KR20240032222A - Composition for preventing or treating muscle disease containing angelica gigas nakai extract and artemisia dracunculus l. extract - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating muscle disease containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients. Specifically, the mixed extract of Angelica gigas NAKAI and tarragon is used to prepare muscle protein. It not only reduces the expression of genes involved in degradation and increases the expression of proteins involved in protein synthesis, but also suppresses the decrease in muscle weight, muscle mass and strength in a muscular atrophy mouse model, and the expression of factors involved in muscle breakdown. Since it has the effect of reducing, the mixed extract of Angelica gigas and tarragon of the present invention can be used as an active ingredient in a composition for preventing or treating muscle diseases.

Description

Composition for preventing or treating muscle disease containing angelica root extract and tarragon extract {COMPOSITION FOR PREVENTING OR TREATING MUSCLE DISEASE CONTAINING ANGELICA GIGAS NAKAI EXTRACT AND ARTEMISIA DRACUNCULUS L. EXTRACT}

The present invention relates to a composition for preventing or treating muscle disease containing an extract of Angelica gigas NAKAI and an extract of tarragon ( Artemisia dracunculus L.), and a health food for preventing or improving muscle disease.

Muscle is responsible for approximately 40% of the human body, and securing an appropriate amount of muscle mass is essential to maintain the functional ability of the human body and prevent metabolic diseases. It is largely divided into smooth muscle, cardiac muscle, and skeletal muscle. Skeletal muscle occupies a significant portion of our entire body and promotes skeletal movement.

Muscle disease progresses as skeletal muscle weakness gradually impairs walking and movement functions, makes activities of daily living (ADL) difficult, and independent living becomes impossible. In addition, it causes cardiopulmonary dysfunction and other complications, so it is important to accurately understand the characteristics of each muscle disease and approach it accordingly.

Sarcopenia is when the motor nerve that induces skeletal muscle contraction degenerates, preventing skeletal muscle contraction from proceeding, or the expression of proteins involved in muscle contraction within skeletal muscle is reduced or altered, preventing normal skeletal muscle contraction from proceeding. It is known that in the long term, the motor nerves or skeletal muscles are transformed into fibrous tissue. It is also known to be caused by various causes such as aging, hormonal abnormalities, nutritional deficiencies, lack of physical activity, inflammation, and degenerative diseases.

It is known that exercise, protein, and calorie supplementation are helpful for sarcopenia, but they do not help much in the elderly, who make up the majority of sarcopenia patients, so sarcopenia treatments are urgently needed. However, the treatments currently used for sarcopenia that have a direct effect on improving muscle loss and increasing muscle mass are still at the clinical trial level, and there are currently no drugs that have been finally approved by the FDA.

Inflammatory muscle disease is known to cause inflammation in muscles and surrounding tissues, and the inflammation destroys muscle tissue, weakening the muscles, causing loss of strength and muscle pain. In the long term, it is known that muscle mass may decrease and muscle atrophy may occur. Because inflammation occurs in the muscles, it is called myositis and is broadly classified into polymyositis and dermatomyositis. It is an autoimmune disease caused by abnormalities in the body's immune system and is known to be caused by viruses or some drugs (penicillamine, alpha interferon, cimetidine, phenytoin, hepatitis B vaccine, etc.).

Steroids are mainly used as drugs to treat polymyositis or dermatomyositis, and 70 to 80% of patients show improvement. It is used as a high-concentration oral therapy or as an injection, and muscle strength can be significantly improved, but side effects (weight gain, osteoporosis, worsening diabetes, heartburn, indigestion, worsening stomach ulcers, etc.) occur, so to reduce them, other immunosuppressants (Imuran) are used. etc.) are used together. In addition, intravenous immunoglobulin may be used when various immunosuppressants are ineffective or cannot be used due to side effects. Meanwhile, it is known that newly developed immunosuppressants have some effect on polymyositis, but there is a constant demand for the development of treatments without side effects.

In addition, muscular atrophy is a disease in which the muscles of the extremities are atrophied. The expression of MuRF-1 and Atrogin-1 increases and breaks down the myosin heavy chain in the muscle, causing muscular atrophy in which the size of the muscle decreases. It is known to be done.

Although the development of treatments to treat muscular atrophy is in progress, no effective treatment for muscular atrophy has been developed to date, and the aging population, increase in chronic diseases, space development, and social pursuit of healthy life and quality of life Due to changes in perception, the demand for treatments for muscular atrophy is gradually increasing, and there is an urgent need to develop safe and effective treatments using natural materials that can help maintain muscles even in various situations that induce muscle atrophy.

Accordingly, the present inventors tried to develop a natural product that has the effect of preventing or treating muscle diseases, and as a result, the mixed extract of Angelica gigas NAKAI and tarragon ( Artemisia dracunculus L.) reduced the expression of genes involved in muscle protein breakdown. It was newly discovered that it can not only increase the expression of proteins involved in protein synthesis, but also suppress the decrease in muscle weight, muscle mass, and strength in a mouse model of muscular atrophy, and reduce the expression of factors involved in muscle breakdown. The present invention was completed by revealing that the mixed extract of Angelica gigas and tarragon can be used as an active ingredient in a composition for preventing or treating muscle diseases.

The present invention is to provide a pharmaceutical composition for preventing or treating muscle disease containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients, and a health food for preventing or improving muscle disease. .

The present invention provides a pharmaceutical composition for preventing or treating muscle disease containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients.

In addition, the present invention provides a health food for preventing or improving muscle disease containing angelica root extract and tarragon extract as active ingredients.

Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract according to the present invention not only reduce the expression of genes involved in muscle protein breakdown and increase the expression of proteins involved in protein synthesis, but also increase muscle strength. Since it has the effect of suppressing the decrease in muscle weight, muscle mass, and strength in atrophic mouse models and reducing the expression of factors involved in muscle breakdown, it can be useful in the treatment of various muscle diseases.

Figure 1 is a diagram showing the results of measuring Atrogin-1 gene expression level after treating C2C12 cells with angelica root and/or tarragon extract.
Figure 2 is a diagram showing the results of measuring MuRF-1 gene expression level after treating C2C12 cells with angelica root and/or tarragon extract.
Figure 3 is a diagram showing the results of measuring mTOR protein expression after treating C2C12 cells with Angelica gigas root and/or tarragon extract.
Figure 4 is a diagram showing the results of measuring muscle weight after treating a muscle atrophy-induced mouse model with a mixed extract of angelica root and tarragon.
Figure 5 is a diagram showing the results of measuring lean body mass after treating a muscle atrophy-induced mouse model with a mixed extract of angelica root and tarragon.
Figure 6 is a diagram showing the results of measuring muscle strength after treating a muscle atrophy-induced mouse model with a mixed extract of angelica root and tarragon.
Figure 7 is a diagram showing the results of measuring the expression levels of FoxO3a, Fbx32, and MuRF-1 after treating a muscle atrophy-induced mouse model with a mixed extract of Angelica gigas and tarragon.

Hereinafter, the present invention will be described in more detail.

The present invention provides a pharmaceutical composition for preventing or treating muscle disease, containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients.

Each of the active ingredients of the present invention, Angelica root extract and tarragon extract, is preferably prepared by a method comprising the following steps, but is not limited thereto:

1) Extracting by adding an extraction solvent to each of Angelica gigas and tarragon;

2) filtering the extract of step 1);

3) distilling the filtrate of step 2) under reduced pressure; and

4) Drying the reactant of step 3).

In the production method of the present invention, angelica gigas or tarragon in step 1) can be used without limitation, whether cultivated or commercially available. In addition, the Angelica gigas or tarragon may be used in combination with flowers, branches, stems, leaves, fruits, aerial parts, rhizomes, roots, or a combination thereof, but is not limited thereto.

In the production method of the present invention, it is preferable to use water, an organic solvent, or a mixture thereof as the extraction solvent in step 1). The organic solvent preferably includes methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane and cyclohexane, but is not limited thereto. Extraction methods include reflux cooling extraction, steam distillation extraction, hot water extraction, organic solvent extraction, Soxhelt extraction, shaking extraction, saponification extraction, supercritical fluid extraction, mechanical compression extraction, microwave application extraction, enzyme extraction, room temperature stirring extraction, and ultrasonic waves. It can be extracted using an extraction method, a high-temperature pressure extraction method, or a low-temperature high-pressure extraction method. Specifically, extraction using a reflux cooling extraction method is preferred, but is not limited to this. It is preferable to extract by adding 1 to 30 times the extraction solvent to dried angelica root or tarragon, more preferably to extract by adding 10 to 20 times, and even more preferably by adding 13 to 17 times. In addition, the extraction time of the above extraction is preferably 1 to 20 hours, more preferably 3 to 15 hours, and even more preferably 5 to 10 hours, but is not limited thereto.

In the production method of the present invention, the vacuum distillation in step 3) is preferably performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto.

In the production method of the present invention, the drying in step 4) is preferably performed by reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

In the production method of the present invention, the Angelica gigas extract and the tarragon extract can be mixed after preparing the respective extracts, but it is also possible to prepare them by mixing Angelica gigas and tarragon to obtain the extract.

The above muscle diseases include Sarcopenia, Muscular atrophy, Myasthenia, Muscular dystrophy, Myotonia, Hypotonia, Muscular weakness, and Muscular dystrophy. It is one or more diseases selected from the group consisting of Muscular dystrophy, Amyotrophic lateral sclerosis, and Inflammatory myopathy.

In a specific example of the present invention, the present inventors prepared Angelica gigas root extract and tarragon extract, and mixed the extracts at various mixing ratios to prepare a mixed extract of Angelica gigas root and tarragon.

In one aspect of the present invention, the weight ratio of the angelica root extract and the tarragon extract of the mixed extract of Angelica gigas and tarragon may be 5:5 to 9:1, and the weight ratio is preferably 6:4 to 8:2, and the weight ratio is It is more preferable that the ratio is 6.5:5.5 to 7.5:2.5, and the weight ratio is most preferably 7:3.

In the present invention, the mixed extract of Angelica gigas and tarragon corresponds to the above weight ratio, and compared to the case of using the extract alone or using the mixed extract mixed at a different weight ratio, it inhibits muscle loss, increases muscle, increases muscle mass, and increases strength. It shows a significant difference in aspects such as the most significant effect when the weight ratio of angelica root extract and tarragon extract is 7:3.

In addition, in order to confirm the effectiveness of the mixed extract of Angelica gigasia and tarragon in preventing or treating muscle diseases, the present inventors treated C2C12 cells with the extract and confirmed the effect of reducing the expression of genes involved in muscle protein degradation. It was confirmed that the mixed extract of angelica root and tarragon is effective in preventing or treating muscle disease by reducing Atrogin-1 and MuRF-1 gene expression (see Figure 1).

In addition, in order to confirm the effectiveness of the mixed extract of Angelica gigasia and tarragon in preventing or treating muscle diseases, the present inventors treated C2C12 cells with the extract and confirmed the effect of increasing the expression of proteins involved in muscle protein synthesis. It was confirmed that the mixed extract of angelica root and tarragon is effective in preventing or treating muscle disease by increasing mTOR protein expression (see Figure 2).

In addition, in order to confirm the effectiveness of the mixed extract of Angelica gigasia and tarragon in preventing or treating muscle diseases, the present inventors measured muscle weight, muscle mass, and strength after orally administering the extract to a muscle atrophy-inducing mouse model, and measured muscle decomposition. As a result of confirming the effect of reducing the expression of factors, the mixed extract of Angelica gigas and tarragon of the present invention inhibits the decrease in muscle weight, muscle mass, and strength in a muscle atrophy-induced mouse model, and reduces the expression of FoxO3a, Fbx32, and MuRF-1, thereby reducing muscle disease. It was confirmed that it was effective in prevention or treatment (see FIGS. 3 to 7).

In one aspect of the present invention, the composition inhibits the expression of one or more selected from the group consisting of Atrogin-1, MuRF-1, Fox03a, and Fbx32.

Additionally, in one aspect of the present invention, the composition increases the expression of mTOR.

Additionally, in one aspect of the present invention, the composition inhibits muscle weight loss.

Additionally, in one aspect of the present invention, the composition inhibits muscle mass loss.

Additionally, in one aspect of the present invention, the composition inhibits muscle strength decline.

Therefore, the present inventors found that the mixed extract of Angelica gigas and tarragon of the present invention not only reduces the expression of genes involved in muscle protein degradation and increases the expression of proteins involved in protein synthesis, but also increases muscle weight, Since it has been confirmed that it is effective in suppressing the decrease in muscle mass and strength and reducing the expression of factors involved in muscle breakdown, the mixed extract of the present invention can be used as an active ingredient in a composition for preventing or treating muscle diseases.

The composition containing Angelica root extract and tarragon extract of the present invention as active ingredients may contain one or more active ingredients that exhibit the same or similar functions in addition to the above ingredients.

The composition of the present invention may further include pharmaceutically acceptable additives, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, and lactose. , mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate. , white sugar, dextrose, sorbitol, and talc can be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

That is, the composition of the present invention can be administered in various oral and parenteral formulations during actual clinical administration. When formulated, diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. It can be prepared using. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain angelica root extract and tarragon extract and at least one or more excipients, such as starch, calcium carbonate, It can be prepared by mixing sucrose, lactose, or gelatin. Additionally, in addition to simple excipients, lubricants such as magnesium styrate talc may also be used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The composition of the present invention can be administered orally or parenterally according to the desired method. When administered parenterally, it is administered externally to the skin or intraperitoneally, intrarectally, subcutaneously, intravenously, intramuscularly, or intrathoracically. It is desirable to select . The dosage range varies depending on the patient's weight, age, gender, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.

In one aspect of the invention, the composition is administered orally.

The composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, “pharmaceutically effective amount” means an amount sufficient to treat the disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, and activity of the patient's disease. , can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the field of medicine. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

Specifically, the effective amount of the composition according to the present invention may vary depending on the patient's age, gender, and weight, and is generally administered at 0.1 to 100 mg, preferably 0.5 to 10 mg, per kg of body weight every day or every other day, or 1 It can be administered in divided doses 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, severity of obesity, gender, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

In addition, the present invention provides a health food for preventing or improving muscle disease containing the angelica root extract and tarragon extract of the present invention as active ingredients.

The Angelica root extract and tarragon extract have activity in preventing or improving muscle disease.

Since the angelica root extract and tarragon extract of the present invention exhibit significant effects in preventing or treating muscle diseases, the angelica root extract and tarragon extract can be usefully used as health food compositions for preventing or improving muscle diseases.

There are no special restrictions on the types of foods above. Examples of foods to which the above substances can be added include various foods such as confectionery, bread, and noodles, drinks such as water, soft drinks, and fruit drinks, gum, tea, vitamin complexes, seasonings, and health functional foods. Includes all health functional foods in the conventional sense.

The angelica root extract and tarragon extract of the present invention can be added as is to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use (prevention or improvement). In general, the amount of the above compound in health foods can be 0.01 to 15% by weight, preferably 0.1 to 5% by weight, of the total weight of the food, and in health drink compositions, the amount is 0.01 to 5.0 g, preferably 0.01 to 5.0 g, based on 100. It can be added at a rate of 1.0 g. However, in the case of long-term intake for the purpose of health control, the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

The health functional beverage composition of the present invention has no particular restrictions on other ingredients other than containing the above-mentioned compounds as essential ingredients in the indicated proportions, and may contain various flavoring agents or natural carbohydrates as additional ingredients like ordinary drinks. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Common sugars such as disaccharides, such as maltose, sucrose, etc., and polysaccharides, such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (thaumaquine, stevia extract, etc.) and synthetic flavoring agents (saccharin, aspartane, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 0.1 to 2.0 g, preferably about 0.1 to 1.0 g per 100 of the composition of the present invention.

The health functional food of the present invention can be easily obtained by adding the extract of the present invention described above during the food manufacturing process or by adding the extract of the present invention described above after manufacturing the food. At this time, taste and odor correctors may be added as needed.

In addition to the above, the angelica root extract and tarragon extract of the present invention contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), pectic acid, and the like. It may contain salts, alginic acid and its salts, organic acids, protective colloidal thickening agents, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the angelica root extract and tarragon extract of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages. These ingredients can be used independently or in combination. The ratio of these additives is not that critical, but is generally selected in the range of about 20 parts by weight per 100 parts by weight of Angelica root extract and tarragon extract of the present invention.

Hereinafter, the present invention will be described in detail through examples and experimental examples.

However, the following examples and experimental examples specifically illustrate the present invention, and the content of the present invention is not limited to the examples and experimental examples.

<Example 1> Preparation of Angelica gigas extract

10 g of dried Angelica gigas NAKAI was extracted under reflux cooling for 6 hours using 160 ml of distilled water, filtered through 2.5 ㎛ quantitative filter paper (Whatman No. 42, UK) to remove insoluble substances, and then distilled under reduced pressure ( Vacuum distillation) and drying to obtain tarragon extract.

<Example 2> Preparation of tarragon extract

10 g of dried tarragon ( Artemisia dracunculus L.) was extracted under reflux for 6 hours using 160 ml of distilled water, filtered through 2.5 ㎛ quantitative filter paper (Whatman No. 42, UK) to remove insoluble substances, and then distilled under reduced pressure. Tarragon extract was obtained by drying.

<Example 3> Preparation of angelica root and tarragon mixed extract

A mixed extract of Angelica gigas and tarragon was prepared by mixing the Angelica gigas extract prepared in <Example 1> and the tarragon extract prepared in <Example 2> in a composition of 9:1 or 7:3.

<Experimental Example 1> Confirmation of the effect of reducing the expression of genes involved in muscle protein degradation of angelica root and tarragon mixed extract in mouse muscle cells

The effect of reducing the expression of genes involved in muscle protein degradation of the angelica root extract prepared in <Example 1>, the tarragon extract prepared in <Example 2>, and the angelica root and tarragon mixed extract prepared in <Example 3> To confirm, Atrogin-1 and MuRF-1 (Muscle RING-finger protein-1, MuRF-1), which are major ligases involved in protein degradation in muscle, were used in mouse muscle cells. 1) The mRNA expression level was confirmed.

Specifically, C2C12 mouse muscle cells (ATCC, USA) were grown in Dulbecco's modified eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Hyclone, USA) (Hyclone, USA). ) were dispensed into a 6-well plate at 1×10 ⁵ cells/well and cultured for 24 hours. Next, it was replaced with DMEM supplemented with 2% horse serum, and the medium was changed every two days for 6 days to differentiate into myotube cells. After 6 days, the extracts prepared in <Example 1> to <Example 3> were added to DMEM containing 50 μg/ml of tumor necrosis factor alpha (TNF-α) (PeproTech, USA). 50 ㎍/㎖ each was mixed, treated with cells, and reacted for 12 hours. Afterwards, total RNA was isolated using Trizol reagent (Takara, Japan), and then using a nano spectrometer Nanodrop 1000 (ND-1000) (Thermo Fisher Scientific Inc., USA). and quantified. 16 μl of the quantified RNA was mixed with 4 μl of reverse transcriptase premix (ELPIS-Biotech, Korea) and a T100 thermal cycler (Bio), a polymerase chain reaction (PCR) device. -rad, USA) was used to synthesize cDNA under the conditions of 42°C for 60 minutes and 94°C for 5 minutes.

To amplify the cDNA for which synthesis was performed, quantitative real-time PCR (Real-time PCR or quantitative PCR) was performed. 1 ㎕ of the synthesized cDNA, specific primer (Bioneer, Korea), and quantitative real-time PCR 2X premix (qPCR 2X) were used to amplify the synthesized cDNA. premix) (ELPIS-Biotech, Korea) at 95°C for 10 minutes, 95°C for 10 seconds, 60°C for 30 seconds, and 72°C for 20 seconds repeated 40 times, then reacted at 72°C for 5 minutes to perform qPCR. carried out. It was shown that the loading amount of mRNA was consistent with beta-actin. The sequences of specific primers used are shown in Table 1.

Primer Forward(F)/
Reverse(R) Sequences(5'→3') sequence number Atrogin-1 F TGGAAGGACTACCACCTTGC One R CACTGAGCCTGTCGTCACTT 2 MuRF-1 F GTGCCAGACCATTGAGGACA 3 R ATTGCCCCGACCTTGTTGAT 4 β-Actin F GAACGAGATTACTGCTCTGGCT 5 R CTCAGTAACAGTCCGCCTAGAA 6

As a result, as shown in Figure 1, the expression of Atrogin-1 increased compared to the control group in the group treated only with TNF-α, while the expression of Atrogin-1 increased in the group treated with the mixed extract of Angelica gigas and tarragon of the present invention. It was confirmed that was significantly reduced.

In particular, it was confirmed that the group treated with the mixed extract of Angelica gigas and tarragon of the present invention had a superior effect in reducing Atrogin-1 expression compared to the group treated with the extract of Angelica gigas or tarragon alone (Figure 1).

In addition, as shown in Figure 2, in the group treated only with TNF-α, MuRF-1 expression increased compared to the control group, while in the group treated with the mixed extract of Angelica gigas and tarragon of the present invention, the expression of MuRF-1 was decreased. It was confirmed that there was a significant decrease.

In particular, it was confirmed that the group treated with the mixed extract of Angelica gigas and tarragon of the present invention had a superior effect in reducing MuRF-1 expression compared to the group treated with the extract of Angelica gigas or tarragon alone (FIG. 2).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention inhibits muscle protein degradation by reducing the expression of Atrogin-1 and MuRF-1, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

<Experimental Example 2> Confirmation of the effect of increased expression of proteins involved in muscle protein synthesis of Angelica root and tarragon mixed extract in mouse muscle cells

The effect of increasing the expression of proteins involved in muscle protein synthesis of the angelica root extract prepared in <Example 1>, the tarragon extract prepared in <Example 2>, and the angelica root and tarragon mixed extract prepared in <Example 3> To confirm, the activity of mTOR, a protein involved in muscle protein synthesis and muscle mass increase in the PI3K/Akt signaling pathway within muscle cells, was tested using the mTOR sandwich ELISA (Enzyme-linked immunosorbent assay, ELISA) kit ( This was confirmed using the mTOR Sandwich ELISA kit (Cell signaling technology, USA).

Specifically, C2C12 mouse muscle cells were distributed at 1 × 10 ⁵ cells/well in a 6-well plate with DMEM supplemented with 10% FBS and cultured for 24 hours. Next, the cells were replaced with DMEM supplemented with 2% horse serum, and the medium was changed every two days for 6 days to differentiate into myotube cells. After 6 days, 50 μg/ml of each of the extracts prepared in <Example 1> to <Example 3> were mixed in DMEM, treated with cells, and reacted for 12 hours. Afterwards, cells were lysed using cell lysis buffer, and proteins in the cell lysate were quantified using a Bicinchoninic acid (BCA) protein analysis kit (Dyne Bio, Korea). Next, 100 ㎕ of cell lysate was dispensed into microwells with anti-mTOR antibody attached and incubated at 37°C for 2 hours. After washing four times with washing buffer, detection antibody was added. ) was treated and incubated at 37°C for 1 hour. After incubation, the cells were washed again four times with washing buffer, secondary antibodies were added, and cultured at 37°C for 30 minutes. Finally, cells were washed four times with washing buffer, and TMB substrate was added to each well. 37 After incubation at ℃ for 10 minutes, stop solution was added to stop the reaction of TMB. After 2 minutes, the absorbance was measured at a wavelength of 450 nm to measure the level of mTOR in myotube cells.

As a result, as shown in Figure 3, it was confirmed that mTOR expression increased in the group treated with the mixed extract of Angelica gigas and tarragon of the present invention compared to the control group not treated with the extract.

In particular, it was confirmed that the group treated with the mixed extract of Angelica gigas and tarragon of the present invention had a superior effect on increasing mTOR expression compared to the group treated with the extract of Angelica gigas or tarragon alone (FIG. 3).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention promotes muscle protein synthesis by increasing mTOR expression, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

<Experimental Example 3> Confirmation of the effect of suppressing muscle loss of angelica root and tarragon mixed extract in a muscular atrophy mouse model

<3-1> Creating a muscle atrophy mouse model and administering Angelica gigas and tarragon mixed extract

Experimental animals, 6-week-old C57BL/6J male mice, were supplied and used in the experiment after undergoing a circulatory system for one week to adapt to the animal breeding room environment until the day of the experiment.

To create a muscle atrophy mouse model, first, a control group (Control, CON) in which the experimental animals were not treated with anything, and an induction group (DEX) in which distilled water was orally administered while inducing muscle atrophy, see <Example 3> above. Samples mixed with angelica root and tarragon extract at a composition of 7:3 were divided into four groups, including an experimental group (DEX＋CHDT350, DEX＋CHDT500), which was administered orally at a concentration of 350 or 500 mg/kg, respectively, and then administered at the same time every day for 30 days. The same amount of distilled water or a mixed extract of Angelica gigas and tarragon was administered orally, and starting 14 days after oral administration, the same amount of Dexamethasone was injected intraperitoneally into the control and experimental groups at the same time every day.

<3-2> Confirmation of the effect of Angelica root and tarragon mixed extract on increasing muscle weight

In <Experimental Example 3-1>, after the oral administration and intraperitoneal injection period was completed, the circulatory system was performed for one week, and then dissection was performed to remove the quadriceps femoris muscle (QUA) of the thigh and the gastrocnemius (GAS) muscle of the calf. was separated and its weight was measured.

As a result, as shown in Figure 4, in the induced group treated only with dexamethasone, the weight of the thigh muscles and calf muscles decreased compared to the control group, while in the experimental group treated with the mixed extract of Angelica gigas and tarragon of the present invention, the weight decreased in a concentration-dependent manner. It was confirmed that the weight of the thigh muscles and calf muscles increased (Figure 4).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention increases muscle weight decreased due to muscle atrophy, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

<3-3> Confirmation of muscle mass increase effect of angelica root and tarragon mixed extract

In <Experimental Example 3-1>, the lean mass (%) of the hind limbs of the experimental animals was measured using dual energy X-ray absorptiometry (DEXA) before and after the start of the experiment.

As a result, as shown in Figure 5, in the induced group treated only with dexamethasone, lean body mass decreased compared to the control group before and after the start of the experiment, while in the experimental group treated with the mixed extract of Angelica gigas and tarragon of the present invention, the concentration-dependent decrease was observed. It was confirmed that lean mass increased (Figure 5).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention increases lean body mass reduced due to muscle atrophy, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

<3-4> Strength improvement effect of angelica root and tarragon mixed extract

During the experiment in <Experimental Example 3-1>, the maximum grip strength value when the forelimb muscles of the experimental animal pulled the bar was measured using a grip strength meter (Shimpo instruments, Mexico).

As a result, as shown in Figure 6, in the induced group treated only with dexamethasone, muscle strength decreased compared to the control group, while in the experimental group treated with the mixed extract of angelica root and tarragon of the present invention, muscle strength increased in a concentration-dependent manner. (Figure 6).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention increases muscle strength decreased due to muscle atrophy, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

<3-5> Effect of Angelica gigasia and tarragon mixed extract on reducing expression of factors related to muscle breakdown

Expression levels of FoxO3a, Fbx32, and MuRF-1, factors related to muscle breakdown, using the quadriceps femoris muscle (QUA) of the thigh and the gastrocnemius (GAS) muscle of the calf isolated in <Experimental Example 3-2>. Western blot was performed to measure .

Specifically, the isolated muscle was lysed using a lysis buffer, and the protein in the lysate was quantified using a BCA protein analysis kit. Next, the proteins were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and the separated proteins were transferred to a nitrocellulose membrane, and the proteins were Each primary and secondary antibody was treated and reacted on the transferred membrane. Afterwards, changes in the expression of specific proteins were analyzed using an electrogenerated chemiluminescence (ECL) solution. Expression of FoxO3a was measured by the p-FoxO3a/FoxO3a ratio.

As a result, as shown in Figure 7, in the induced group treated only with dexamethasone, the expression of FoxO3a, Fbx32, and MuRF-1 increased compared to the control group, while in the experimental group treated with the mixed extract of Angelica gigas and tarragon of the present invention, the concentration decreased. It was confirmed that the expression of FoxO3a, Fbx32, and MuRF-1 was significantly reduced in a dependent manner (Figure 7).

Therefore, it was confirmed that the mixed extract of Angelica gigas and tarragon of the present invention reduces the expression of genes increased due to muscle atrophy, and therefore, the mixed extract of Angelica gigas and tarragon can be used to prevent or treat muscle diseases.

Claims (11)

A composition for preventing or treating muscle disease, containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients.
The composition for preventing or treating muscle disease according to claim 1, wherein the extract is extracted with water, an organic solvent, or a mixture thereof.
The method of claim 2, wherein the organic solvent is at least one selected from the group consisting of methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane, and cyclohexane. , Composition for preventing or treating muscle diseases.
The method of claim 1, wherein the muscle disease includes sarcopenia, muscular atrophy, myasthenia, muscular dystrophy, myotonia, hypotonia, and muscular weakness. ), for preventing or treating muscle diseases, characterized in that at least one selected from the group consisting of Muscular dystrophy, Cachexia, Amyotrophic lateral sclerosis, and Inflammatory myopathy Composition.
The composition for preventing or treating muscle disease according to claim 1, wherein the composition inhibits the expression of one or more selected from the group consisting of Atrogin-1, MuRF-1, Fox03a, and Fbx32.
The composition for preventing or treating muscle disease according to claim 1, wherein the composition increases the expression of mTOR.
The composition for preventing or treating muscle diseases according to claim 1, wherein the composition inhibits muscle weight loss.
The composition for preventing or treating muscle disease according to claim 1, wherein the composition inhibits a decrease in muscle mass.
The composition for preventing or treating muscle disease according to claim 1, wherein the composition inhibits muscle strength reduction.
A health food for preventing or improving muscle disease containing Angelica gigas NAKAI extract and tarragon ( Artemisia dracunculus L.) extract as active ingredients.
The method of claim 10, wherein the muscle disease includes sarcopenia, muscular atrophy, myasthenia, muscular dystrophy, myotonia, hypotonia, and muscular weakness. ), Muscular dystrophy, amyotrophic lateral sclerosis, and inflammatory myopathy. A health food for preventing or improving muscle disease, characterized in that it is at least one selected from the group consisting of.