsa-miR-6873-3p , hsa-miR-769-3p, Mature_1143, Mature_1813, Mature_2474, and Mature_2598.

According to one embodiment of the present invention, the composition includes hsa-miR-101-3p, hsa-miR-122-3p, hsa-miR-1246, and hsa-miR-1260a, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa- miR-144-3p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197- 5p, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-200b-5p, hsa-miR-202-3p, hsa-miR-205-5p, hsa- miR-20b-5p, hsa-miR-2278, hsa-miR-27a-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30e-5p, hsa-miR-3158- 5p, hsa-miR-32-5p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR- 4716-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4753-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-486- 5p, hsa-miR-5010-5p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR- 6516-3p, hsa-miR-660-5p, hsa-miR-6735-5p, hsa-miR-6855-5p, hsa-miR-765, hsa-miR-766-5p, hsa-miR-7847-3p, It may include an agent for measuring the expression level of one or more types of miRNA selected from the group consisting of hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1719, Mature_405 and Mature_787.

In particular, to improve the accuracy and reliability of lung cancer stage III and IV diagnosis in benign lung tumors, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1268a, hsa-miR-1290, hsa-miR -193b-3p, hsa-miR-1972, hsa-miR-200b-5p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-2278, hsa-miR-301b-3p, hsa -miR-3158-5p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-455-3p, hsa-miR-4716-3p, hsa-miR-4749-5p, hsa-miR-4753 -5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-627-5p, hsa-miR-6855-5p, hsa It is preferable to include an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of -miR-765, hsa-miR-940, Mature_1143, Mature_1719, Mature_405 and Mature_787.

According to one embodiment of the present invention, the composition contains hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR- to diagnose whether lung cancer has progressed from stage I and II to lung cancer stage III and IV. 1246, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-140-5p, hsa-miR-150-3p, hsa-miR-181d-3p, hsa- miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-200c-3p, hsa-miR-205-5p, hsa-miR-2110, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-30d-5p, hsa- miR-30e-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-342-3p, hsa-miR- 3615, hsa-miR-3682-3p, hsa-miR-375-3p, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-4444, hsa-miR-4492, hsa-miR- 4525, hsa-miR-455-3p, hsa-miR-4669, hsa-miR-4685-3p, hsa-miR-4701-5p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa- miR-4750-5p, hsa-miR-4772-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-5100, hsa-miR-627-5p, hsa-miR-642a-3p, hsa-miR-6511a-3p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6837-5p, hsa- miR-765, hsa-miR-7704, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1655, Mature_1719, Mature_1813, Mature_1850, Mature_2015, It may include an agent for measuring the expression level of one or more types of miRNA selected from the group consisting of Mature_2474, Mature_2598, Mature_684, and Mature_787.

In particular, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1290 to improve the accuracy and reliability of lung cancer stage Ⅲ and Ⅳ diagnosis in lung cancer stage Ⅰ and Ⅱ. , hsa-miR-181d-3p, hsa-miR-200c-3p, hsa-miR-205-5p, hsa-miR-3200-5p, hsa-miR-3682-3p, hsa-miR-375-3p, hsa -miR-4444, hsa-miR-4492, hsa-miR-455-3p, hsa-miR-4669, hsa-miR-4701-5p, hsa-miR-4732-3p, hsa-miR-4750-5p, hsa -miR-4772-3p, hsa-miR-486-5p, hsa-miR-5100, hsa-miR-6779-5p, hsa-miR-6837-5p, hsa-miR-765, hsa-miR-7704, Mature_1719 , Mature_1850, Mature_2015, Mature_2598, and Mature_787.

Another aspect of the present invention provides a kit for diagnosing lung cancer, including the composition for diagnosing lung cancer described above.

“Lung cancer diagnostic kit” used in the present invention refers to a substance that can diagnose lung cancer or the progress of each stage of lung cancer through biological samples collected from test subjects, thereby quickly, accurately, and conveniently diagnosing lung cancer. can do. In the present invention, the lung cancer diagnostic kit includes an agent capable of measuring the expression level of miRNA, and the agent preferably includes a primer or primer set.

According to one embodiment of the present invention, the kit may further include a reagent for nucleic acid amplification.

The nucleic acid amplification reagent may include conventional PCR reagents known in the art, and examples may include nucleoside triphosphate, (deoxy)ribonuclease inhibitor, heat-stable polymerase, and reaction buffer. may, but is not limited to this.

The nucleoside triphosphate refers to a molecule in which a purine-based or pyrimidine-based nucleoside is bound to ribose or deoxyribose and is bound to three phosphate groups, (deoxyribose ) Adenosine triphosphate ((deoxy)adenosine triphosphate, ATP or dATP), (deoxy)guanosine triphosphate ((deoxy)guanosine triphosphate, GTP or dGTP), (deoxy)cytidine triphosphate ((deoxy)cytidine triphosphate , CTP or dCTP) and (deoxy)thymidine triphosphate (TTP or dTTP).

The reaction buffer may be Taq polymerase buffer, PCR buffer, etc., and is a compound added to the amplification reaction that changes the stability, activity, and/or longevity of one or more components of the amplification reaction by adjusting the pH of the amplification reaction. This reaction buffer may further contain additives to optimize efficient PCR reaction.

According to one embodiment of the present invention, the kit may be one or more types selected from the group consisting of PCR, RT-PCR kit, real-time PCR kit, and microarray chip kit.

According to one embodiment of the present invention, the kit may further include a reagent for nucleic acid isolation.

The nucleic acid isolation reagent is a typical RNA or miRNA extraction reagent known in the art, and may include salts capable of cell lysis, surfactants, metal ions, sugars, reducing agents (e.g., DTT), etc. .

The kit according to the present invention may include a diagnostic kit based on conventional quantitative gene analysis without limitation.

For example, when the kit is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs. In addition, the kit according to the present invention can be manufactured in a number of separate packaging or compartments containing the above-mentioned reagent components, and the kit according to the present invention is a diagnostic kit containing the essential elements required to perform DNA or RNA chipping. It can be.

Another aspect of the invention includes a) collecting a biological sample from an individual in need of diagnosis; b) In the biological sample, hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1229-3p, hsa-miR- 1246, hsa-miR-125a-5p, hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1273c, hsa-miR-128-1- 5p, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa- miR-130a-3p, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR- 144-3p, hsa-miR-150-3p, hsa-miR-150-5p, hsa-miR-155-5p, hsa-miR-15b-5p, hsa-miR-181c-5p, hsa-miR-181d- 3p, hsa-miR-185-5p, hsa-miR-188-5p, hsa-miR-18a-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-194-5p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a- 3p, hsa-miR-19b-3p, hsa-miR-200b-5p, hsa-miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-2110, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR- 2278, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30c-1-3p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-337-3p, hsa- miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4685-3p, hsa- miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR- 4753-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-491-5p, hsa-miR-497-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR- 519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa- miR-627-5p, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511a-3p, hsa-miR-6511b-3p, hsa-miR-6516-3p, hsa-miR- 652-5p, hsa-miR-660-5p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6804-5p, hsa-miR-6807- 5p, hsa-miR-6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-762, hsa-miR-765, hsa-miR- 766-3p, hsa-miR-766-5p, hsa-miR-769-3p, hsa-miR-7704, hsa-miR-7847-3p, hsa-miR-7854-3p, hsa-miR-8485, hsa- miR-874-5p, hsa-miR-885-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1655, Measuring the expression level of one or more types of miRNA selected from the group consisting of Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684 and Mature_787; and c) providing a method of providing information for lung cancer diagnosis, including the step of comparing the measured miRNA expression level with a control group.

The above steps a) to c) will be discussed in detail below, and description of content in common with the above-described content will be omitted to avoid excessive complexity.

Step a) is a process of collecting biological samples from a subject who needs to be tested for lung cancer or to determine the stage of lung cancer.

According to one embodiment of the present invention, the biological sample in step a) may be one or more types selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.

Step b) is a process of measuring the presence or absence of biomarker miRNA and the expression level in the biological sample.

According to one embodiment of the present invention, the level of miRNA expression in step b) is determined by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease It may be measured by one or more methods selected from the group consisting of nuclease protection assay, in situ hybridization, microarray, and Northern blot.

It is preferable to use the composition or kit for diagnosing lung cancer according to the present invention described above to determine the level of expression of this miRNA.

Step c) is a process of determining whether lung cancer has occurred or the stage of lung cancer by comparing the level of miRNA expression measured in the biological sample with the control group.

According to one embodiment of the present invention, the control group may be a patient with a benign lung tumor, a patient with stage III or IV lung cancer, or a biological sample obtained therefrom.

According to one embodiment of the present invention, step c) may be to diagnose lung cancer when the individual's miRNA expression level is higher or lower than that of the control group based on fc according to statistical analysis.

More specifically, step c) is performed in an individual by performing hsa-miR-1229-3p, hsa-miR-125a-5p, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-1292-5p , hsa-miR-1306-5p, hsa-miR-1307-3p, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR -1976, hsa-miR-30d-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-423-3p, hsa -miR-4286, hsa-miR-4685-3p, hsa-miR-4732-3p, hsa-miR-4787-3p, hsa-miR-484, hsa-miR-532-3p, hsa-miR-551a, hsa -miR-5585-3p, hsa-miR-6511b-3p, hsa-miR-6873-3p, hsa-miR-766-3p, hsa-miR-769-3p, hsa-miR-7854-3p, hsa-miR -874-5p, Mature_1143, and Mature_2015, the expression level of one or more miRNAs selected from the group is higher than the control group, or hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-126 in the individual -3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-144-3p , hsa-miR-190a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-21-5p, hsa -miR-2355-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p, hsa-miR-424-5p, hsa-miR-4444, hsa-miR-497 -5p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6807-5p, Mature_684, Mature_1813, Mature_2474 and Mature_2598. If the expression level of one or more types of miRNA selected from the group is lower than that of the control group, progression from a benign lung tumor to stage I lung cancer may be diagnosed.

Additionally, step c) may be performed in an individual by performing hsa-miR-150-5p, hsa-miR-194-5p, hsa-miR-1972, hsa-miR-1976, hsa-miR-3605-3p, and hsa-miR-4449. , the expression level of one or more miRNAs selected from the group consisting of hsa-miR-885-5p, Mature_1143, and Mature_1719 is higher than that of the control group, or hsa-miR-181c-5p, hsa-miR-202-3p, and hsa in the individual. -If the expression level of one or more miRNAs selected from the group consisting of -miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-652-5p, Mature_1813, and Mature_2474 is lower than that of the control group, the lung tumor changes from benign lung tumor to lung cancer stage II. It may be to diagnose the progression of .

Additionally, step c) may be performed in an individual by performing hsa-miR-122-3p, hsa-miR-1268a, hsa-miR-128-3p, hsa-miR-1290, hsa-miR-132-3p, and hsa-miR-155. -5p, hsa-miR-15b-5p, hsa-miR-194-5p, hsa-miR-197-3p, hsa-miR-1976, hsa-miR-223-3p, hsa-miR-27a-5p, hsa -miR-29a-3p, hsa-miR-30c-1-3p, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4772-5p, hsa-miR-491-5p, hsa-miR -551a, hsa-miR-5585-3p, hsa-miR-627-5p, hsa-miR-940, Mature_405, Mature_1143 and Mature_1719, the expression level of one or more types of miRNA is higher than the control group, or the individual hsa-miR-101-3p, hsa-miR-1260a, hsa-miR-1270, hsa-miR-130a-3p, hsa-miR-144-3p, hsa-miR-185-5p, hsa-miR-188 -5p, hsa-miR-197-5p, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20b-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa -miR-301b-3p, hsa-miR-32-5p, hsa-miR-369-3p, hsa-miR-4429, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-574 If the expression level of one or more types of miRNA selected from the group consisting of -5p, hsa-miR-660-5p, and hsa-miR-6855-5p is lower than that of the control group, progression from benign lung tumor to stage III lung cancer may be diagnosed. .

Additionally, step c) may be performed in an individual in hsa-miR-1246, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-193b-3p, hsa -miR-1972, hsa-miR-200b-5p, hsa-miR-205-5p, hsa-miR-375-3p, hsa-miR-4449, hsa-miR-4787-3p, hsa-miR-483-5p , hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR -523-5p, hsa-miR-5585-3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-6516-3p, hsa-miR-6837-5p, hsa-miR-6873-3p , the expression level of one or more miRNAs selected from the group consisting of hsa-miR-762, hsa-miR-765, hsa-miR-7847-3p, hsa-miR-8485, Mature_787, Mature_1175 and Mature_1719 is higher than the control group, or hsa-miR-181c-5p, hsa-miR-185-5p, hsa-miR-18a-5p, hsa-miR-196b-5p, hsa-miR-27b-5p, hsa-miR-301b-3p in the individual. , hsa-miR-3158-5p, hsa-miR-378h, hsa-miR-4646-5p, hsa-miR-4732-5p, hsa-miR-4753-5p, hsa-miR-5010-5p, hsa-miR -543, hsa-miR-610, hsa-miR-6125, hsa-miR-6735-5p, and hsa-miR-6804-5p. Lung benign tumor when the expression level of one or more types of miRNAs is lower than that of the control group. It may be a diagnosis of progression from lung cancer to stage IV.

In addition, step c) is performed in an individual in hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-128- 3p, hsa-miR-1290, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-205- 5p, hsa-miR-3605-3p, hsa-miR-375-3p, hsa-miR-423-3p, hsa-miR-4286, hsa-miR-4449, hsa-miR-4787-3p, hsa-miR- 1 species selected from the group consisting of 5585-3p, hsa-miR-574-3p, hsa-miR-627-5p, hsa-miR-6873-3p, hsa-miR-769-3p, Mature_405, Mature_787, Mature_1143 and Mature_1719 The expression level of the above miRNAs is higher than that of the control group, or the individual has hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-1260a, hsa-miR-130a-3p, hsa-miR-130b- 3p, hsa-miR-144-3p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa-miR-196b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-20a-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR- 32-5p, hsa-miR-369-3p, hsa-miR-378h, hsa-miR-4716-3p, hsa-miR-4749-5p, hsa-miR-532-5p, hsa-miR-574-5p, A group consisting of hsa-miR-610, hsa-miR-6125, hsa-miR-642b-3p, hsa-miR-660-5p, hsa-miR-6855-5p, hsa-miR-7-5p, Mature_1813 and Mature_2474. If the expression level of one or more selected types of miRNA is lower than that of the control group, progression from benign lung tumor to lung cancer stage I to IV may be diagnosed.

Additionally, step c) may be performed in an individual in hsa-miR-128-1-5p, hsa-miR-1292-5p, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa -miR-1976, hsa-miR-30d-5p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-423-3p, hsa-miR-4286, hsa -miR-4685-3p, hsa-miR-4732-3p, hsa-miR-484, hsa-miR-532-3p, hsa-miR-5585-3p, hsa-miR-6511b-3p, hsa-miR-6873 -3p, hsa-miR-769-3p, hsa-miR-874-5p, and Mature_1143, the expression level of one or more types of miRNAs is higher than that of the control group, or hsa-miR-101-3p, hsa in the individual -miR-126-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-190a-5p, hsa-miR -196b-5p, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20a-3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa-miR-26b -5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p, hsa-miR-335-5p, hsa-miR-369-3p, hsa-miR-4444, hsa 1 selected from the group consisting of -miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6807-5p, Mature_684, Mature_1813, Mature_2474 and Mature_2598 If the expression level of more than one type of miRNA is lower than that of the control group, it may be a diagnosis of progression from a benign lung tumor to lung cancer stages I and II.

In addition, step c) may be performed in an individual by performing hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-200b-5p, hsa-miR-205-5p, hsa-miR-27a-5p, hsa-miR-375-3p, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR- 5585-3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-6516-3p, hsa-miR-765, hsa-miR-7847-3p, hsa-miR-940, Mature_405, Mature_787, The expression level of one or more miRNAs selected from the group consisting of Mature_1143, Mature_1175, and Mature_1719 is higher than that of the control group, or hsa-miR-101-3p, hsa-miR-1260a, hsa-miR-130a-3p, hsa- miR-144-3p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa-miR-197-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR- 202-3p, hsa-miR-20b-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30e-5p, hsa-miR-3158-5p, hsa-miR-32-5p, hsa-miR-378h, hsa-miR-4646-5p, hsa-miR-4716-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR- 4753-5p, hsa-miR-486-5p, hsa-miR-5010-5p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-660-5p, hsa-miR-6735-5p, When the expression level of at least one type of miRNA selected from the group consisting of hsa-miR-6855-5p, hsa-miR-766-5p, and hsa-miR-92b-5p is lower than that of the control group, it can change from a benign lung tumor to lung cancer stages III and IV. It may be a diagnosis of progression.

In addition, step c) may be performed in an individual by performing hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-140- 5p, hsa-miR-199b-5p, hsa-miR-200c-3p, hsa-miR-205-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-335-5p, hsa-miR-375-3p, hsa-miR-4444, hsa-miR-4492, hsa-miR-455- 3p, hsa-miR-4772-3p, hsa-miR-483-5p, hsa-miR-5100, hsa-miR-627-5p, hsa-miR-642a-3p, hsa-miR-6779-5p, hsa- The expression level of one or more miRNAs selected from the group consisting of miR-6837-5p, hsa-miR-765, hsa-miR-7704, hsa-miR-940, Mature_684, Mature_787, Mature_1719, Mature_1813, Mature_1850, Mature_2474 and Mature_2598 was compared to the control group. higher compared to, or in an individual, hsa-miR-1292-5p, hsa-miR-150-3p, hsa-miR-181d-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR- 2110, hsa-miR-27b-5p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-329-3p, hsa-miR-342-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-4525, hsa-miR-4669, hsa-miR-4685-3p, hsa-miR-4701-5p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4750-5p, hsa-miR-484, hsa-miR- 486-5p, hsa-miR-6511a-3p, hsa-miR-6735-5p, hsa-miR-6780a-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b- If the expression level of one or more types of miRNA selected from the group consisting of 5p, Mature_1655, and Mature_2015 is lower than that of the control group, progression from lung cancer I and II to lung cancer stages III and IV may be diagnosed.

The present invention provides a composition and kit for lung cancer diagnosis by presenting a new biomarker that can predict lung cancer, enabling rapid and accurate diagnosis of lung cancer or progression of each stage of lung cancer, and providing treatment tailored to the patient's condition. there is.

Figure 1 shows the number of mature miRNAs commonly observed in all 76 samples according to an embodiment of the present invention.
Figure 2 shows the expression distribution of each sample based on original data (number of reads), log transformation of reads per million (CPM), and TMN normalization according to an embodiment of the present invention.
Figure 3 shows the expression density of each sample based on original data (number of reads), log transformation to reads per million (CPM), and TMN normalization according to an embodiment of the present invention.
Figure 4 shows the similarity between each sample using the Pearson correlation coefficient for normal values according to an embodiment of the present invention.
Figure 5 shows hierarchical clustering analysis using normal values according to an embodiment of the present invention.
Figure 6 shows multidimensional scale analysis using normal values according to an embodiment of the present invention.
Figure 7 shows up- and down-regulated maturation based on fold change (fc) or p value between lung benign tumor patients and lung cancer patients at each stage, or groups of lung cancer patients at different stages, according to an embodiment of the present invention. This indicates the number of miRNAs.
Figure 8 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage I patients according to an embodiment of the present invention, and (c) expression difference compared to lung benign tumor patients. This shows the miRNA with .
Figure 9 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage II patients according to an embodiment of the present invention, and (c) expression difference compared to lung benign tumor patients. This shows the miRNA with .
Figure 10 shows (a) expression level, (b) log-transformed fc and p value between a patient with a benign lung tumor and a patient with stage III lung cancer according to an embodiment of the present invention, and (c) the difference in expression compared to a patient with a benign lung tumor. This shows the miRNA with .
Figure 11 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage IV patients according to an embodiment of the present invention, and (c) expression difference compared to lung benign tumor patients. This shows the miRNA with .
Figure 12 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage I to IV patients according to an embodiment of the present invention, and (c) compared to lung benign tumor patients. This shows miRNAs with expression differences.
Figure 13 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage I and II patients according to an embodiment of the present invention, and (c) compared to lung benign tumor patients. This shows miRNAs with expression differences.
Figure 14 shows (a) expression levels, (b) log-transformed fc and p values between lung benign tumor patients and lung cancer stage III and IV patients according to an embodiment of the present invention, and (c) compared to lung benign tumor patients. This shows miRNAs with expression differences.
Figure 15 shows (a) expression levels, (b) log-transformed fc and p values, and (c) lung cancer stages I and II between patients with lung cancer stages I and II and patients with lung cancer stages III and IV according to an embodiment of the present invention. This shows miRNAs that have differences in expression compared to patients with pre-existing conditions.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example: Discovery of new biomarkers for lung cancer diagnosis

1. Population selection

As shown in Table 1 below, a total of 76 patients, including 16 patients with benign lung tumor and 60 patients with non-small cell lung cancer (19 in stage I, 8 in stage II, 12 in stage III, and 21 in stage IV). A population was formed.

Sample ID division Sample ID division One 4006619 Benign 39 4532445 Stage_II 2 4103192 Benign 40 4534027 Stage_II 3 4172239 Benign 41 4567274 Stage_II 4 4236094 Benign 42 4669646 Stage_II 5 4271568 Benign 43 4791242 Stage_II 6 4314471 Benign 44 4068379 Stage_III 7 4334375 Benign 45 4155585 Stage_III 8 4391575 Benign 46 4180209 Stage_III 9 4408692 Benign 47 4268049 Stage_III 10 4424174 Benign 48 4409174 Stage_III 11 4474392 Benign 49 4567035 Stage_III 12 4586291 Benign 50 4603564 Stage_III 13 4640924 Benign 51 4665304 Stage_III 14 4644712 Benign 52 4679389 Stage_III 15 4673798 Benign 53 4695689 Stage_III 16 4680558 Benign 54 4779112 Stage_III 17 4054929 Stage_I 55 4782336 Stage_III 18 4075789 Stage_I 56 4024928 Stage IV 19 4090738 Stage_I 57 4059680 Stage IV 20 4110230 Stage_I 58 4060899 Stage IV 21 4133089 Stage_I 59 4099268 Stage IV 22 4149930 Stage_I 60 4101703 Stage IV 23 4249410 Stage_I 61 4129269 Stage IV 24 4314799 Stage_I 62 4241478 Stage IV 25 4372700 Stage_I 63 4301201 Stage IV 26 4381670 Stage_I 64 4369328 Stage IV 27 4387656 Stage_I 65 4383927 Stage IV 28 4504906 Stage_I 66 4392052 Stage IV 29 4586223 Stage_I 67 4395886 Stage IV 30 4670761 Stage_I 68 4422704 Stage IV 31 4681094 Stage_I 69 4476920 Stage IV 32 4700074 Stage_I 70 4499598 Stage IV 33 4712962 Stage_I 71 4532993 Stage IV 34 4716039 Stage_I 72 4563283 Stage IV 35 4767744 Stage_I 73 4572566 Stage IV 36 4046017 Stage_II 74 4590443 Stage IV 37 4203999 Stage_II 75 4741122 Stage IV 38 4223348 Stage_II 76 4794201 Stage IV

2. miRNA sequence analysis

To analyze gene expression patterns between lung benign tumor patients and lung cancer patients at each stage, or between groups of lung cancer patients at different stages, exosomes were isolated from the patient's blood and exosome miRNA sequencing was performed.

2-1. Exosome and RNA isolation

Exosome isolation was performed using the miRCURY® Exosome Serum/Plasma Kit (cat 76603, Qiagen) according to the manufacturer's instructions. 1 mL of serum was placed in a 2 mL microcentrifuge tube and centrifuged at 3,000 g (approximately 2,000 rpm) for 5 to 10 minutes to obtain a cell-free sample. Afterwards, 1 mL of sample and 400 uL of precipitation buffer A were added to the tube, the tube cap was closed, and vortexing was performed for 5 seconds. The tube was then incubated at 2 to 8°C for 60 minutes and then centrifuged at 1,500 g for 30 minutes at 20°C. The supernatant was discarded or stored as needed. The pellet was centrifuged again and the remaining supernatant was discarded. 255 uL of resuspension buffer was added to the tube containing the pellet and then vortexed (remaining volume approximately 300 uL).

Total RNA, including miRNA, was extracted using the miRNeasy Serum/Plasma Kit (cat 217184, Qiagen) according to the manufacturer's instructions, and eluted using 20 uL of RNase-free water.

2-2. NGS

Each library was constructed using RNA (10 ng). First, a small RNA library was created using the SMARTer smRNA-Seq Kit (Illumina, Takara Bio), followed by polyadenylation, complementary DNA (cDNA) synthesis, and PCR amplification process. Library sequencing was performed. Library quality was measured with an Agilent 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed using the same mole for each library using the Illumina HiSeq 2500 instrument (Illumina) to produce reads of 51 bp in length. Image decomposition and quality value calculation were performed using the Illumina pipeline module. To identify miRNAs, clustered reads were aligned to the reference genome of miRBase v22.1. MiRNAs that had not previously been reported were judged to be new miRNAs, and as a result, 6,527 mature miRNAs were selected out of a total of 76 patient samples.

3. Data analysis

3-1. Data preprocessing and quality checking

Data pre-processing and quality check were performed to exclude low-quality data for each mature miRNA and sample from the raw data.

First, out of 6,527 mature miRNAs (original data) among a total of 76 patient samples, 5,397 were not observed at all in all samples, and mature miRNAs with an O value of more than 51% of the total samples were excluded. Therefore, 661 mature miRNAs (processed data) commonly observed in more than 38 samples were used for analysis (Figure 1). Afterwards, data transformation and normalization were performed to reduce systematic bias in the data that may affect biological meaning in comparisons between samples. The read size of the original data was estimated using the calcNormFactors method, the number of reads was log-transformed into counts per million reads (CPM), and this was normalized using the Trimmed mean of M-values (TMM) method (Figure 2). Here, 1 was added to the CPM or normalized number of reads to prevent negative values. Then, the raw data, log-transformed and TMM normalized were visualized to show the expression density per sample (Figure 3). To analyze the correlation between each sample, the similarity between each sample was determined using Pearson's coefficient (r) of the normalized value for each sample. The correlation coefficient (r) was found to range from about 0.8 to 1.0 (Figure 4). Subsequently, in the hierarchical clustering analysis, samples with high expression similarity were grouped using the normal value of each sample (Figure 5). Here, the distance metric is Euclidean distance, and the connection method As a linkage method, complete linkage was used to measure the similarity between samples in two dimensions using the normal value of each sample through multidimensional scaling (MDS) analysis. It was shown in a graph (FIG. 6). In the graph, the presence or absence of samples with outliers and the similarity of expression patterns between groups were confirmed.

3-2. statistical analysis

Statistical analysis (fold change and exactTest) was performed on 661 mature miRNAs to identify up- and down-regulated mature miRNAs between lung benign tumor patients and lung cancer patients at each stage, or between groups of lung cancer patients at different stages. Based on fold change (fc) |fc| Mature miRNAs with ≥ 1.1 were selected, and among them, 174 mature miRNAs that satisfied the condition of exactTest initial p value (raw.p) < 0.05 were selected as significant data (Figure 7 and Table 2 below). The core data included 162 previously reported mature miRNAs and 13 new mature miRNAs identified for the first time in this sequence analysis, and the sequences of the new mature miRNAs are shown in Table 3 below.

|fc| ≥1.1, Raw.p < 0.05 mature miRNA hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1229-3p, hsa-miR-1246, hsa-miR- 125a-5p, hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR- 128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa- miR-150-3p, hsa-miR-150-5p, hsa-miR-155-5p, hsa-miR-15b-5p, hsa-miR-181c-5p, hsa-miR-181d-3p, hsa-miR- 185-5p, hsa-miR-188-5p, hsa-miR-18a-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-194-5p, hsa-miR-196b- 5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR- 19b-3p, hsa-miR-200b-5p, hsa-miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-20a- 5p, hsa-miR-20b-5p, hsa-miR-2110, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR-2278, hsa-miR- 2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b- 3p, hsa-miR-30c-1-3p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200- 3p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-3940- 3p, hsa-miR-409-3p, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4685-3p, hsa-miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4753-5p, hsa- miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-491- 5p, hsa-miR-497-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa- miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511a-3p, hsa-miR-6511b-3p, hsa-miR-6516-3p, hsa-miR-652-5p, hsa- miR-660-5p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6804-5p, hsa-miR-6807-5p, hsa-miR- 6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-762, hsa-miR-765, hsa-miR-766-3p, hsa- miR-766-5p, hsa-miR-769-3p, hsa-miR-7704, hsa-miR-7847-3p, hsa-miR-7854-3p, hsa-miR-8485, hsa-miR-874-5p, hsa-miR-885-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1655, Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684, and Mature_787 * hsa-miR is a mature miRNA reported in the standard genome, and Mature is a sequence predicted to be a new miRNA.

Novel mature miRNA Base sequence (5'-3') sequence number Mature_405 GGGGGAGGGGGTAAAAAAAAA One Mature_684 GGAAGAGGGGGACAAAAAAT 2 Mature_787 GGATTTTTGGAGCAGAGC 3 Mature_1143 GGGGGAAAAGGGAGGGGAGC 4 Mature_1175 AGGGAAGAGAGAGGGTGGGGG 5 Mature_1655 TCAGGCTCAGTCCCTCCAT 6 Mature_1719 AGGATTTTTGGAGTAGGGAAAG 7 Mature_1813 GGAGGCCATGGGGTTGGGG 8 Mature_1850 GGGAGGGAGGGAAGAAAGC 9 Mature_2015 AGCTCCCTGGGGACACAG 10 Mature_2474 GGAGGCCATGGGGTTGGGG 11 Mature_2598 CATAGTGAAGAAGTACAGCC 12

Expression levels between each patient or group were compared (FIGS. 8 to 13 a), and fc and p values were log-transformed (FIGS. 8 to 13 b). Additionally, a scatterplot was used to identify miRNAs with large expression differences compared to each patient or group according to the overall average expression level (Figures 8 to 13, c).

① Comparison of patients with benign lung tumors and patients with stage I lung cancer

Referring to Figure 8 and Table 4 below, 65 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences in lung cancer stage I patients compared to lung benign tumor patients were identified, which indicates arsenic in lung benign tumor. It can be used as a biomarker to check whether cell lung cancer has progressed to stage I. In particular, among the 65, 32 mature miRNAs (|fc| > 2, p < 0.05) with an expression level fc exceeding twice that of patients with lung benign tumors are expected to improve the accuracy and reliability of diagnosis of stage I non-small cell lung cancer. do.

fc Raw.p fc Raw.p hsa-let-7a-3p -1.921943 0.04260248 hsa-miR-342-3p 1.635771 0.01933692 hsa-miR-101-3p -1.827960 0.01620998 hsa-miR-3605-3p 2.608835 0.0178025 hsa-miR-1229-3p 1.856418 0.00811644 hsa-miR-3615 1.713999 0.01084177 hsa-miR-125a-5p 1.625584 0.02392168 hsa-miR-423-3p 1.536300 0.02223424 hsa-miR-126-3p -1.749851 0.00835725 hsa-miR-424-5p -1.702028 0.01779007 hsa-miR-1273c 1.675677 0.04477757 hsa-miR-4286 1.495907 0.03879967 hsa-miR-128-1-5p 3.020683 0.0266721 hsa-miR-4444 -5.595616 0.0033884 hsa-miR-1292-5p 1.573131 0.04226265 hsa-miR-4685-3p 1.937249 0.02618558 hsa-miR-1306-5p 1.721519 0.01898721 hsa-miR-4732-3p 2.137773 0.01885944 hsa-miR-1307-3p 1.521507 0.0406114 hsa-miR-4787-3p 2.541242 0.03094866 hsa-miR-130a-3p -1.757929 0.00392408 hsa-miR-484 1.886950 0.00715291 hsa-miR-130b-3p -1.527529 0.01717469 hsa-miR-497-5p -1.868766 0.01652402 hsa-miR-140-5p -2.125319 0.02686519 hsa-miR-532-3p 1.602984 0.03328379 hsa-miR-142-3p -1.640727 0.04723954 hsa-miR-551a 2.912375 0.03380565 hsa-miR-142-5p -1.605583 0.02212365 hsa-miR-5585-3p 3.353633 0.00748693 hsa-miR-144-3p -1.759856 0.03949094 hsa-miR-574-5p -1.441985 0.04777366 hsa-miR-150-5p 2.054288 0.00435576 hsa-miR-610 -2.552285 0.03805932 hsa-miR-190a-5p -2.139476 0.0219698 hsa-miR-642a-3p -1.940809 0.02480929 hsa-miR-193b-3p 2.591561 0.03585555 hsa-miR-642b-3p -2.056969 0.02016814 hsa-miR-1972 1.574957 0.04553415 hsa-miR-6511b-3p 1.811335 0.01092276 hsa-miR-197-3p 2.508958 0.01247086 hsa-miR-6807-5p -3.167821 0.00453051 hsa-miR-1976 2.974383 0.00197352 hsa-miR-6873-3p 2.213938 0.04248261 hsa-miR-199b-5p -2.099217 0.02011139 hsa-miR-766-3p 1.485459 0.04651319 hsa-miR-19a-3p -2.132247 0.00473096 hsa-miR-769-3p 3.260243 0.00484425 hsa-miR-19b-3p -1.592292 0.04767906 hsa-miR-7854-3p 2.149008 0.02209981 hsa-miR-202-3p -3.907837 0.00689685 hsa-miR-874-5p 1.962014 0.03044189 hsa-miR-21-5p -1.668566 0.02192223 Mature_684 -1.821879 0.01588386 hsa-miR-2355-5p -2.240412 0.02403755 Mature_1143 5.215317 0.01201872 hsa-miR-301a-3p -2.076614 0.01630311 Mature_1813 -2.075045 0.02729305 hsa-miR-301b-3p -4.390737 3.9245E-05 Mature_2015 3.611357 0.04214781 hsa-miR-30d-5p 1.759323 0.02460907 Mature_2474 -2.075046 0.02737747 hsa-miR-32-5p -2.402131 0.00924355 Mature_2598 -4.301736 0.01659154 hsa-miR-337-3p 2.866369 0.039027

② Comparison of patients with benign lung tumors and patients with stage Ⅱ lung cancer

Referring to Figure 9 and Table 5 below, 16 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences in lung cancer stage Ⅱ patients compared to lung benign tumor patients were identified, which indicates arsenic in lung benign tumor. It can be used as a biomarker to check whether cellular lung cancer has progressed to stage II. In particular, among the 16, 15 mature miRNAs (|fc| > 2, p < 0.05) whose expression level fc exceeds twice that of patients with benign lung tumors are expected to improve the accuracy and reliability of diagnosis of stage Ⅱ non-small cell lung cancer. do.

fc Raw.p fc Raw.p hsa-miR-150-5p 1.708485 0.04252947 hsa-miR-3605-3p 2.643681 0.02878732 hsa-miR-181c-5p -2.480737 0.01963994 hsa-miR-4449 2.142989 0.02096176 hsa-miR-194-5p 2.321293 0.01488002 hsa-miR-652-5p -2.723077 0.02505583 hsa-miR-1972 2.244449 0.02845778 hsa-miR-885-5p 4.427234 0.00258536 hsa-miR-1976 3.143707 0.00379067 Mature_1143 4.657929 0.01232045 hsa-miR-202-3p -5.643874 0.01089312 Mature_1719 2.544308 0.01364354 hsa-miR-301b-3p -3.070993 0.03230777 Mature_1813 -2.834473 0.03105247 hsa-miR-3150b-3p -3.881407 0.0187338 Mature_2474 -2.834475 0.03114825

③ Comparison of patients with benign lung tumors and patients with stage Ⅲ lung cancer

Referring to Figure 10 and Table 6 below, 47 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences in lung cancer stage Ⅲ patients compared to lung benign tumor patients were identified, which indicates arsenic in lung benign tumor. It can be used as a biomarker to check whether cell lung cancer has progressed to stage III. In particular, among the 47, 35 mature miRNAs (|fc| > 2, p < 0.05) with an expression level fc exceeding twice that of patients with lung benign tumors are expected to improve the accuracy and reliability of diagnosis of stage Ⅲ non-small cell lung cancer. do.

fc Raw.p fc Raw.p hsa-miR-101-3p -1.890380 0.02045969 hsa-miR-29a-3p 2.188898 0.01140313 hsa-miR-122-3p 11.601732 8.1178E-05 hsa-miR-301a-3p -2.681548 0.00635155 hsa-miR-1260a -2.181696 0.00575712 hsa-miR-301b-3p -3.514139 0.0019234 hsa-miR-1268a 2.171332 0.01155357 hsa-miR-30c-1-3p 1.687104 0.02550265 hsa-miR-1270 -2.615067 0.04037894 hsa-miR-32-5p -2.227379 0.01073677 hsa-miR-128-3p 1.760800 0.01295601 hsa-miR-369-3p -2.608407 0.02738843 hsa-miR-1290 2.635922 0.00376488 hsa-miR-4429 -2.690869 0.00668288 hsa-miR-130a-3p -1.707893 0.0217335 hsa-miR-4449 2.323359 0.00393716 hsa-miR-132-3p 2.548180 0.0270302 hsa-miR-455-3p 7.602357 0.00127542 hsa-miR-144-3p -1.825515 0.03596744 hsa-miR-4749-5p -4.263519 0.01365749 hsa-miR-155-5p 2.622396 0.03020847 hsa-miR-4750-5p -2.559106 0.03392578 hsa-miR-15b-5p 1.758082 0.04779493 hsa-miR-4772-5p 3.565919 0.01703254 hsa-miR-185-5p -1.575086 0.04910391 hsa-miR-491-5p 2.126596 0.02019881 hsa-miR-188-5p -1.877771 0.02509072 hsa-miR-551a 2.814086 0.03174552 hsa-miR-194-5p 2.037157 0.02226701 hsa-miR-5585-3p 3.072298 0.00583761 hsa-miR-197-3p 1.848226 0.01049578 hsa-miR-574-5p -1.681465 0.02055668 hsa-miR-197-5p -1.751536 0.03523925 hsa-miR-627-5p 2.704216 0.00366637 hsa-miR-1976 2.219418 0.02354463 hsa-miR-660-5p -2.068799 0.00875859 hsa-miR-19a-3p -2.110539 0.01848871 hsa-miR-6855-5p -4.921246 0.00249404 hsa-miR-202-3p -3.307356 0.01925542 hsa-miR-940 2.678358 0.00444037 hsa-miR-20b-5p -1.716225 0.03663435 Mature_405 2.455326 0.01534681 hsa-miR-223-3p 2.206440 0.00840517 Mature_1143 11.616336 0.00049998 hsa-miR-2278 -3.041755 0.00205146 Mature_1719 3.159012 0.0013829 hsa-miR-27a-5p 2.038486 0.04099172

④ Comparison of patients with benign lung tumors and patients with stage IV lung cancer

Referring to Figure 11 and Table 7 below, 50 mature miRNAs (|fc| ≥ 1.1, p < 0.05) with greater expression differences in lung cancer stage Ⅳ patients compared to lung benign tumor patients were identified, which indicates arsenic in lung benign tumor. It can be used as a biomarker to confirm whether cell lung cancer has progressed to stage IV. In particular, among the 50, 39 mature miRNAs (|fc| > 2, p < 0.05) whose expression level fc exceeds twice that of patients with benign lung tumors are expected to improve the accuracy and reliability of diagnosis of stage Ⅳ non-small cell lung cancer. do.

fc Raw.p fc Raw.p hsa-miR-1246 6.144233 8.0324E-07 hsa-miR-5100 2.825125 0.02795294 hsa-miR-1268a 1.933028 0.01996248 hsa-miR-518e-5p 2.845104 0.0486859 hsa-miR-1273c 2.210191 0.00272972 hsa-miR-519a-5p 2.845191 0.0485656 hsa-miR-1285-3p 2.249516 0.00229369 hsa-miR-519b-5p 2.845234 0.04850578 hsa-miR-1290 4.493251 4.1317E-06 hsa-miR-519c-5p 2.845321 0.04838512 hsa-miR-181c-5p -2.617114 0.00155822 hsa-miR-522-5p 2.845365 0.04832391 hsa-miR-185-5p -1.626119 0.00911949 hsa-miR-523-5p 2.845358 0.04833373 hsa-miR-18a-5p -1.956030 0.02936836 hsa-miR-543 -2.672837 0.02164478 hsa-miR-193b-3p 2.284073 0.0226183 hsa-miR-5585-3p 2.962491 0.01353111 hsa-miR-196b-5p -2.209855 0.00755392 hsa-miR-610 -2.708499 0.04844778 hsa-miR-1972 2.183147 0.00950884 hsa-miR-6125 -2.899839 0.02224939 hsa-miR-200b-5p 3.581880 0.0177614 hsa-miR-6126 1.686920 0.03997286 hsa-miR-205-5p 4.822297 0.00114382 hsa-miR-627-5p 2.301317 0.01639014 hsa-miR-27b-5p -2.118589 0.0429828 hsa-miR-6516-3p 1.973631 0.00652946 hsa-miR-301b-3p -2.607780 0.01371307 hsa-miR-6735-5p -1.617863 0.01580739 hsa-miR-3158-5p -2.738262 0.00298118 hsa-miR-6804-5p -2.452536 0.01986776 hsa-miR-375-3p 6.655801 0.00141824 hsa-miR-6837-5p 3.482143 0.02398421 hsa-miR-378h -2.844107 0.00883555 hsa-miR-6873-3p 2.715627 0.01367723 hsa-miR-4449 1.802110 0.03907049 hsa-miR-762 2.630167 0.03249587 hsa-miR-4646-5p -2.023441 0.01455102 hsa-miR-765 4.301965 0.0035698 hsa-miR-4732-5p -2.041055 0.00174142 hsa-miR-7847-3p 1.872125 0.03136053 hsa-miR-4753-5p -2.749909 0.03121249 hsa-miR-8485 1.560028 0.04190744 hsa-miR-4787-3p 6.053613 0.00184027 Mature_787 9.624011 0.00277919 hsa-miR-483-5p 3.382406 0.00369343 Mature_1175 1.683362 0.04634724 hsa-miR-5010-5p -1.807321 0.01221509 Mature_1719 8.400301 1.2021E-07

⑤ Comparison of patients with benign lung tumors and patients with stage I to IV lung cancer

Referring to Figure 12 and Table 8 below, 60 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences were identified in lung cancer patients, more specifically, lung cancer stage I to IV patients compared to lung benign tumor patients. This can be used as a biomarker to check whether a benign lung tumor progresses from stage I to stage IV non-small cell lung cancer. In particular, among the 60, 24 mature miRNAs (|fc| > 2, p < 0.05) with an expression level fc exceeding twice that of patients with benign lung tumors are expected to improve the accuracy and reliability of non-small cell lung cancer diagnosis.

fc Raw.p fc Raw.p hsa-miR-101-3p -1.630946 0.01364342 hsa-miR-32-5p -1.867654 0.02202757 hsa-miR-122-3p 3.815359 0.02291645 hsa-miR-3605-3p 2.173121 0.02573312 hsa-miR-1246 2.921261 0.00187367 hsa-miR-369-3p -2.115423 0.04545144 hsa-miR-1260a -1.456925 0.02231651 hsa-miR-375-3p 2.974640 0.03908725 hsa-miR-126-3p -1.546720 0.03145711 hsa-miR-378h -1.967407 0.01768623 hsa-miR-1268a 1.862988 0.0094028 hsa-miR-423-3p 1.336588 0.04742169 hsa-miR-1273c 1.730609 0.01342905 hsa-miR-4286 1.376497 0.03505028 hsa-miR-128-1-5p 2.680299 0.02438728 hsa-miR-4449 1.754141 0.03096248 hsa-miR-128-3p 1.371616 0.02688664 hsa-miR-4716-3p -1.948388 0.03398597 hsa-miR-1290 2.569711 0.00291216 hsa-miR-4749-5p -2.418504 0.01080904 hsa-miR-130a-3p -1.565079 0.00286393 hsa-miR-4787-3p 3.604780 0.01134412 hsa-miR-130b-3p -1.309136 0.0309859 hsa-miR-532-5p -1.330472 0.0477156 hsa-miR-144-3p -1.703628 0.01144799 hsa-miR-5585-3p 2.981026 0.00258011 hsa-miR-150-5p 1.631060 0.01726297 hsa-miR-574-3p 1.349881 0.04196932 hsa-miR-185-5p -1.501153 0.00218586 hsa-miR-574-5p -1.341362 0.04253896 hsa-miR-190a-5p -1.937294 0.01053249 hsa-miR-610 -2.221525 0.02445054 hsa-miR-193b-3p 2.242759 0.02709632 hsa-miR-6125 -2.103977 0.04923398 hsa-miR-196b-5p -1.600068 0.04599479 hsa-miR-627-5p 1.952838 0.04123937 hsa-miR-1972 1.497641 0.03241268 hsa-miR-642b-3p -1.549854 0.04441862 hsa-miR-197-3p 2.266536 0.0059089 hsa-miR-660-5p -1.487293 0.03329245 hsa-miR-1976 2.446346 0.00124182 hsa-miR-6855-5p -2.017437 0.04600843 hsa-miR-19a-3p -1.832637 0.00421338 hsa-miR-6873-3p 2.065844 0.0393715 hsa-miR-19b-3p -1.536881 0.01845083 hsa-miR-7-5p -1.471271 0.04832784 hsa-miR-202-3p -3.274530 0.00054187 hsa-miR-769-3p 2.291788 0.03770823 hsa-miR-205-5p 2.874338 0.01523075 Mature_405 1.881381 0.04756655 hsa-miR-20a-5p -1.495349 0.03968982 Mature_787 4.640459 0.0407289 hsa-miR-2278 -1.766317 0.03831741 Mature_1143 6.120269 0.00808475 hsa-miR-301a-3p -1.989026 0.00500979 Mature_1719 4.128969 0.00060559 hsa-miR-301b-3p -3.272701 0.00017877 Mature_1813 -1.733566 0.01893278 hsa-miR-3158-5p -1.911449 0.01576399 Mature_2474 -1.733565 0.0188979

⑥ Comparison of patients with benign lung tumors and patients with lung cancer stages I and II

Referring to Figure 13 and Table 9 below, 51 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences in lung cancer stage I and II patients compared to lung benign tumor patients were identified, which are It can be used as a biomarker to check whether non-small cell lung cancer has progressed to stages I and II. In particular, among the 51, 22 mature miRNAs (|fc| > 2, p < 0.05) whose expression level fc exceeds twice that of patients with lung benign tumors (|fc| > 2, p < 0.05) will improve the accuracy and reliability of diagnosis of stage I and II non-small cell lung cancer. It is expected that

fc Raw.p fc Raw.p hsa-miR-101-3p -1.623634 0.03579012 hsa-miR-3605-3p 2.620400 0.01256206 hsa-miR-126-3p -1.690451 0.00494517 hsa-miR-3615 1.598331 0.01586253 hsa-miR-128-1-5p 3.081414 0.01977243 hsa-miR-369-3p -2.637833 0.03377473 hsa-miR-1292-5p 1.483951 0.04429408 hsa-miR-423-3p 1.460211 0.02924693 hsa-miR-130a-3p -1.648770 0.00296065 hsa-miR-4286 1.444167 0.03706898 hsa-miR-130b-3p -1.414521 0.02550899 hsa-miR-4444 -3.883896 0.00806848 hsa-miR-142-5p -1.444900 0.04724023 hsa-miR-4685-3p 1.809320 0.03045407 hsa-miR-144-3p -1.671255 0.03890223 hsa-miR-4732-3p 1.980349 0.0366323 hsa-miR-150-5p 1.951822 0.00289258 hsa-miR-484 1.717167 0.01351676 hsa-miR-190a-5p -2.124456 0.01226231 hsa-miR-532-3p 1.516569 0.03161466 hsa-miR-193b-3p 2.427572 0.0398141 hsa-miR-5585-3p 2.965404 0.00711253 hsa-miR-196b-5p -1.737595 0.04841235 hsa-miR-574-5p -1.442169 0.02277271 hsa-miR-1972 2.428182 0.00853951 hsa-miR-610 -2.453773 0.02344414 hsa-miR-1976 3.030449 0.00035776 hsa-miR-642a-3p -1.836391 0.01734142 hsa-miR-19a-3p -1.932612 0.01013472 hsa-miR-642b-3p -1.874860 0.01875461 hsa-miR-202-3p -4.297301 0.00096576 hsa-miR-6511b-3p 1.618231 0.03457185 hsa-miR-20a-3p -2.375369 0.04618442 hsa-miR-6807-5p -2.829105 0.00569413 hsa-miR-223-5p -1.501017 0.04017516 hsa-miR-6873-3p 2.073217 0.04310983 hsa-miR-2355-5p -2.027075 0.02135839 hsa-miR-769-3p 2.788847 0.00977118 hsa-miR-26b-5p -1.474529 0.03932538 hsa-miR-874-5p 1.967051 0.02343568 hsa-miR-301a-3p -2.104879 0.00856768 Mature_684 -1.674843 0.0397326 hsa-miR-301b-3p -3.857511 0.00011756 Mature_1143 5.048754 0.00682399 hsa-miR-30d-5p 1.624677 0.02881468 Mature_1813 -2.253936 0.00436426 hsa-miR-32-5p -1.919813 0.03922032 Mature_2474 -2.253936 0.00436006 hsa-miR-335-5p -1.527835 0.02897961 Mature_2598 -3.329618 0.02977842 hsa-miR-342-3p 1.611867 0.01040544

⑦ Comparison of patients with benign lung tumors and patients with stage Ⅲ and Ⅳ lung cancer

Referring to Figure 14 and Table 10 below, 63 mature miRNAs (|fc| ≥1.1, p < 0.05) with greater expression differences in lung cancer stage Ⅲ and Ⅳ patients compared to lung benign tumor patients were identified, which are It can be used as a biomarker to check whether non-small cell lung cancer has progressed to stages III and IV. In particular, among the 63, 30 mature miRNAs (|fc| > 2, p < 0.05) whose expression level fc exceeds twice that of patients with benign lung tumors can improve the accuracy and reliability of diagnosis of stage Ⅲ and Ⅳ non-small cell lung cancer. It is expected that

fc Raw.p fc Raw.p hsa-miR-101-3p -1.637030 0.02835007 hsa-miR-378h -2.008038 0.022087 hsa-miR-122-3p 5.722319 0.00327579 hsa-miR-4449 1.991816 0.00846073 hsa-miR-1246 4.547331 2.4127E-05 hsa-miR-455-3p 3.789672 0.02681346 hsa-miR-1260a -1.854674 0.01140819 hsa-miR-4646-5p -1.765068 0.03765135 hsa-miR-1268a 2.022538 0.00622146 hsa-miR-4716-3p -2.128582 0.04357278 hsa-miR-1273c 1.861355 0.0106909 hsa-miR-4732-5p -1.865527 0.00258935 hsa-miR-128-3p 1.457340 0.02623389 hsa-miR-4749-5p -2.679591 0.01516624 hsa-miR-1285-3p 1.835982 0.01328961 hsa-miR-4753-5p -2.332252 0.03499811 hsa-miR-1290 3.817828 3.8459E-05 hsa-miR-4787-3p 4.719240 0.00629282 hsa-miR-130a-3p -1.502691 0.02441527 hsa-miR-483-5p 2.370843 0.03322655 hsa-miR-144-3p -1.731083 0.01768878 hsa-miR-486-5p -1.427918 0.04883337 hsa-miR-185-5p -1.607164 0.00175996 hsa-miR-5010-5p -1.509908 0.03894923 hsa-miR-190a-5p -1.805848 0.0479901 hsa-miR-532-5p -1.390611 0.04488377 hsa-miR-193b-3p 2.081064 0.03524217 hsa-miR-543 -2.143598 0.0398292 hsa-miR-1972 1.555810 0.03777979 hsa-miR-5585-3p 3.000246 0.00354794 hsa-miR-197-3p -1.547854 0.02605839 hsa-miR-6126 1.576111 0.04471432 hsa-miR-197-5p 2.131459 0.01013559 hsa-miR-627-5p 2.447496 0.00717806 hsa-miR-1976 1.945108 0.02553888 hsa-miR-6516-3p 1.601368 0.04911671 hsa-miR-19a-3p -1.758103 0.01742441 hsa-miR-660-5p -1.658163 0.0114431 hsa-miR-19b-3p -1.600288 0.02180912 hsa-miR-6735-5p -1.533137 0.01650003 hsa-miR-200b-5p 2.631518 0.04839304 hsa-miR-6855-5p -2.809115 0.00643765 hsa-miR-202-3p -2.718273 0.00764161 hsa-miR-765 3.267158 0.01537883 hsa-miR-205-5p 3.822465 0.00424357 hsa-miR-766-5p -1.516725 0.03239012 hsa-miR-20b-5p -1.555221 0.02497857 hsa-miR-7847-3p 1.812516 0.03634669 hsa-miR-2278 -2.016273 0.01291242 hsa-miR-92b-5p -1.450239 0.04999825 hsa-miR-27a-5p 1.824917 0.03657542 hsa-miR-940 2.263994 0.00755514 hsa-miR-301a-3p -1.901523 0.02210927 Mature_405 2.176276 0.03391196 hsa-miR-301b-3p -2.892762 0.00225516 Mature_787 7.494939 0.00545192 hsa-miR-30e-5p -1.540052 0.04839692 Mature_1143 6.996161 0.00998078 hsa-miR-3158-5p -2.261719 0.00499475 Mature_1175 1.692202 0.03408524 hsa-miR-32-5p -1.824250 0.03180212 Mature_1719 6.493933 2.6851E-06 hsa-miR-375-3p 4.698694 0.00689163

⑧ Comparison of lung cancer stage Ⅲ and Ⅳ patients with lung cancer stage Ⅰ and Ⅱ patients

Referring to Figure 15 and Table 11 below, 70 mature miRNAs (|fc| ≥ 1.1, p < 0.05) with greater expression differences in lung cancer stage Ⅲ and Ⅳ patients compared to lung cancer stage Ⅰ and Ⅱ patients were identified, which are arsenic It can be used as a biomarker to check whether cell lung cancer has progressed from stage I and II to non-small cell lung cancer stage III and IV. In particular, among the 70, 29 mature miRNAs (|fc| > 2, p < 0.05) with an expression level fc exceeding 2-fold compared to patients with lung cancer stages I and II were found in non-small cell lung cancer stages I and II. It is expected to improve the accuracy and reliability of stage IV diagnosis.

fc Raw.p fc Raw.p hsa-miR-10a-3p 2.239687 0.03405825 hsa-miR-4525 -1.882273 0.02285453 hsa-miR-122-3p 3.870721 0.00411846 hsa-miR-455-3p 6.242424 0.00019078 hsa-miR-1246 4.869362 6.676E-09 hsa-miR-4669 -2.139619 0.04573225 hsa-miR-1285-3p 1.719238 0.00492823 hsa-miR-4685-3p -1.928071 0.00412282 hsa-miR-1290 3.655740 5.2425E-07 hsa-miR-4701-5p -2.032430 0.04300976 hsa-miR-1292-5p -1.787476 0.00054801 hsa-miR-4732-3p -2.427926 0.00073918 hsa-miR-140-5p 1.767146 0.04890548 hsa-miR-4732-5p -1.849508 0.00017677 hsa-miR-150-3p -1.366860 0.04490502 hsa-miR-4750-5p -2.013629 0.01431973 hsa-miR-181d-3p -2.009496 0.04385441 hsa-miR-4772-3p 2.129036 0.0455323 hsa-miR-197-5p -1.452181 0.0317667 hsa-miR-483-5p 1.920736 0.04821433 hsa-miR-1976 -1.556128 0.03165746 hsa-miR-484 -1.680262 0.00084162 hsa-miR-199b-5p 1.772163 0.04875951 hsa-miR-486-5p -2.088272 2.1249E-05 hsa-miR-200c-3p 2.586598 0.00149826 hsa-miR-5100 2.071052 0.04123542 hsa-miR-205-5p 2.213098 0.02708294 hsa-miR-627-5p 1.812868 0.04197541 hsa-miR-2110 -1.415158 0.01317595 hsa-miR-642a-3p 1.452486 0.04388031 hsa-miR-223-3p 1.623797 0.01869192 hsa-miR-6511a-3p -1.672394 0.01482981 hsa-miR-223-5p 1.394364 0.04062386 hsa-miR-6735-5p -1.505050 0.00818479 hsa-miR-2355-5p 1.913083 0.02687526 hsa-miR-6779-5p 2.927951 0.00083808 hsa-miR-26b-5p 1.410687 0.02924707 hsa-miR-6780a-5p -1.530165 0.03787957 hsa-miR-27a-5p 1.988621 0.00889527 hsa-miR-6837-5p 2.439536 0.048057 hsa-miR-27b-5p -1.828148 0.04815015 hsa-miR-765 3.058162 0.00454092 hsa-miR-30d-5p -1.723927 0.00074229 hsa-miR-7704 2.630949 0.00176768 hsa-miR-30e-5p -1.664017 0.0243561 hsa-miR-92a-3p -1.784339 0.00065293 hsa-miR-3200-3p -1.993285 0.00872044 hsa-miR-92b-3p -1.511034 0.01997084 hsa-miR-3200-5p -2.113005 0.00103169 hsa-miR-92b-5p -1.515290 0.01135124 hsa-miR-329-3p -1.785578 0.04991193 hsa-miR-940 1.823409 0.023063 hsa-miR-335-5p 1.740652 0.00405594 Mature_684 1.717526 0.0146514 hsa-miR-342-3p -1.370135 0.03062337 Mature_787 6.508107 0.00094203 hsa-miR-3615 -1.489224 0.00747532 Mature_1655 -1.973303 0.0265143 hsa-miR-3682-3p -2.252631 0.0074041 Mature_1719 5.230598 5.8095E-07 hsa-miR-375-3p 5.398052 6.31E-05 Mature_1813 1.545872 0.03803359 hsa-miR-3940-3p -1.769734 0.02299897 Mature_1850 3.497165 0.03593141 hsa-miR-409-3p -1.710093 0.02019929 Mature_2015 -3.360333 0.01078107 hsa-miR-4444 3.027450 0.00424588 Mature_2474 1.545872 0.03805185 hsa-miR-4492 2.099684 0.04515309 Mature_2598 4.556517 0.00643812

So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

Sequence list electronic file attached

Claims (25)

hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1229-3p, hsa-miR-1246, hsa-miR- 125a-5p, hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR- 128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa- miR-150-3p, hsa-miR-150-5p, hsa-miR-155-5p, hsa-miR-15b-5p, hsa-miR-181c-5p, hsa-miR-181d-3p, hsa-miR- 185-5p, hsa-miR-188-5p, hsa-miR-18a-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-194-5p, hsa-miR-196b- 5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR- 19b-3p, hsa-miR-200b-5p, hsa-miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-20a- 5p, hsa-miR-20b-5p, hsa-miR-2110, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR-2278, hsa-miR- 2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b- 3p, hsa-miR-30c-1-3p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200- 3p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-3940- 3p, hsa-miR-409-3p, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4685-3p, hsa-miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4753-5p, hsa- miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-491- 5p, hsa-miR-497-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa- miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511a-3p, hsa-miR-6511b-3p, hsa-miR-6516-3p, hsa-miR-652-5p, hsa- miR-660-5p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6804-5p, hsa-miR-6807-5p, hsa-miR- 6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-762, hsa-miR-765, hsa-miR-766-3p, hsa- miR-766-5p, hsa-miR-769-3p, hsa-miR-7704, hsa-miR-7847-3p, hsa-miR-7854-3p, hsa-miR-8485, hsa-miR-874-5p, hsa-miR-885-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1655, Mature_1719, Mature_1813, Mature_1850, A composition for diagnosing lung cancer comprising an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684 and Mature_787.
In claim 1,
The Mature_1143 is represented by SEQ ID NO: 1,
The Mature_1175 is represented by SEQ ID NO: 2,
The Mature_1655 is represented by SEQ ID NO: 3,
The Mature_1719 is represented by SEQ ID NO: 4,
The Mature_1813 is represented by SEQ ID NO: 5,
The Mature_1850 is represented by SEQ ID NO: 6,
The Mature_2015 is represented by SEQ ID NO: 7,
The Mature_2474 is represented by SEQ ID NO: 8,
The Mature_2598 is represented by SEQ ID NO: 9,
The Mature_405 is represented by SEQ ID NO: 10,
The Mature_684 is represented by SEQ ID NO: 11, and
The composition where Mature_787 is represented by SEQ ID NO: 12.
In claim 1,
A composition wherein the agent is at least one selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA.
In claim 1,
The composition is used to diagnose whether lung cancer progresses from benign lung tumor to stage I. -miR-126-3p, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa-miR -130a-3p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-150 -5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR -19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-21-5p, hsa-miR-2355-5p, hsa-miR-301a-3p, hsa-miR-301b -3p, hsa-miR-30d-5p, hsa-miR-32-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa -miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4444, hsa-miR-4685-3p, hsa-miR-4732-3p, hsa-miR-4787-3p , hsa-miR-484, hsa-miR-497-5p, hsa-miR-532-3p, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-5p, hsa-miR-610 , hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511b-3p, hsa-miR-6807-5p, hsa-miR-6873-3p, hsa-miR-766-3p, hsa -An agent for measuring the expression level of one or more types of miRNA selected from the group consisting of -miR-769-3p, hsa-miR-7854-3p, hsa-miR-874-5p, Mature_1143, Mature_1813, Mature_2015, Mature_2474, Mature_2598 and Mature_684 A composition comprising:
In claim 1,
The composition is used to diagnose whether lung cancer progresses from benign lung tumor to stage Ⅱ. -1976, hsa-miR-202-3p, hsa-miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-3605-3p, hsa-miR-4449, hsa-miR-652-5p, hsa A composition comprising an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of -miR-885-5p, Mature_1143, Mature_1719, Mature_1813 and Mature_2474.
In claim 1,
The composition contains hsa-miR-101-3p, hsa-miR-122-3p, hsa-miR-1260a, hsa-miR-1268a, and hsa-miR-1270 to diagnose whether lung cancer has progressed from benign lung tumor to stage III. , hsa-miR-128-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-155-5p, hsa-miR -15b-5p, hsa-miR-185-5p, hsa-miR-188-5p, hsa-miR-194-5p, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976 , hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20b-5p, hsa-miR-223-3p, hsa-miR-2278, hsa-miR-27a-5p, hsa-miR -29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30c-1-3p, hsa-miR-32-5p, hsa-miR-369-3p, hsa-miR -4429, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR-4772-5p, hsa-miR-491-5p, hsa -miR-551a, hsa-miR-5585-3p, hsa-miR-574-5p, hsa-miR-627-5p, hsa-miR-660-5p, hsa-miR-6855-5p, hsa-miR-940 , Mature_1143, Mature_1719, and Mature_405. A composition comprising an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of Mature_1143, Mature_1719, and Mature_405.
In claim 1,
The composition is used to diagnose whether lung cancer has progressed from benign lung tumor to stage IV. -miR-181c-5p, hsa-miR-185-5p, hsa-miR-18a-5p, hsa-miR-193b-3p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-200b -5p, hsa-miR-205-5p, hsa-miR-27b-5p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR-375-3p, hsa-miR-378h, hsa -miR-4449, hsa-miR-4646-5p, hsa-miR-4732-5p, hsa-miR-4753-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-5010 -5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa -miR-523-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa-miR-627-5p, hsa-miR -6516-3p, hsa-miR-6735-5p, hsa-miR-6804-5p, hsa-miR-6837-5p, hsa-miR-6873-3p, hsa-miR-762, hsa-miR-765, hsa A composition comprising an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of -miR-7847-3p, hsa-miR-8485, Mature_1175, Mature_1719 and Mature_787.
In claim 1,
The composition includes hsa-miR-101-3p, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1260a, and hsa-miR to diagnose whether lung cancer progresses from benign lung tumor to stage I to IV. -126-3p, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-1-5p, hsa-miR-128-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa -miR-130b-3p, hsa-miR-144-3p, hsa-miR-150-5p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR -196b-5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa -miR-205-5p, hsa-miR-20a-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR-32 -5p, hsa-miR-3605-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-423-3p, hsa-miR-4286, hsa-miR -4449, hsa-miR-4716-3p, hsa-miR-4749-5p, hsa-miR-4787-3p, hsa-miR-532-5p, hsa-miR-5585-3p, hsa-miR-574-3p , hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-627-5p, hsa-miR-642b-3p, hsa-miR-660-5p, hsa-miR-6855 -5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-769-3p, Mature_1143, Mature_1719, Mature_1813, Mature_2474, Mature_405 and Mature_787. A composition comprising an agent to be measured.
In claim 1,
The composition contains hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-128-1-5p, hsa-miR-1292 to diagnose whether lung cancer progresses from benign lung tumor to stage I and II. -5p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-150-5p, hsa-miR-190a-5p , hsa-miR-193b-3p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-1976, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20a -3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30d-5p , hsa-miR-32-5p, hsa-miR-335-5p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-369-3p, hsa-miR -423-3p, hsa-miR-4286, hsa-miR-4444, hsa-miR-4685-3p, hsa-miR-4732-3p, hsa-miR-484, hsa-miR-532-3p, hsa-miR -5585-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511b-3p, hsa-miR-6807-5p , hsa-miR-6873-3p, hsa-miR-769-3p, hsa-miR-874-5p, Mature_1143, Mature_1813, Mature_2474, Mature_2598, and Mature_684. An agent for measuring the expression level of one or more types of miRNA selected from the group consisting of A composition comprising:
In claim 1,
The composition is used to diagnose whether lung cancer progresses from benign lung tumor to stage Ⅲ or Ⅳ lung cancer. -1268a, hsa-miR-1273c, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-130a-3p, hsa-miR-144-3p, hsa-miR -185-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa -miR-19a-3p, hsa-miR-19b-3p, hsa-miR-200b-5p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20b-5p, hsa-miR -2278, hsa-miR-27a-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30e-5p, hsa-miR-3158-5p, hsa-miR-32-5p , hsa-miR-375-3p, hsa-miR-378h, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4716-3p, hsa-miR-4732 -5p, hsa-miR-4749-5p, hsa-miR-4753-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-486-5p, hsa-miR-5010-5p , hsa-miR-532-5p, hsa-miR-543, hsa-miR-5585-3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-6516-3p, hsa-miR-660 -5p, hsa-miR-6735-5p, hsa-miR-6855-5p, hsa-miR-765, hsa-miR-766-5p, hsa-miR-7847-3p, hsa-miR-92b-5p, hsa -A composition comprising an agent for measuring the expression level of at least one type of miRNA selected from the group consisting of -miR-940, Mature_1143, Mature_1175, Mature_1719, Mature_405 and Mature_787.
In claim 1,
The composition is used to diagnose whether lung cancer has progressed from stage I and II to lung cancer stage III and IV. , hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-140-5p, hsa-miR-150-3p, hsa-miR-181d-3p, hsa-miR-197-5p, hsa-miR -1976, hsa-miR-199b-5p, hsa-miR-200c-3p, hsa-miR-205-5p, hsa-miR-2110, hsa-miR-223-3p, hsa-miR-223-5p, hsa -miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR -3200-3p, hsa-miR-3200-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-342-3p, hsa-miR-3615, hsa-miR-3682-3p , hsa-miR-375-3p, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-4444, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p , hsa-miR-4669, hsa-miR-4685-3p, hsa-miR-4701-5p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4750-5p, hsa-miR -4772-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-5100, hsa-miR-627-5p, hsa-miR-642a-3p, hsa -miR-6511a-3p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6837-5p, hsa-miR-765, hsa-miR-7704 , hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1655, Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_684 and Mature_787. A composition comprising an agent for measuring the expression level of at least one type of miRNA selected from the group.
A kit for diagnosing lung cancer comprising the composition of any one of claims 1 to 11.
In claim 12,
The kit further includes a reagent for nucleic acid amplification.
a) collecting a biological sample from an individual in need of diagnosis;
b) In the biological sample, hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1229-3p, hsa-miR- 1246, hsa-miR-125a-5p, hsa-miR-1260a, hsa-miR-126-3p, hsa-miR-1268a, hsa-miR-1270, hsa-miR-1273c, hsa-miR-128-1- 5p, hsa-miR-128-3p, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-1292-5p, hsa-miR-1306-5p, hsa-miR-1307-3p, hsa- miR-130a-3p, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR- 144-3p, hsa-miR-150-3p, hsa-miR-150-5p, hsa-miR-155-5p, hsa-miR-15b-5p, hsa-miR-181c-5p, hsa-miR-181d- 3p, hsa-miR-185-5p, hsa-miR-188-5p, hsa-miR-18a-5p, hsa-miR-190a-5p, hsa-miR-193b-3p, hsa-miR-194-5p, hsa-miR-196b-5p, hsa-miR-1972, hsa-miR-197-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-199b-5p, hsa-miR-19a- 3p, hsa-miR-19b-3p, hsa-miR-200b-5p, hsa-miR-200c-3p, hsa-miR-202-3p, hsa-miR-205-5p, hsa-miR-20a-3p, hsa-miR-20a-5p, hsa-miR-20b-5p, hsa-miR-2110, hsa-miR-21-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR- 2278, hsa-miR-2355-5p, hsa-miR-26b-5p, hsa-miR-27a-5p, hsa-miR-27b-5p, hsa-miR-29a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-30c-1-3p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3150b-3p, hsa-miR-3158-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-32-5p, hsa-miR-329-3p, hsa-miR-335-5p, hsa-miR-337-3p, hsa- miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-369-3p, hsa-miR-375-3p, hsa-miR-378h, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-423-3p, hsa-miR-424-5p, hsa-miR-4286, hsa-miR-4429, hsa-miR-4444, hsa-miR-4449, hsa-miR-4492, hsa-miR-4525, hsa-miR-455-3p, hsa-miR-4646-5p, hsa-miR-4669, hsa-miR-4685-3p, hsa- miR-4701-5p, hsa-miR-4716-3p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR- 4753-5p, hsa-miR-4772-3p, hsa-miR-4772-5p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-486-5p, hsa-miR-491-5p, hsa-miR-497-5p, hsa-miR-5010-5p, hsa-miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR- 519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-532-3p, hsa-miR-532-5p, hsa-miR-543, hsa-miR-551a, hsa-miR-5585-3p, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, hsa-miR-6126, hsa- miR-627-5p, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6511a-3p, hsa-miR-6511b-3p, hsa-miR-6516-3p, hsa-miR- 652-5p, hsa-miR-660-5p, hsa-miR-6735-5p, hsa-miR-6779-5p, hsa-miR-6780a-5p, hsa-miR-6804-5p, hsa-miR-6807- 5p, hsa-miR-6837-5p, hsa-miR-6855-5p, hsa-miR-6873-3p, hsa-miR-7-5p, hsa-miR-762, hsa-miR-765, hsa-miR- 766-3p, hsa-miR-766-5p, hsa-miR-769-3p, hsa-miR-7704, hsa-miR-7847-3p, hsa-miR-7854-3p, hsa-miR-8485, hsa- miR-874-5p, hsa-miR-885-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, hsa-miR-940, Mature_1143, Mature_1175, Mature_1655, Measuring the expression level of one or more types of miRNA selected from the group consisting of Mature_1719, Mature_1813, Mature_1850, Mature_2015, Mature_2474, Mature_2598, Mature_405, Mature_684 and Mature_787; and
c) comparing the measured miRNA expression level with the control group
A method of providing information for lung cancer diagnosis, including.
In claim 14,
A method wherein the biological sample in step a) is one or more selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.
In claim 14,
The expression level of miRNA in step b) was determined by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease protection assay, in A method that is measured by one or more methods selected from the group consisting of situ hybridization, microarray, and Northern blot.
In claim 14,
The control group in step c) is a patient with a benign lung tumor or a patient with stage 2 and ₃ lung cancer, or a biological sample obtained therefrom.
In claim 14,
Step c) is carried out in the individual by -1306-5p, hsa-miR-1307-3p, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR-1976, hsa -miR-30d-5p, hsa-miR-337-3p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-423-3p, hsa-miR-4286 , hsa-miR-4685-3p, hsa-miR-4732-3p, hsa-miR-4787-3p, hsa-miR-484, hsa-miR-532-3p, hsa-miR-551a, hsa-miR-5585 -3p, hsa-miR-6511b-3p, hsa-miR-6873-3p, hsa-miR-766-3p, hsa-miR-769-3p, hsa-miR-7854-3p, hsa-miR-874-5p , the expression level of one or more miRNAs selected from the group consisting of Mature_1143 and Mature_2015 is higher than that of the control group, or
In the individual, hsa-let-7a-3p, hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-190a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa- miR-19b-3p, hsa-miR-202-3p, hsa-miR-21-5p, hsa-miR-2355-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR- 32-5p, hsa-miR-424-5p, hsa-miR-4444, hsa-miR-497-5p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa- When the expression level of one or more miRNAs selected from the group consisting of miR-642b-3p, hsa-miR-6807-5p, Mature_684, Mature_1813, Mature_2474 and Mature_2598 is lower than the control group, it is used to diagnose progression from benign lung tumor to stage I lung cancer. How to do it.
In claim 14,
Step c) is carried out in the subject by: -The expression level of one or more miRNAs selected from the group consisting ofmiR-885-5p, Mature_1143, and Mature_1719 is higher than that of the control group, or
selected from the group consisting of hsa-miR-181c-5p, hsa-miR-202-3p, hsa-miR-301b-3p, hsa-miR-3150b-3p, hsa-miR-652-5p, Mature_1813 and Mature_2474 in the individual. A method for diagnosing progression from benign lung tumor to stage II lung cancer when the expression level of one or more types of miRNA is lower than that in the control group.
In claim 14,
Step c) is performed in an individual in hsa-miR-122-3p, hsa-miR-1268a, hsa-miR-128-3p, hsa-miR-1290, hsa-miR-132-3p, hsa-miR-155-5p , hsa-miR-15b-5p, hsa-miR-194-5p, hsa-miR-197-3p, hsa-miR-1976, hsa-miR-223-3p, hsa-miR-27a-5p, hsa-miR -29a-3p, hsa-miR-30c-1-3p, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4772-5p, hsa-miR-491-5p, hsa-miR-551a , hsa-miR-5585-3p, hsa-miR-627-5p, hsa-miR-940, Mature_405, Mature_1143 and Mature_1719, the expression level of one or more types of miRNAs is higher than the control group, or
In the individual, hsa-miR-101-3p, hsa-miR-1260a, hsa-miR-1270, hsa-miR-130a-3p, hsa-miR-144-3p, hsa-miR-185-5p, hsa-miR- 188-5p, hsa-miR-197-5p, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20b-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p, hsa-miR-369-3p, hsa-miR-4429, hsa-miR-4749-5p, hsa-miR-4750-5p, hsa-miR- When the expression level of one or more types of miRNA selected from the group consisting of 574-5p, hsa-miR-660-5p, and hsa-miR-6855-5p is lower than the control group, progression from benign lung tumor to stage III lung cancer is diagnosed. method.
In claim 14,
Step c) is performed in the subject in hsa-miR-1246, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-193b-3p, hsa-miR -1972, hsa-miR-200b-5p, hsa-miR-205-5p, hsa-miR-375-3p, hsa-miR-4449, hsa-miR-4787-3p, hsa-miR-483-5p, hsa -miR-5100, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523 -5p, hsa-miR-5585-3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-6516-3p, hsa-miR-6837-5p, hsa-miR-6873-3p, hsa -The expression level of one or more miRNAs selected from the group consisting of -miR-762, hsa-miR-765, hsa-miR-7847-3p, hsa-miR-8485, Mature_787, Mature_1175 and Mature_1719 is higher than the control group, or
In an individual, hsa-miR-181c-5p, hsa-miR-185-5p, hsa-miR-18a-5p, hsa-miR-196b-5p, hsa-miR-27b-5p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR-378h, hsa-miR-4646-5p, hsa-miR-4732-5p, hsa-miR-4753-5p, hsa-miR-5010-5p, hsa-miR- 543, in benign lung tumors when the expression level of one or more miRNAs selected from the group consisting of hsa-miR-610, hsa-miR-6125, hsa-miR-6735-5p, and hsa-miR-6804-5p is lower than that in the control group. A method for diagnosing the progression of lung cancer to stage IV.
In claim 14,
Step c) is carried out in the subject by: , hsa-miR-1290, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-205-5p , hsa-miR-3605-3p, hsa-miR-375-3p, hsa-miR-423-3p, hsa-miR-4286, hsa-miR-4449, hsa-miR-4787-3p, hsa-miR-5585 One or more species selected from the group consisting of -3p, hsa-miR-574-3p, hsa-miR-627-5p, hsa-miR-6873-3p, hsa-miR-769-3p, Mature_405, Mature_787, Mature_1143 and Mature_1719 The level of miRNA expression is higher than that of the control group, or
In the individual hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-1260a, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-144-3p, hsa- miR-185-5p, hsa-miR-190a-5p, hsa-miR-196b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR- 20a-5p, hsa-miR-2278, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-3158-5p, hsa-miR-32-5p, hsa-miR-369-3p, hsa-miR-378h, hsa-miR-4716-3p, hsa-miR-4749-5p, hsa-miR-532-5p, hsa-miR-574-5p, hsa-miR-610, hsa-miR-6125, The expression level of one or more miRNAs selected from the group consisting of hsa-miR-642b-3p, hsa-miR-660-5p, hsa-miR-6855-5p, hsa-miR-7-5p, Mature_1813 and Mature_2474 compared to the control group In low cases, the method is to diagnose progression from a benign lung tumor to lung cancer stages I to IV.
In claim 14,
Step c) is performed in the subject in hsa-miR-128-1-5p, hsa-miR-1292-5p, hsa-miR-150-5p, hsa-miR-193b-3p, hsa-miR-1972, hsa-miR -1976, hsa-miR-30d-5p, hsa-miR-342-3p, hsa-miR-3605-3p, hsa-miR-3615, hsa-miR-423-3p, hsa-miR-4286, hsa-miR -4685-3p, hsa-miR-4732-3p, hsa-miR-484, hsa-miR-532-3p, hsa-miR-5585-3p, hsa-miR-6511b-3p, hsa-miR-6873-3p , the expression level of one or more miRNAs selected from the group consisting of hsa-miR-769-3p, hsa-miR-874-5p, and Mature_1143 is higher than the control group, or
In an individual, hsa-miR-101-3p, hsa-miR-126-3p, hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-142-5p, hsa-miR-144-3p, hsa-miR-190a-5p, hsa-miR-196b-5p, hsa-miR-19a-3p, hsa-miR-202-3p, hsa-miR-20a-3p, hsa-miR-223-5p, hsa- miR-2355-5p, hsa-miR-26b-5p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-32-5p, hsa-miR-335-5p, hsa-miR- 369-3p, hsa-miR-4444, hsa-miR-574-5p, hsa-miR-610, hsa-miR-642a-3p, hsa-miR-642b-3p, hsa-miR-6807-5p, Mature_684, A method for diagnosing progression from benign lung tumor to lung cancer stages I and II when the expression level of one or more types of miRNA selected from the group consisting of Mature_1813, Mature_2474, and Mature_2598 is lower than that of the control group.
In claim 14,
Step c) is performed in the subject in hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1268a, hsa-miR-1273c, hsa-miR-128-3p, hsa-miR-1285-3p, hsa -miR-1290, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-1972, hsa-miR-1976, hsa-miR-200b-5p, hsa-miR-205-5p, hsa -miR-27a-5p, hsa-miR-375-3p, hsa-miR-4449, hsa-miR-455-3p, hsa-miR-4787-3p, hsa-miR-483-5p, hsa-miR-5585 -3p, hsa-miR-6126, hsa-miR-627-5p, hsa-miR-6516-3p, hsa-miR-765, hsa-miR-7847-3p, hsa-miR-940, Mature_405, Mature_787, Mature_1143 , the expression level of one or more miRNAs selected from the group consisting of Mature_1175 and Mature_1719 is higher than that of the control group, or
In the individual, hsa-miR-101-3p, hsa-miR-1260a, hsa-miR-130a-3p, hsa-miR-144-3p, hsa-miR-185-5p, hsa-miR-190a-5p, hsa- miR-197-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-202-3p, hsa-miR-20b-5p, hsa-miR-2278, hsa-miR-301a- 3p, hsa-miR-301b-3p, hsa-miR-30e-5p, hsa-miR-3158-5p, hsa-miR-32-5p, hsa-miR-378h, hsa-miR-4646-5p, hsa- miR-4716-3p, hsa-miR-4732-5p, hsa-miR-4749-5p, hsa-miR-4753-5p, hsa-miR-486-5p, hsa-miR-5010-5p, hsa-miR- 532-5p, hsa-miR-543, hsa-miR-660-5p, hsa-miR-6735-5p, hsa-miR-6855-5p, hsa-miR-766-5p and hsa-miR-92b-5p. A method for diagnosing progression from a benign lung tumor to lung cancer stages III and IV when the expression level of one or more types of miRNA selected from the group is lower than that of the control group.
In claim 14,
Step c) is performed in an individual by performing hsa-miR-10a-3p, hsa-miR-122-3p, hsa-miR-1246, hsa-miR-1285-3p, hsa-miR-1290, hsa-miR-140-5p , hsa-miR-199b-5p, hsa-miR-200c-3p, hsa-miR-205-5p, hsa-miR-223-3p, hsa-miR-223-5p, hsa-miR-2355-5p, hsa -miR-26b-5p, hsa-miR-27a-5p, hsa-miR-335-5p, hsa-miR-375-3p, hsa-miR-4444, hsa-miR-4492, hsa-miR-455-3p , hsa-miR-4772-3p, hsa-miR-483-5p, hsa-miR-5100, hsa-miR-627-5p, hsa-miR-642a-3p, hsa-miR-6779-5p, hsa-miR -6837-5p, hsa-miR-765, hsa-miR-7704, hsa-miR-940, Mature_684, Mature_787, Mature_1719, Mature_1813, Mature_1850, Mature_2474, and Mature_2598. The expression level of one or more miRNAs in the control group was higher than that, or
In the individual hsa-miR-1292-5p, hsa-miR-150-3p, hsa-miR-181d-3p, hsa-miR-197-5p, hsa-miR-1976, hsa-miR-2110, hsa-miR- 27b-5p, hsa-miR-30d-5p, hsa-miR-30e-5p, hsa-miR-3200-3p, hsa-miR-3200-5p, hsa-miR-329-3p, hsa-miR-342- 3p, hsa-miR-3615, hsa-miR-3682-3p, hsa-miR-3940-3p, hsa-miR-409-3p, hsa-miR-4525, hsa-miR-4669, hsa-miR-4685- 3p, hsa-miR-4701-5p, hsa-miR-4732-3p, hsa-miR-4732-5p, hsa-miR-4750-5p, hsa-miR-484, hsa-miR-486-5p, hsa- With miR-6511a-3p, hsa-miR-6735-5p, hsa-miR-6780a-5p, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-92b-5p, Mature_1655 and Mature_2015 A method for diagnosing progression from lung cancer I and II to lung cancer stages III and IV when the expression level of one or more types of miRNA selected from the group is lower than that of the control group.