KR20230113048A - Biomarkers for early diagnosing Alzheimer's disease and uses thereof - Google Patents

Abstract

The present invention relates to a composition and kit for diagnosing Alzheimer's disease using a novel miRNA biomarker, and a method for providing information for diagnosing Alzheimer's disease using the same. In the present invention, a novel biomarker capable of predicting Alzheimer's disease By presenting a composition and kit for diagnosing Alzheimer's disease, it is possible to quickly and accurately diagnose Alzheimer's disease patients, and provide appropriate treatment to Alzheimer's disease patients.

Description

Biomarkers for early diagnosing Alzheimer's disease and uses thereof {Biomarkers for early diagnosing Alzheimer's disease and uses thereof}

The present invention relates to a composition and kit for diagnosing Alzheimer's disease using a novel miRNA biomarker, and a method for providing information for diagnosing Alzheimer's disease using the same.

Dementia is a representative disease of old age, characterized by progressive loss of intellectual ability, cognitive impairment, behavioral and psychological symptoms (abnormal behavior and psychological symptoms such as insomnia, bulimia, anxiety, agitation, depression, delusion, etc.) It is a degenerative disease that Any disease that can cause damage to overall brain function can cause dementia. Commonly known Alzheimer's-type dementia or Alzheimer's disease (AD) accounts for about 60% of all dementia, and brain tissue is lost and the brain atrophy as neurons degenerate or slowly decline in the cerebral cortex or hippocampus. In some cases, vascular dementia occurs when brain cells die due to cerebral blood circulation disorders or cerebrovascular abnormalities.

Alzheimer's disease is estimated to be affected by more than 20% of the elderly aged 80 years or older, and the number tends to increase rapidly as the aging society progresses. However, since Alzheimer's disease is caused by various etiological factors accompanied by the accumulation of β-amyloid in brain tissue, there is no clear diagnosis and treatment method yet. The most common diagnostic methods for Alzheimer's disease include image diagnosis such as magnetic resonance imaging (MRI) and positron emission tomography (PET), as well as indirect methods such as mini mental state examination (MMSE) and questionnaires. , Imaging diagnosis is burdensome for patients due to high cost and limitations of equipment, and the accuracy of diagnosis is a problem because the results of diagnosis through MMSE vary depending on age, educational background, etc.

Recently, studies on blood biomarkers for the diagnosis of Alzheimer's disease are being actively conducted worldwide. However, the results so far are extremely limited, and various opposing opinions and results are emerging, and in the case of protein biomarkers, quantitative numerical differences are shown depending on the binding state or aggregation of countless proteins present in the body. Therefore, there is an urgent need for research on biomarkers in other forms than proteins.

Republic of Korea Patent Publication No. 10-2018-0067313 Republic of Korea Patent Publication No. 10-2020-0097636

An object of the present invention is to provide a composition for diagnosing Alzheimer's disease using a novel miRNA biomarker.

Another object of the present invention is to provide a kit for diagnosing Alzheimer's disease comprising the composition for diagnosing Alzheimer's disease.

In addition, an object of the present invention is to provide a method for providing information for diagnosis of Alzheimer's disease using a novel miRNA biomarker.

One aspect of the present invention is hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR- 1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a- 5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a- 3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2- 5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR- 4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa- miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR- 6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, A composition for diagnosing Alzheimer's disease comprising an agent for measuring the expression level of at least one miRNA selected from the group consisting of Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 and Mature_776 is provided.

As used in the present invention, "Alzheimer's disease" is a brain pathological finding in which a neuritic plaque, a neurofibrillary tangle, etc. related to the deposition of beta amyloid are observed, and visually, overall brain atrophy due to loss of nerve cells It means a degenerative brain disease that shows findings. In the early stages, memory loss usually appears, and as it progresses, not only cognitive function decline, but also psychobehavioral symptoms such as personality change, nervous behavior, depression, delusion, hallucination, increased aggression, and sleep disorder are accompanied and intensified.

In the present invention, miRNA can be used as a biomarker for diagnosing Alzheimer's disease. Here, a biomarker is a substance that is generally detectable in a biological sample and includes all organic biomolecules such as polypeptides, proteins, nucleic acids, genes, lipids, glycolipids, glycoproteins, and sugars that can detect biological changes.

As used in the present invention, "miRNA" is also called micro RNA, and is composed of 21 to 23 non-coding RNAs that regulate gene expression after transcription by promoting degradation of target RNA or inhibiting their translation. means RNA. In general, miRNA is transcribed as a precursor of about 70 to 80 nt (nucleotide) in length having a hairpin structure called pre-miRNA, and then cleaved by Dicer, an RNAse III enzyme, to be produced in a mature form. More than 30% of human miRNAs exist in clusters, and after being transcribed as one precursor, the final mature miRNA is formed through a cleavage process.

These miRNAs are composed of specific miRNAs that show specific expression level changes in Alzheimer's disease patients identified through next-generation sequencing (NGS), and can be suggested as biomarkers for Alzheimer's disease diagnosis.

The NGS has a multiplexing ability to simultaneously perform hundreds of thousands of reactions, and sequencing is possible even with a small amount of sample. NGS has slightly different specific application techniques depending on the commercialized technology, but in general, clonal amplification, massively parallel sequencing, and a new sequencing method with a different mechanism of action from the Sanger method are used. Commercialized technologies include the 454 GS improved FLX model sequencer released by Roche in 2007, Genome Analyzer HiSeq released by Illumina in 2006, and SOLiD released by Applied Biosystems in 2007. In common, these three platforms abandoned complex library construction and cloning processes and adopted clonal amplification technology, chose massively parallel sequencing technology that can process a large amount at once, and adopted cyclic sequencing. The nucleotide sequence was determined by sequencing by synthesis, thereby eliminating the cumbersome electrophoresis process. It also uses an algorithm that arranges the short reads read using the shotgun method into a computer to find overlapping parts and complete the whole.

These 64 miRNAs for diagnosis of Alzheimer's disease include previously identified miRNAs as well as novel miRNAs first identified as miRNAs by the present inventors.

The novel miRNAs have not been reported in previous references, and include Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649, and Mature_776.

According to one embodiment of the present invention, the Mature_99 is represented by SEQ ID NO: 1, the Mature_141 is represented by SEQ ID NO: 2, the Mature_163 is represented by SEQ ID NO: 3, and the Mature_167 is represented by SEQ ID NO: 4 The Mature_184 is represented by SEQ ID NO: 5, the Mature_258 is represented by SEQ ID NO: 6, the Mature_385 is represented by SEQ ID NO: 7, the Mature_649 is represented by SEQ ID NO: 8, and the Mature_776 may be represented by SEQ ID NO: 9.

These 64 miRNAs may be used alone or in combination of two or more as biomarkers for Alzheimer's diagnosis.

More specifically, among the 64 miRNAs, it is preferable to use miRNA alone or miRNA combination having a statistically significant expression difference (|fc| > 2 and/or p value < 0.01) for more accurate diagnosis of Alzheimer's disease.

According to one embodiment of the present invention, the miRNAs are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136- 3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR- 6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, and Mature_649.

In addition, according to one embodiment of the present invention, the miRNAs are hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR- It may be one or more selected from the group consisting of 4485-5p, Mature_99, Mature_141, Mature_258 and Mature_385.

The expression level of the miRNA according to the present invention can be measured in a biological sample.

As used in the present invention, "biological sample" refers to cells and tissues as well as organic biomolecules such as nucleic acids, genes, peptides, amino acids, proteins, lipids, sugars, glycolipids, glycoproteins, etc. means a sample containing In the present invention, any sample containing miRNA is not limited.

According to one embodiment of the present invention, the biological sample may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.

The agent may be a substance that binds miRNA.

According to one embodiment of the present invention, the agent may be at least one selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA.

As used herein, “specifically binding” means that the binding ability to a target substance is superior to other substances to the extent that the presence or absence of the target substance can be detected by binding.

As used herein, a "primer" is a nucleic acid sequence having a short free 3-terminal hydroxyl group, a single-stranded oligo that is capable of base pairing with a complementary template and serves as a starting point for copying the template strand. Nucleotide (single strand oligonucleotide). The primers can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. In addition, the primers are composed of sense and antisense nucleic acids having 7 to 50 nucleotide sequences, and contain 15 to 30 nucleic acids at a level that does not change the basic properties of the primer that serves as the starting point of DNA synthesis. It may have a nucleotide sequence.

As used herein, “probe” refers to a linear oligomer of natural or modified monomers or linkages, comprising deoxyribonucleotides and ribonucleotides, and specifically hybridizing to a target nucleotide sequence It can exist naturally, or it can be artificially synthesized.

Another aspect of the present invention provides a kit for diagnosing Alzheimer's disease comprising the above-described composition for diagnosing Alzheimer's disease.

The "Alzheimer's disease diagnosis kit" used in the present invention refers to a substance capable of diagnosing Alzheimer's disease through a biological sample collected from a test subject, and through this, Alzheimer's disease can be diagnosed quickly, accurately, and conveniently. In the present invention, the kit for diagnosing Alzheimer's disease includes an agent capable of measuring miRNA expression levels, and preferably includes a primer or a primer set as the agent.

According to one embodiment of the present invention, the kit may further include a reagent for nucleic acid amplification.

The nucleic acid amplification reagent may include conventional PCR reagents known in the art, and may include, for example, nucleoside triphosphate, (deoxy) ribonuclease inhibitor, thermostable polymerase, reaction buffer, and the like. It can, but is not limited thereto.

The nucleoside triphosphate refers to a molecule in which a purine-based or pyrimidine-based nucleoside is bonded to ribose or deoxyribose to form three phosphate groups, ) Adenosine triphosphate ((deoxy) adenosine triphosphate (ATP or dATP), (deoxy) guanosine triphosphate (GTP or dGTP), (deoxy) cytidine triphosphate ((deoxy) cytidine triphosphate , CTP or dCTP) and (deoxy)thymidine triphosphate (TTP or dTTP).

The reaction buffer may be Taq polymerase buffer, PCR buffer, etc., and is a compound added to the amplification reaction that changes the stability, activity and/or longevity of one or more components of the amplification reaction by adjusting the pH of the amplification reaction. This reaction buffer may further contain additives for optimizing an efficient PCR reaction.

According to one embodiment of the present invention, the kit may be at least one selected from the group consisting of PCR, RT-PCR kits, real-time PCR kits, and microarray chip kits.

According to one embodiment of the present invention, the kit may further include a reagent for separating nucleic acids.

The nucleic acid isolation reagent is a conventional RNA or miRNA extraction reagent known in the art, and may include a salt capable of cell lysis, a surfactant, a metal ion, a sugar, a reducing agent (eg, DTT), and the like. .

The kit according to the present invention may include, without limitation, a diagnostic kit based on conventional genetic quantitative analysis.

For example, when the kit is applied to a PCR amplification process, the kit of the present invention may optionally include reagents required for PCR amplification, such as a buffer, DNA polymerase, DNA polymerase cofactor, and dNTPs. In addition, the kit according to the present invention may be manufactured in a number of separate packaging or compartments including the above reagent components, and the kit of the present invention is a diagnostic kit including essential elements necessary for performing DNA or RNA chips. can be

Another aspect of the present invention is a step of collecting a biological sample from a subject in need of diagnosis; b) hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR- 1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a- 5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a- 3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2- 5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR- 4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa- miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR- 6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Measuring the expression level of one or more miRNAs selected from the group consisting of Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 and Mature_776; and c) providing information for diagnosing Alzheimer's disease, comprising comparing the measured miRNA expression level with a control group.

Steps a) to c) will be examined in detail in the following, and the description of the contents common to the above will be omitted to avoid excessive complexity.

Step a) is a process of collecting a biological sample from a subject who needs to be tested for Alzheimer's disease.

According to one embodiment of the present invention, the biological sample in step a) may be at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine, and tissue.

Step b) is a process of measuring the expression level together with the presence or absence of the biomarker miRNA in the biological sample.

According to one embodiment of the present invention, the miRNAs of step b) are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa- miR-136-3p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR- 376c-5p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, It may be at least one selected from the group consisting of hsa-miR-6809-5p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, and Mature_649. .

In addition, according to one embodiment of the present invention, the miRNAs of step b) are hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, It may be one or more selected from the group consisting of hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 and Mature_385.

According to one embodiment of the present invention, the miRNA expression level in step b) is determined by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease It may be measured by one or more methods selected from the group consisting of nuclease protection assay, in situ hybridization, microarray, and northern blot.

It is preferable to use the above-described composition or kit for diagnosing Alzheimer's disease according to the present invention to determine the level of miRNA expression.

Step c) is a process of determining Alzheimer's disease by comparing the amount of miRNA expression measured in the biological sample with a control group.

According to one embodiment of the present invention, the control group may be a normal person, an individual without suspected symptoms of Alzheimer's disease or an individual who has not been diagnosed with Alzheimer's disease, or a sample obtained therefrom.

According to one embodiment of the present invention, step c) comprises hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1233-5p, hsa- miR-136-3p, hsa-miR-136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR- 375-3p, hsa-miR-376a-2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410- 3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-494-3p, hsa-miR-5582-3p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa- The group consisting of miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 and Mature_776 Alzheimer's disease may be diagnosed if the expression level of one or more miRNAs selected from is higher than that of the control group.

In addition, according to one embodiment of the present invention, step c) is performed in an individual in which hsa-miR-10395-3p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-148a-5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR-301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR- 4743-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c- At least one miRNA selected from the group consisting of 5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-579-5p, hsa-miR-598-5p and hsa-miR-642a-5p If the expression level is lower than that of the control group, Alzheimer's disease may be diagnosed.

In the present invention, by providing a composition and kit for diagnosing Alzheimer's disease by presenting a novel biomarker capable of predicting Alzheimer's disease, it is possible to quickly and accurately diagnose Alzheimer's disease patients and provide appropriate treatment to Alzheimer's disease patients.

1 shows the number of reads for all 20 samples according to an embodiment of the present invention.
Figure 2 shows the types and ratios of small RNA (smRNA) classified in processing data according to an embodiment of the present invention.
Figure 3 shows the number of mature miRNAs commonly observed in all 20 samples according to an embodiment of the present invention.
4 shows the expression distribution of each sample based on log transformation and TMM normalization of original data (number of reads), reads per million (CPM) according to an embodiment of the present invention.
5 shows the expression density of each sample based on logarithmic transformation and TMM normalization for original data (number of reads), reads per million (CPM) according to an embodiment of the present invention.
FIG. 6 shows the degree of similarity between samples using Pearson's correlation coefficient for normal values according to an embodiment of the present invention.
7 illustrates hierarchical clustering analysis using normal values according to an embodiment of the present invention.
8 illustrates multidimensional scale analysis using normal values according to an embodiment of the present invention.
Figure 9 shows the number of up- and down-regulated mature miRNAs based on the fold change (fc) between the NC group and the LOAD group according to an embodiment of the present invention.
10 shows the number of up- and down-regulated mature miRNAs based on fold change and p value between the NC group and the LOAD group according to an embodiment of the present invention.
11 shows log-transformed fold changes and p values compared between the NC group and the LOAD group according to an embodiment of the present invention.
12 shows transcripts with expression differences compared to the NC group according to an embodiment of the present invention.
13 is a hierarchical clustering analysis of similarities between mature miRNAs and samples according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings. However, these descriptions are merely presented as examples to aid understanding of the present invention, and the scope of the present invention is not limited by these exemplary descriptions.

Example: Discovery of novel biomarkers for diagnosis of Alzheimer's disease

1. Population Selection

From April 2020 to February 2021, 10 normal controls (NC) and 10 late-onset Alzheimer's disease (LOAD) patients who had been tested for Alzheimer's disease including MMSE were selected to form the population (Table One).

division ID gender age MMSE NC 19 female 72 28 25 female 73 30 77 female 73 29 21 female 74 30 7 female 75 28 12 other 75 30 30 female 76 30 26 female 77 27 39 other 79 18 49 female 82 29 LOAD 86 female 72 25 46 too much 73 25 56 female 73 21 13 female 75 21 48 other 75 29 63 female 75 22 41 female 76 23 16 female 77 15 17 other 79 23 79 female 82 12

2. miNRA sequencing and data processing

NGS analysis was performed to analyze gene expression patterns between normal subjects and patients with Alzheimer's disease. Blood samples collected from the population were used for miRNA sequencing ( Homo sapiens miRNA sequencing), which was commissioned by Macrogen. Briefly, RNA present in blood was synthesized into cDNA using PrimeScript reverse transcriptase (RT) and SMARTer® smRNA-Seq Kit for Illumina® (TaKaRa), followed by PCR amplification. For data processing after sequencing analysis, the quality of raw sequence reads was evaluated, reads containing adapter sequences were excluded, and reads with trimmed reads and adapter sequences were excluded (non-adapter reads). read) (≥ 50 bp) was selected (Fig. 1). Thereafter, reads that match 100% in read length, sequence identity, etc. were collected to form one cluster, and then unnecessary rRNA was removed and used for miRNA profiling. Most of the rRNA was removed, and the remaining RNA was a short RNA of 18 to 100 nt, including a trim lead of 47 bp and a mature miRNA of 20 to 25 nt.

3. miRNA profiling

New miRNAs were predicted from processing data using the miRNA analysis software miRDeep2. First, by sequentially using the reference genome miRBase v22.1 (2,656 human miRNAs) and the non-coding RNA database RNAcentral 14.0, previously known miRNAs and other RNAs such as tRNA, snRNA, and snoRNA were identified. classified (FIG. 2). Thereafter, using the reference Homo sapiens GRCh3, previously unreported miRNAs were determined as novel miRNAs.

4. Results of differential expression miRNA analysis

Differential expression miRNA analysis was performed between samples in the NC group (n = 10) and LOAD group (n = 10). In the differential expression miRNA analysis, the number of mature miRNA reads obtained from the miRDeep2 Quantifier module was used as raw data.

First, as a data preprocessing process, data quality and similarity were checked. Of a total of 3,473 mature miRNAs (original data), 273 were commonly observed in all 20 samples, whereas 1,068 were not observed at all in all samples. 895 mature miRNAs (processed data) commonly observed in 10 or more samples, more than half of the total number of samples, were used for analysis (FIG. 3). Then, data transformation and normalization were performed to reduce the systematic bias of the data. The read size of the original data was estimated using the calcNormFactors method, and the number of reads was log-transformed into counts per million reads (CPM), which was normalized using the Trimmed Mean of M-values (TMM) method (FIG. 4). Here, 1 was added to the CPM or normalized number of reads to avoid negative values. And the original data, log transformation and TMM normalization were visualized to show the expression density per sample (Fig. 5). In order to analyze the association between each sample, the similarity between each sample was identified using the Pearson's coefficient (r) of the normalized value for each sample. The correlation coefficient (r) ranged from about 0.7 to 1.0 (FIG. 6). Subsequently, in the hierarchical clustering analysis, samples having high expression similarity were grouped using the normal value of each sample (FIG. 7). Here, Euclidean distance was used as the distance metric and Complete Linkage was used as the linkage method. In order to represent the variability of the entire data, the similarity between the samples was shown in a two-dimensional graph using the normal value of each sample through multidimensional scaling analysis (FIG. 8). In the graph, the presence or absence of samples with outliers and the similarity of expression patterns between groups could be confirmed.

Then, statistical analysis (fold change and exactTest) was performed on 895 mature miRNAs to identify up- and down-regulated mature miRNAs between the NC and LOAD groups. Among 895, 114 mature miRNAs showed expression differences by fold change (fc) (FIG. 9), and 65 mature miRNAs showed significant expression differences by fold change and p value (FIG. 10). . |fc| 64 mature miRNAs satisfying the conditions of ≥ 2 and an initial p value of exactTest < 0.05 were selected as significant data (Table 2). The fold change and p value were log-transformed by comparison between the NC group and the LOAD group (FIG. 11). In addition, according to the overall average expression level, it was shown as a scatter plot to identify miRNAs with a large expression difference compared to the NC group (FIG. 12). For example, it can be said that mature miRNAs are more reliable if they are higher than the average logCPM even if there is a difference of more than 2-fold in fold change. Taken together, the similarities between mature miRNAs and samples were clustered according to the expression level (normal value) of the core data and presented in a hierarchical clustering analysis (FIG. 13).

fold change
> 2 p-value
<0.05 fold change
> 2 p-value
<0.05 hsa-miR-1-3p 2.463 0.0401 hsa-miR-4485-5p 10.264 0.0017 hsa-miR-10393-5p 3.291 0.0332 hsa-miR-4645-3p -2.182 0.0170 hsa-miR-10395-3p -14.515 0.0003 hsa-miR-4659b-5p -2.242 0.0374 hsa-miR-122-3p 3.431 0.0090 hsa-miR-4743-5p -2.815 0.0460 hsa-miR-1233-5p 2.981 0.0301 hsa-miR-490-5p -3.147 0.0389 hsa-miR-1287-3p -2.333 0.0174 hsa-miR-494-3p 2.080 0.0398 hsa-miR-1287-5p -2.073 0.0272 hsa-miR-497-5p -2.272 0.0096 hsa-miR-1296-3p -3.776 0.0405 hsa-miR-518e-5p -2.789 0.0112 hsa-miR-136-3p 2.228 0.0091 hsa-miR-519a-5p -2.789 0.0111 hsa-miR-136-5p 2.172 0.0420 hsa-miR-519b-5p -2.794 0.0113 hsa-miR-148a-5p -2.612 0.0420 hsa-miR-519c-5p -2.794 0.0113 hsa-miR-15a-5p 2.054 0.0406 hsa-miR-522-5p -2.793 0.0113 hsa-miR-188-3p -2.179 0.0334 hsa-miR-523-5p -2.793 0.0113 hsa-miR-199a-5p -2.193 0.0175 hsa-miR-5582-3p 2.796 0.0344 hsa-miR-19b-2-5p -2.897 0.0309 hsa-miR-579-5p -2.015 0.0409 hsa-miR-214-3p -2.149 0.0162 hsa-miR-598-5p -2.665 0.0343 hsa-miR-27a-5p -2.075 0.0166 hsa-miR-642a-5p -3.195 0.0370 hsa-miR-29a-3p -2.971 0.0004 hsa-miR-6809-5p 2.674 0.0080 hsa-miR-301b-5p -2.559 0.0037 hsa-miR-6825-5p 2.395 0.0448 hsa-miR-323b-3p 2.119 0.0281 hsa-miR-6842-5p 2.297 0.0130 hsa-miR-329-3p 2.031 0.0382 hsa-miR-6858-3p 2.983 0.0316 hsa-miR-3667-3p 3.060 0.0250 hsa-miR-7112-3p 3.327 0.0243 hsa-miR-375-3p 3.218 0.0226 hsa-miR-758-5p 4.532 0.0147 hsa-miR-376a-2-5p 2.432 0.0256 Mature_99 4.733 0.0089 hsa-miR-376a-3p 2.051 0.0252 Mature_141 14.250 0.0011 hsa-miR-376b-5p 3.295 0.0036 Mature_163 6.791 0.0306 hsa-miR-376c-5p 3.145 0.0033 Mature_167 3.024 0.0317 hsa-miR-3920 2.458 0.0211 Mature_184 4.433 0.0421 hsa-miR-410-3p 2.165 0.0384 Mature_258 5.417 0.0071 hsa-miR-4301 -2.469 0.0437 Mature_385 23.504 0.0001 hsa-miR-4436b-3p -2.068 0.0219 Mature_649 3.799 0.0234 hsa-miR-4467 3.133 0.0462 Mature_776 2.468 0.0248 * hsa-miR is a mature miRNA reported in the reference, and Mature is a sequence predicted as a novel miRNA

Table 2 above shows 64 mature miRNAs corresponding to the core data, including 55 previously reported mature miRNAs and 9 new mature miRNAs first identified in this sequencing analysis. These miRNAs were selected as candidate biomarkers for diagnosis of Alzheimer's disease.

The sequences of 9 new mature miRNAs are shown in Table 3 below.

Novel mature miRNA Base sequence (5'-3') sequence number Mature_99 TTGTTTTTGGGGTTTGGCAG One Mature_141 AGGATGAGACTCCGTCAC 2 Mature_163 CTCAGGCTACACCCTAGACC 3 Mature_167 GGGGGGAGGGGGGAAAAAGG 4 Mature_184 CATGGAGGCCATGGGGTGG 5 Mature_258 ACTGAAGAATGGAGAGAG 6 Mature_385 GGAGGCCATGGGGTTGGGG 7 Mature_649 CATGGAGGCCATGGGGTCA 8 Mature_776 AGAGCGAGACCCCGTCTCTT 9

And, as shown in Table 4 below, among the 64 miRNAs, 28 miRNAs with a fold change (fc) in the expression level compared to the NC group were more than 3 times or the p value was less than 0.01 (fc > 3 or p < 0.01) for Alzheimer's disease diagnosis. It was selected as a biomarker, and it can be expected that 9 miRNAs (fc > 3 and p < 0.01) satisfying all of the above conditions will improve the accuracy and reliability of Alzheimer's disease diagnosis.

fold change
> 3 p-value
<0.01 hsa-miR-10393-5p O - hsa-miR-10395-3p O O hsa-miR-122-3p O O hsa-miR-1296-3p O - hsa-miR-136-3p - O hsa-miR-29a-3p - O hsa-miR-301b-5p - O hsa-miR-3667-3p O - hsa-miR-375-3p O - hsa-miR-376b-5p O O hsa-miR-376c-5p O O hsa-miR-4467 O - hsa-miR-4485-5p O O hsa-miR-4659b-5p - O hsa-miR-490-5p O - hsa-miR-497-5p - O hsa-miR-642a-5p O - hsa-miR-6809-5p - O hsa-miR-7112-3p O - hsa-miR-758-5p O - Mature_99 O O Mature_141 O O Mature_163 O - Mature_167 O - Mature_184 O - Mature_258 O O Mature_385 O O Mature_649 O -

So far, the present invention has been looked at with respect to its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

<110> BioNano Health Guard Research Center SEOUL NATIONAL UNIVERSITY HOSPITAL <120> Biomarkers for early diagnosing Alzheimer's disease and uses its <130> SNUBH <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> artificial sequence <220> <223> mature_99 <400> 1 ttgtttttgg ggtttggcag 20 <210> 2 <211> 18 <212> RNA <213> artificial sequence <220> <223> mature_141 <400> 2 aggatgagac tccgtcac 18 <210> 3 <211> 20 <212> RNA <213> artificial sequence <220> <223> mature_163 <400> 3 ctcaggctac accctagacc 20 <210> 4 <211> 20 <212> RNA <213> artificial sequence <220> <223> mature_167 <400> 4 ggggggaggg gggaaaaagg 20 <210> 5 <211> 19 <212> RNA <213> artificial sequence <220> <223> mature_184 <400> 5 catggaggcc atggggtgg 19 <210> 6 <211> 18 <212> RNA <213> artificial sequence <220> <223> mature_258 <400> 6 actgaagaat ggagagag 18 <210> 7 <211> 19 <212> RNA <213> artificial sequence <220> <223> mature_385 <400> 7 ggaggccatg gggttgggg 19 <210> 8 <211> 19 <212> RNA <213> artificial sequence <220> <223> mature_649 <400> 8 catggaggcc atggggtca 19 <210> 9 <211> 20 <212> RNA <213> artificial sequence <220> <223> mature_776 <400> 9 agagcgagac cccgtctctt 20

Claims (12)

hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-1287-3p, hsa- miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a-5p, hsa-miR- 188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR- 301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2-5p, hsa-miR- 376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR-4436b-3p, hsa- miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494- 3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa- miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, A composition for diagnosing Alzheimer's disease comprising an agent for measuring the expression level of at least one miRNA selected from the group consisting of Mature_385, Mature_649 and Mature_776. The method of claim 1,
The Mature_99 is represented by SEQ ID NO: 1, the Mature_141 is represented by SEQ ID NO: 2, the Mature_163 is represented by SEQ ID NO: 3, the Mature_167 is represented by SEQ ID NO: 4, and the Mature_184 is represented by SEQ ID NO: 5 , wherein the Mature_258 is represented by SEQ ID NO: 6, the Mature_385 is represented by SEQ ID NO: 7, the Mature_649 is represented by SEQ ID NO: 8, and the Mature_776 is represented by SEQ ID NO: 9. composition. The method of claim 1,
The miRNAs are hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-29a-3p , hsa-miR-301b-5p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4467, hsa-miR -4485-5p, hsa-miR-4659b-5p, hsa-miR-490-5p, hsa-miR-497-5p, hsa-miR-642a-5p, hsa-miR-6809-5p, hsa-miR-7112 At least one composition selected from the group consisting of -3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385 and Mature_649. The method of claim 1,
The miRNAs are hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-4485-5p, Mature_99, Mature_141, Mature_258 and Mature_385 A composition that is one or more selected from the group consisting of. The method of claim 1,
Wherein the agent is at least one selected from the group consisting of primers, probes, and antisense oligonucleotides that specifically bind to miRNA. A kit for diagnosing Alzheimer's disease comprising the composition of any one of claims 1 to 5. The method of claim 6,
The kit further comprises a reagent for nucleic acid amplification. a) collecting a biological sample from a subject in need of diagnosis;
b) hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-10395-3p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR- 1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-136-3p, hsa-miR-136-5p, hsa-miR-148a-5p, hsa-miR-15a- 5p, hsa-miR-188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a- 3p, hsa-miR-301b-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a-2- 5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4301, hsa-miR- 4436b-3p, hsa-miR-4467, hsa-miR-4485-5p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p, hsa-miR-494-3p, hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa- miR-522-5p, hsa-miR-523-5p, hsa-miR-5582-3p, hsa-miR-579-5p, hsa-miR-598-5p, hsa-miR-642a-5p, hsa-miR- 6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR-6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Measuring the expression level of one or more miRNAs selected from the group consisting of Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 and Mature_776; and
c) comparing the measured miRNA expression level with a control group
Method for providing information for diagnosing Alzheimer's disease comprising a. The method of claim 8,
Wherein the biological sample of step a) is at least one selected from the group consisting of blood, plasma, serum, lymph, saliva, urine and tissue. The method of claim 8,
The level of miRNA expression in step b) was determined by polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, nuclease protection assay, in A method that is measured by at least one method selected from the group consisting of in situ hybridization, microarray, and northern blot. The method of claim 8,
Step c) may be performed in the subject with hsa-miR-1-3p, hsa-miR-10393-5p, hsa-miR-122-3p, hsa-miR-1233-5p, hsa-miR-136-3p, hsa-miR -136-5p, hsa-miR-15a-5p, hsa-miR-323b-3p, hsa-miR-329-3p, hsa-miR-3667-3p, hsa-miR-375-3p, hsa-miR-376a -2-5p, hsa-miR-376a-3p, hsa-miR-376b-5p, hsa-miR-376c-5p, hsa-miR-3920, hsa-miR-410-3p, hsa-miR-4467, hsa -miR-4485-5p, hsa-miR-494-3p, hsa-miR-5582-3p, hsa-miR-6809-5p, hsa-miR-6825-5p, hsa-miR-6842-5p, hsa-miR The expression level of one or more miRNAs selected from the group consisting of -6858-3p, hsa-miR-7112-3p, hsa-miR-758-5p, Mature_99, Mature_141, Mature_163, Mature_167, Mature_184, Mature_258, Mature_385, Mature_649 and Mature_776 A method of diagnosing Alzheimer's disease if it is higher than the control group. The method of claim 8,
Step c) may be performed in the subject with hsa-miR-10395-3p, hsa-miR-1287-3p, hsa-miR-1287-5p, hsa-miR-1296-3p, hsa-miR-148a-5p, hsa-miR -188-3p, hsa-miR-199a-5p, hsa-miR-19b-2-5p, hsa-miR-214-3p, hsa-miR-27a-5p, hsa-miR-29a-3p, hsa-miR -301b-5p, hsa-miR-4301, hsa-miR-4436b-3p, hsa-miR-4645-3p, hsa-miR-4659b-5p, hsa-miR-4743-5p, hsa-miR-490-5p , hsa-miR-497-5p, hsa-miR-518e-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-522-5p, hsa -If the expression level of one or more miRNAs selected from the group consisting of miR-523-5p, hsa-miR-579-5p, hsa-miR-598-5p, and hsa-miR-642a-5p is lower than that of the control group, Alzheimer's disease How to diagnose.