KR20220052474A - MicroRNA-21-3p for diagnosing rosacea and use thereof - Google Patents

MicroRNA-21-3p for diagnosing rosacea and use thereof Download PDF

Info

Publication number
KR20220052474A
KR20220052474A KR1020200136469A KR20200136469A KR20220052474A KR 20220052474 A KR20220052474 A KR 20220052474A KR 1020200136469 A KR1020200136469 A KR 1020200136469A KR 20200136469 A KR20200136469 A KR 20200136469A KR 20220052474 A KR20220052474 A KR 20220052474A
Authority
KR
South Korea
Prior art keywords
rosacea
mir
diagnosing
microrna
expression level
Prior art date
Application number
KR1020200136469A
Other languages
Korean (ko)
Inventor
류성호
김정은
서수민
Original Assignee
순천향대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 순천향대학교 산학협력단 filed Critical 순천향대학교 산학협력단
Priority to KR1020200136469A priority Critical patent/KR20220052474A/en
Publication of KR20220052474A publication Critical patent/KR20220052474A/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a biomarker for diagnosing rosacea and uses thereof. More specifically, in microRNA-21-3p (miR-21-3p) according to the present invention, a significantly increased expression in the tissues of patients with rosacea compared to normal people is confirmed so that the miR-21-3p can be used not only as a biomarker for diagnosing rosacea but also as a new target for treating rosacea.

Description

주사증 진단을 위한 마이크로RNA-21-3p 및 이의 용도{MicroRNA-21-3p for diagnosing rosacea and use thereof}MicroRNA-21-3p for diagnosing rosacea and its use {MicroRNA-21-3p for diagnosing rosacea and use thereof}

본 발명은 주사증 진단을 위한 마이크로RNA-21-3p 및 이의 용도에 관한 것으로, 보다 상세하게는 주사증을 진단할 수 있는 마이크로RNA-21-3p을 포함하는 바이오마커 조성물, 상기 마이크로RNA-21-3p의 발현수준을 측정하는 제제를 포함하는 주사증 진단용 조성물 및 키트, 상기 바이오마커를 이용하여 주사증을 진단하는 방법에 관한 것이다.The present invention relates to microRNA-21-3p for diagnosing rosacea and its use, and more particularly, to a biomarker composition comprising microRNA-21-3p capable of diagnosing rosacea, the microRNA-21 A composition and kit for diagnosing rosacea comprising an agent for measuring the expression level of -3p, and a method for diagnosing rosacea using the biomarker.

주사증은 얼굴의 중심부인 코와 같은 돌출부에 반복적인 충혈과 지속성 홍반이 나타나고, 구진, 농포, 모세혈관의 확장이 관찰되는 만성염증성 피부질환으로 다인성 병인으로 알려져 있다. Rosacea is a chronic inflammatory skin disease in which repeated redness and persistent erythema appear in the protrusion such as the nose, which is the central part of the face, and papules, pustules, and capillary expansion are observed. It is known as a multifactorial etiology.

주사증의 원인과 특별한 치료법은 알려져 있지 않지만 피부의 혈관과 모피지선 단위를 포함하는 지속적인 염증을 유발하는 특징을 가진다. Although the cause and specific treatment for rosacea are not known, it has the characteristic of inducing continuous inflammation involving the blood vessels of the skin and the pilosebaceous gland units.

Small non-coding RNA인 microRNA(miRNA)가 많은 질병에서 유전자 발현을 조절하는데 중요한 조절인자로 알려지면서 miRNA을 진단 표지자 또는 치료 표적으로 활용하고자 하는 연구들이 활발히 수행 중이며, 특히, 최근 여러 연구를 통해 miRNA가 다양한 피부질환에서 중요한 역할을 한다고 알려져 왔다. As microRNA (miRNA), a small non-coding RNA, is known as an important regulator in regulating gene expression in many diseases, studies to utilize miRNA as a diagnostic marker or therapeutic target are being actively conducted. has been known to play an important role in various skin diseases.

그럼에도 불구하고 피부질환에서 miRNA의 주요 역할은 밝혀져 있지 않고, 무엇보다도 주사증에서 이들 miRNA와 관련된 연구는 전무한 실정이다.Nevertheless, the major role of miRNAs in skin diseases has not been elucidated, and above all, studies related to these miRNAs in rosacea are nonexistent.

국제공개특허 WO 2004/093886 (2004.11.04)International Patent Publication WO 2004/093886 (2004.11.04)

상기와 같이, 피부질환에서 miRNA의 주요 역할이 밝혀져 있지 않고 무엇보다도 주사증에서 이들 miRNA와 관련된 연구가 많이 행해져 있지 않은 점에서 본 발명에서는 주사증 환자의 조직 샘플로부터 얻은 miRNA를 이용해 주사증의 signaling pathway를 분석하고 주사증의 발병기전에 미치는 영향을 밝혀, 이를 바탕으로 주사증의 진단 및 치료 기술 개발에 이용하는 것을 목적으로 한다.As described above, since the major role of miRNAs in skin diseases has not been elucidated and, above all, studies related to these miRNAs in rosacea have not been conducted, in the present invention, signaling of rosacea using miRNAs obtained from tissue samples from patients with rosacea. The purpose of this study is to analyze the pathway and find out the effect on the pathogenesis of rosacea, and use it for diagnosis and treatment technology development of rosacea based on this.

상기 목적을 달성하기 위하여, 본 발명은 마이크로RNA-21-3p을 포함하는, 주사증 진단용 바이오마커 조성물을 제공한다.In order to achieve the above object, the present invention provides a biomarker composition for diagnosis of rosacea, comprising microRNA-21-3p.

또한, 본 발명은 마이크로RNA-21-3p의 발현수준을 측정하는 제제를 포함하는, 주사증 진단용 조성물 및 이를 이용한 키트를 제공한다.In addition, the present invention provides a composition for diagnosing rosacea and a kit using the same, comprising an agent for measuring the expression level of microRNA-21-3p.

또한, 본 발명은 피검체로부터 분리된 생물학적 시료에서 마이크로RNA-21-3p의 발현수준을 측정하는 단계를 포함하는, 주사증 진단을 위한 정보제공방법을 제공한다.In addition, the present invention provides an information providing method for diagnosing rosacea, comprising measuring the expression level of microRNA-21-3p in a biological sample isolated from a subject.

본 발명에 따른 마이크로RNA-21-3p은 정상인에 비해 주사증 환자의 조직에서 유의하게 발현이 증가하는 것을 확인함으로써, miR-21-3p를 주사증의 진단용 바이오마커로 활용할 수 있을 뿐 아니라, 주사증 치료의 새로운 표적으로 활용할 수 있을 것으로 기대된다.By confirming that the expression of the microRNA-21-3p according to the present invention is significantly increased in the tissues of patients with rosacea compared to normal individuals, miR-21-3p can be utilized as a diagnostic biomarker for rosacea, as well as the main It is expected that it can be used as a new target for visa treatment.

도 1은 주사증 환자의 조직에서 발현이 증가하는 마이크로RNA-21-3p의 발현수준을 나타낸 결과이다.1 is a result showing the expression level of microRNA-21-3p, the expression of which is increased in the tissues of patients with rosacea.

이하, 본 발명을 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명자들은 정상인 및 주사증 환자에서 조직을 채취하고 이로부터 RNA를 분리한 후 NGS 분석을 통해 마이크로RNA의 발현수준을 비교분석한 결과, 정상인에 비해 주사증 환자에서 마이크로RNA-21-3p(miR-21-3p)의 발현이 유의하게 증가하는 것을 발견하였는바, 이에 기초하여 본 발명을 완성하였다.The present inventors compared and analyzed the expression level of microRNA through NGS analysis after extracting tissue from normal persons and patients with rosacea and separating RNA from it. As a result, microRNA-21-3p (miR -21-3p) was found to increase significantly, the present invention was completed based on this.

이에, 본 발명은 miR-21-3p을 포함하는, 주사증 진단용 바이오마커 조성물을 제공한다.Accordingly, the present invention provides a biomarker composition for diagnosing rosacea, including miR-21-3p.

본 발명은 miR-21-3p의 발현수준을 측정하는 제제를 포함하는, 주사증 진단용 조성물을 제공한다.The present invention provides a composition for diagnosing rosacea, comprising an agent for measuring the expression level of miR-21-3p.

상기 miR-21-3p은 서열번호 1의 염기서열(CAACACCAGUCGAUGGGCUGU)로 이루어진 것일 수 있다.The miR-21-3p may consist of the nucleotide sequence of SEQ ID NO: 1 (CAACACCAGUCGAUGGGCUGU).

본 발명에서 사용되는 용어, “주사증”이란 얼굴의 중심부, 이마, 턱, 광대뼈, 코와 같은 돌출부에 반복적인 충혈과 지속성 홍반이 나타나고, 구진, 농포, 모세혈관의 확장과 함께 민감성의 증가가 관찰되는 만성재발성 질환이다. 일시적 홍반, 지속성 홍반, 구진, 농포 및 혈관확장증 중 1개 이상의 증상이 있을 때, 주사증으로 진단한다.As used herein, the term “rosacea” refers to repeated redness and persistent erythema in protrusions such as the central part of the face, forehead, chin, cheekbones, and nose, and increased sensitivity along with papules, pustules, and capillary expansion. It is a chronic recurrent disease observed. When one or more of transient erythema, persistent erythema, papule, pustule, and vasodilation are present, rosacea is diagnosed.

본 발명에서 사용되는 용어, “진단(diagnosis)”이란 넓은 의미로는 환자의 병의 실태를 모든 면에 걸쳐서 판단하는 것을 의미한다. 판단의 내용은 병명, 병인, 병형, 경중, 병상의 상세한 양태, 및 합병증의 유무 등이다. 본 발명에서 진단은 주사증의 발병 여부 및 진행단계 수준 등을 판단하는 것이다.As used herein, the term “diagnosis” in a broad sense means judging the actual condition of a patient's disease in all aspects. The content of the judgment is the disease name, etiology, disease type, severity, detailed mode of the disease, and the presence or absence of complications. Diagnosis in the present invention is to determine whether or not the onset of rosacea and the level of progression.

상기 제제는 miR-21-3p에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브일 수 있지만, 이에 한정되는 것은 아니다.The agent may be sense and antisense primers or probes complementary to miR-21-3p, but is not limited thereto.

본 발명에서 사용되는 용어, “프라이머”란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화등으로 변형시킬 수 있다.As used herein, the term “primer” refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. as a short gene sequence serving as a starting point of DNA synthesis. The primers may be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method.

본 발명에서 사용되는 용어, “프로브”란 효소 화학적인 분리정제 또는 합성과정을 거쳐 제작된 수 염기 내지 수백 염기길이의 mRNA와 특이적으로 결합할 수 있는 핵산을 의미한다. 방사성 동위원소나 효소 등을 표지하여 mRNA의 존재 유무를 확인할 수 있으며, 공지된 방법으로 디자인하고 변형시켜 사용할 수 있다.As used herein, the term “probe” refers to a nucleic acid capable of specifically binding to mRNA having a length of several bases to several hundreds of bases produced through enzymatic, chemical separation, purification or synthesis. The presence or absence of mRNA can be checked by labeling radioactive isotopes or enzymes, and it can be designed and modified by a known method.

또한, 본 발명은 상기 조성물을 포함하는, 주사증 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing rosacea, comprising the composition.

본 발명에 따른 진단용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성될 수 있다.The diagnostic kit according to the present invention may be composed of one or more other component compositions, solutions or devices suitable for the assay method.

예컨대, 본 발명의 키트는 PCR을 수행하기 위해, 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 바이오마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.For example, in order to perform PCR, the kit of the present invention includes genomic DNA derived from a sample to be analyzed, a primer set specific for the biomarker gene of the present invention, an appropriate amount of DNA polymerase, a dNTP mixture, a PCR buffer and water. It may be a kit comprising a. The PCR buffer may contain KCl, Tris-HCl and MgCl2. In addition, components necessary for performing electrophoresis that can confirm whether or not the PCR product is amplified may be additionally included in the kit of the present invention.

또한, 본 발명의 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 바이오마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. In addition to each primer pair specific for a biomarker gene, the RT-PCR kit contains a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like may be included. In addition, a primer pair specific for a gene used as a quantitative control may be included.

또한, 본 발명은 피검체로부터 분리된 생물학적 시료에서 miR-21-3p의 발현수준을 측정하는 단계를 포함하는, 주사증 진단을 위한 정보제공방법을 제공한다.In addition, the present invention provides an information providing method for diagnosing rosacea, comprising measuring the expression level of miR-21-3p in a biological sample isolated from a subject.

본 발명에 있어서, 상기 방법에 따라 주사증 환자 유래 생물학적 시료에서 분리된 miR-21-3p 발현수준이 정상인보다 높을 경우 주사증으로 판정할 수 있다.In the present invention, when the expression level of miR-21-3p isolated from a biological sample derived from a patient with rosacea according to the above method is higher than that of a normal person, rosacea can be determined.

상기 생물학적 시료는 조직, 세포, 전혈, 혈액, 타액, 객담, 뇌척수액 또는 뇨 등을 포함할 수 있고, 보다 바람직하게는 조직일 수 있으나 이에 한정되는 것은 아니다.The biological sample may include tissue, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid or urine, and more preferably, a tissue, but is not limited thereto.

상기 miR-21-3p의 발현수준은 당업계에 알려진 통상적인 방법으로 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정될 수 있으나, 이에 한정되는 것은 아니다.The expression level of miR-21-3p is determined by a conventional method known in the art, such as next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time Polymerase chain reaction (Real-time PCR), RNase protection assay (RPA), microarray (microarray), and Northern blotting (northern blotting) to be measured through one or more methods selected from the group consisting of However, the present invention is not limited thereto.

본 발명에서 사용되는 용어 "주사증의 진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로써 주사증의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.The term "information providing method for diagnosis of rosacea" as used in the present invention provides objective basic information necessary for the diagnosis of rosacea as a preliminary step for diagnosis, and the clinical judgment or opinion of a doctor is excluded.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이며 본 발명의 내용을 예시하는 것일 뿐이므로 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다.Hereinafter, examples will be described in detail to help the understanding of the present invention. However, the following examples are provided to more completely explain the present invention to those with average knowledge in the art, and are only illustrative of the contents of the present invention, so that the scope of the present invention is limited to the following examples not.

<< 실시예Example 1> 실험준비 및 실험방법 1> Experiment preparation and method

1-1. 분석 대상 모집1-1. Recruitment for analysis

본 발명자들은 주사증을 진단할 수 있는 마커를 발굴하고자, 정상인 및 주사증 환자들로부터 조직 시료를 채취하여 이들 간 차이를 나타내는 생체지표를 찾고자 하였다.In order to discover markers for diagnosing rosacea, the present inventors sought to find biomarkers indicating differences between normal people and patients with rosacea by collecting tissue samples.

이를 위해 순천향대학교 천안병원에서 주사증으로 판정 받은 환자 40명과 정상 대조군 8명으로부터 조직검체를 제공받았다. 이때 정상인은 당뇨, 비만, 혈압 질환, 및 암 등의 병이 없고 기존에 아토피피부염.건선 등의 염증성 피부질환이 없는 사람을 대상으로 하였으며, 상기 주사증으로 판정 받은 환자 중 15명의 환자는 주사증 병변이 없는 비병변부에서도 조직검체를 함께 채취하였다. 한편, 본 연구는 순천향대학교의 임상연구윤리위원회의(IRB)의 승인을 받은 후 진행하였다.For this purpose, tissue samples were provided from 40 patients diagnosed with rosacea and 8 normal controls at Soonchunhyang University Cheonan Hospital. At this time, the subjects were normal people without diseases such as diabetes, obesity, blood pressure disease, cancer, etc., and did not have inflammatory skin diseases such as atopic dermatitis or psoriasis. Tissue specimens were also collected from non-lesion-free areas. Meanwhile, this study was conducted after receiving approval from the Clinical Research Ethics Committee (IRB) of Soonchunhyang University.

1-2. 조직으로부터 RNA 분리 및 서열분석 수행1-2. RNA isolation and sequencing from tissue

상기 실시예 1-1에서 주사증 환자 및 정상인으로부터 채취한 조직 시료로부터 Qiagen miRNeasy kit을 이용하여 총 RNA를 분리하였으며, 분리된 총 RNA의 질은 Agilent RNA Bioanalyzer를 이용해 제조사의 지시에 따라 측정하였다.In Example 1-1, total RNA was isolated from tissue samples collected from patients with rosacea and normal persons using the Qiagen miRNeasy kit, and the quality of the isolated total RNA was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.

이후 상기 분리된 RNA를 이용하여 마크로젠사에서 Takara SMARTer smRNA for illumina kit을 사용하여 라이브러리를 제작한 후 Hiseq 2500으로 차세대 염기서열 분석(NGS)을 실시하였으며, 2,656개의 mature microRNA 중 주사증 환자의 비병변과 병변을 비교했을 대 211개의 마이크로RNA(microRNA; miRNA)가 검출되었다.Then, using the isolated RNA, Macrogen prepared a library using Takara SMARTer smRNA for illumina kit, and then next-generation sequencing (NGS) was performed with Hiseq 2500. 211 microRNAs (miRNAs) were detected when lesions were compared.

<실시예 2> 주사증 진단용 miRNA 발굴<Example 2> Discovery of miRNA for diagnosis of rosacea

본 발명자들은 주사증을 진단할 수 있는 마커를 발굴하기 위해, 정상인에 비해 주사증 환자에서 유의하게 발현이 변화하는 miRNA를 발굴하였다. 이를 위해, 상기 실시예 1-1 및 1-2의 방법에 따라 정상인과 주사증 환자에서 각각 채취한 조직으로부터 miRNA의 발현수준을 비교하였다.In order to discover a marker for diagnosing rosacea, the present inventors have discovered miRNA whose expression is significantly changed in rosacea patients compared to normal individuals. To this end, according to the methods of Examples 1-1 and 1-2, the expression levels of miRNAs were compared from tissues collected from normal people and patients with rosacea.

그 결과, 도 1과 나타낸 바와 같이 miR-21-3p가 정상인에 비해 주사증 환자에서 발현이 현저히 증가하는 것을 확인하였다. As a result, as shown in FIG. 1 , it was confirmed that the expression of miR-21-3p was significantly increased in patients with rosacea compared to normal subjects.

상기 결과로부터 miR-21-3p가 주사증을 진단할 수 있는 유용한 바이오마커임을 확인하였고, 더불어 치료 타겟으로 활용될 수 있음을 시사한다.From the above results, it was confirmed that miR-21-3p is a useful biomarker for diagnosing rosacea, suggesting that it can be utilized as a therapeutic target.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. Do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> MicroRNA-21-3p for diagnosing rosacea and use thereof <130> ADP-2020-0523 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> RNA <213> Human <400> 1 caacaccagu cgaugggcug u 21 <110> Sonchhunhyang University Industry Academy Cooperation Foundation <120> MicroRNA-21-3p for diagnosing rosacea and use thereof <130> ADP-2020-0523 <160> 1 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> RNA <213> Human <400> 1 caacaccagu cgaugggcug u 21

Claims (10)

마이크로RNA-21-3p(miR-21-3p)을 포함하는, 주사증 진단용 바이오마커 조성물.A biomarker composition for diagnosis of rosacea, comprising microRNA-21-3p (miR-21-3p). 제 1 항에 있어서, 상기 miR-21-3p은 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는, 주사증 진단용 바이오마커 조성물.The biomarker composition for diagnosing rosacea according to claim 1, wherein the miR-21-3p comprises the nucleotide sequence of SEQ ID NO: 1. 마이크로RNA-21-3p(miR-21-3p)의 발현수준을 측정하는 제제를 포함하는, 주사증 진단용 조성물.A composition for diagnosing rosacea, comprising an agent for measuring the expression level of microRNA-21-3p (miR-21-3p). 제 3 항에 있어서, 상기 miR-21-3p은 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는, 주사증 진단용 조성물.The composition for diagnosing rosacea according to claim 3, wherein the miR-21-3p comprises the nucleotide sequence of SEQ ID NO: 1. 제 3 항에 있어서, 상기 제제는 miR-21-3p에 상보적으로 결합하는 센스 및 안티센스 프라이머, 또는 프로브인 것을 특징으로 하는, 주사증 진단용 조성물.The composition for diagnosing rosacea according to claim 3, wherein the agent is a sense and antisense primer or probe that complementarily binds to miR-21-3p. 제 3 항에 따른 조성물을 포함하는, 주사증 진단용 키트.A kit for diagnosing rosacea, comprising the composition according to claim 3. 피검체로부터 분리된 생물학적 시료에서 마이크로RNA-21-3p(miR-21-3p)의 발현수준을 측정하는 단계를 포함하는, 주사증 진단을 위한 정보제공방법.A method for providing information for diagnosing rosacea, comprising measuring the expression level of microRNA-21-3p (miR-21-3p) in a biological sample isolated from a subject. 제 7 항에 있어서, 상기 피검체로부터 분리된 생물학적 시료에서 측정된 miR-21-3p의 발현수준은 정상대조군의 발현수준보다 높을 경우 주사증으로 진단하는 것을 특징으로 하는, 주사증 진단을 위한 정보제공방법.The information for diagnosis of rosacea according to claim 7, wherein when the expression level of miR-21-3p measured in the biological sample isolated from the subject is higher than the expression level of the normal control group, rosacea is diagnosed. How to provide. 제 7 항에 있어서, 상기 miR-21-3p은 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는, 주사증 진단을 위한 정보제공방법.The method of claim 7, wherein the miR-21-3p comprises the nucleotide sequence of SEQ ID NO: 1. 제 7 항에 있어서, 상기 miR-21-3p의 발현수준은 차세대 염기서열 분석(Next generation sequencing; NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), RNase 보호 분석법(RNase protection assay; RPA), 마이크로어레이(microarray), 및 노던 블롯팅(northern blotting)으로 이루어진 군으로부터 선택되는 1종 이상의 방법을 통해 측정되는 것을 특징으로 하는, 주사증 진단을 위한 정보제공방법.The method according to claim 7, wherein the expression level of miR-21-3p is determined by next generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase Chain reaction (Real-time PCR), RNase protection assay (RPA), microarray (microarray), characterized in that measured through one or more methods selected from the group consisting of northern blotting (northern blotting) A method of providing information for diagnosing rosacea.
KR1020200136469A 2020-10-21 2020-10-21 MicroRNA-21-3p for diagnosing rosacea and use thereof KR20220052474A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200136469A KR20220052474A (en) 2020-10-21 2020-10-21 MicroRNA-21-3p for diagnosing rosacea and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200136469A KR20220052474A (en) 2020-10-21 2020-10-21 MicroRNA-21-3p for diagnosing rosacea and use thereof

Publications (1)

Publication Number Publication Date
KR20220052474A true KR20220052474A (en) 2022-04-28

Family

ID=81448093

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200136469A KR20220052474A (en) 2020-10-21 2020-10-21 MicroRNA-21-3p for diagnosing rosacea and use thereof

Country Status (1)

Country Link
KR (1) KR20220052474A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004093886A1 (en) 2003-04-24 2004-11-04 Galderma S.A. Topical formulation of ivermectin for the treatment of dermatological conditions

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004093886A1 (en) 2003-04-24 2004-11-04 Galderma S.A. Topical formulation of ivermectin for the treatment of dermatological conditions

Similar Documents

Publication Publication Date Title
EP2406402B1 (en) Method to assess human allograft status from microrna expression levels
WO2021000893A1 (en) Mirna receptivity analysis of the endometrium
KR20200002241A (en) Biomarker microRNA-26b or microRNA-4449 for diagnosing obesity and use thereof
KR102096498B1 (en) MicroRNA-4732-5p for diagnosing or predicting recurrence of colorectal cancer and use thereof
KR102492149B1 (en) MicroRNA-1246 for diagnosing of ovarian cancer and use thereof
CN108410977B (en) Ultra-early detection kit for serum miRNAs of alcoholic femoral head necrosis patient
KR102480430B1 (en) MicroRNA-31-5p for diagnosing rosacea and use thereof
KR101381894B1 (en) Serum miRNA as a marker for the diagnosis of lymph node metastasis of gastric cancer
KR20220052474A (en) MicroRNA-21-3p for diagnosing rosacea and use thereof
CN112226500B (en) Application of long-chain non-coding RNA as biomarker in diagnosis of acute renal injury caused by contrast agent
KR102096499B1 (en) MicroRNA-3960 for diagnosing or predicting recurrence of colorectal cancer and use thereof
CN102757965B (en) Serum micro RNA molecular marker and applications thereof
KR102601998B1 (en) Kit for diagnosing acute tumor response of cervical cancer
KR102548285B1 (en) Biomarker composition for diagnosing idiopathic nephrotic syndrome and use thereof
KR102555309B1 (en) Method of providing information for diagnosing early progression of cervical cancer
KR102553088B1 (en) Biomarker composition for diagnosing membranous glomerulonephritis and use thereof
US20210388448A1 (en) Method of determining prognosis in patients with follicular lymphoma
Abd El Razik et al. Experimental study for human skin identification using a specific gene marker at different storage durations
KR20160010270A (en) Composition for diagnosing Moyamoya disease using CpG methylation status in promoter region of SORT1 gene and uses thereof
KR20220124941A (en) Biomarker for diagnosing pre-diabetes or predicting development of diabetic complications and use thereof
KR101596357B1 (en) Composition for diagnosing Moyamoya disease using CpG methylation status in promoter region of SNAR-G2 gene and uses thereof
KR20200002237A (en) Biomarker let-7a or let-7f for diagnosing obesity and use thereof
CN112458165A (en) Alzheimer disease prediction marker, detection kit and application
CN110229878A (en) Diagnostic molecular marker for osteoarthritis
CN106554990A (en) Can be used for the blood miR-3135b detection kits of coronary artery calcification diagnosis

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E601 Decision to refuse application