KR20220126092A - Composition for preventing, ameliorating or treating andropause syndrome comprising Acorus gramineus Solander extract as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for the prevention, alleviation or treatment of andropause syndrome containing an extract of Acorus gramineus as an active ingredient. Specifically, an Acorus gramineus ethanol aqueous solution extract has little toxicity in cells and animals, exhibits an effect of increasing testosterone synthesis and inhibiting degradation, helps to increase muscle mass in andropause animal models, and exhibits effects on reducing LDL-cholesterol, improving physical ability, and anti-fatigue effects, so that the extract of Acorus gramineus of the present invention can be used as a material for a health functional food or a treatment material for preventing and alleviate andropause syndrome.

Description

Composition for preventing, ameliorating or treating andropause syndrome comprising Acorus gramineus Solander extract as an active ingredient}

The present invention relates to a composition for preventing, improving or treating androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

Andropause syndrome or late-onset hypogonadism (LOH) is characterized by low testosterone levels and is characterized by decreased sexual function, decreased muscle mass and bone density, decreased physical abilities such as strength and endurance, fatigue and depression, etc. accompanied by clinical symptoms of In men, after age 40, testosterone decreases by 0.4-2.6% per year. Diagnosis of androgenic syndrome is based on a serum total testosterone level of less than about 300 ng/dL, affecting about 10% of middle-aged men. Testosterone production in the body is 95% through testosterone synthesizing enzymes such as CYP17A1 (17,20-desmolase), 3β-HSD (3β-hydroxysteroid dehydrogenase), and 17β-HSD (17β-hydroxysteroid dehydrogenase) in Leydig cells of the testis. It is activated by stimulation of gonadotropin releasing hormone (GnRH) in the hypothalamus and luteinizing hormone (LH) in the anterior pituitary. Testicular function naturally decreases with age, and a decrease in Leydig cell retention in middle-aged and elderly people leads to an increase in LH concentrations to maintain testosterone concentrations. However, reduced testicular function results in significantly lower testosterone levels.

A common method for the treatment of male menopause is testosterone replacement therapy, which involves direct injection of testosterone, but periodic monitoring is necessary because it can increase the risk of prostate diseases such as benign prostatic hyperplasia or prostate carcinoma and the risk of cardiovascular disease. For this reason, effective natural plant materials are being studied to improve testosterone recovery in middle-aged men and the clinical symptoms that follow.

Acorus gramineus Solander ( Acorus gramineus Solander) is found in East Asia, including Korea, China, and Japan. β-asarone, α-asarone, and phenylpropenes are known as the main active ingredients of seokchangpo, and research on bioactive lignans is ongoing. Although the study on the anti-dementia effect, anti-stress effect, anti-tumor and anti-inflammatory effect of seokchangpo extract through memory enhancement has been reported, studies related to andropause and testosterone are insufficient.

Accordingly, the present inventors have made efforts to develop a natural material that has no side effects, has high safety, and is effective for testosterone recovery and symptom improvement in middle -aged men. It is confirmed that it has an effect of increasing testosterone synthesis and inhibiting degradation, as well as helping to increase muscle mass in an in vivo model of male menopause, reducing LDL-cholesterol, improving physical ability, and exhibiting anti-fatigue effects did. Accordingly, by revealing that the seokchangpo extract can be usefully used for the prevention, improvement or treatment of androgenic syndrome, the application of the present invention has been reached.

Republic of Korea Patent No. 10-1841387

Horstman, A. M., Dillon, E. L., Urban, R. J., & Sheffield-Moore, M. (2012). The role of androgens and estrogens on healthy aging and longevity. The journals of gerontology. Series A, Biological sciences and medical sciences, 67(11), 1140-1152. Kim, J. H., Hahm, D. H., Lee, H. J., Pyun, K. H., & Shim, I. (2009). Acori graminei rhizoma ameliorated ibotenic acid-induced amnesia in rats. Evidence-based complementary and alternative medicine: eCAM, 6(4), 457-464. Kim, K. H., Moon, E., Kim, H. K., Oh, J. Y., Kim, S. Y., Choi, S. U., & Lee, K. R. (2012). Phenolic constituents from the rhizomes of Acorus gramineus and their biological evaluation on antitumor and anti-inflammatory activities. Bioorganic & medicinal chemistry letters, 22(19), 6155-6159. Koo, B. S., Park, K. S., Ha, J. H., Park, J. H., Lim, J. C., & Lee, D. U. (2003). Inhibitory effects of the fragrance inhalation of essential oil from Acorus gramineus on central nervous system. Biological & pharmaceutical bulletin, 26(7), 978-982. Lee, Y. H., Kim, D., Lee, M. J., Kim, M. J., Jang, H. S., Park, S. H., Lee, J. M., Lee, H. Y., Park, C. B., Han, B. S., Son, W. C., Kang, J. S., & Kang, J. K. (2016). Subchronic toxicity of Acorus gramineus rhizoma in rats. Journal of ethnopharmacology, 183, 46-53. Liao, J. F., Huang, S. Y., Jan, Y. M., Yu, L. L., & Chen, C. F. (1998). Central inhibitory effects of water extract of Acori graminei rhizoma in mice. Journal of ethnopharmacology, 61(3), 185-193. Singh P. (2013). Andropause: Current concepts. Indian journal of endocrinology and metabolism, 17 (Suppl 3), S621-S629. Swee, D. S., & Gan, E. H. (2019). Late-Onset Hypogonadism as Primary Testicular Failure. Frontiers in endocrinology, 10, 372. Tharakan, T., Miah, S., Jayasena, C., & Minhas, S. (2019). Investigating the basis of sexual dysfunction during late-onset hypogonadism. F1000 Research, 8, F1000 Faculty Rev-331.

It is an object of the present invention to provide a composition for preventing, improving or treating androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

In addition, the present invention provides a health functional food composition for preventing or improving androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

The extract of Acorus gramineus Solander according to the present invention has almost no toxicity to cells and animals, increases testosterone synthesis and inhibits degradation, as well as helps to increase muscle mass in male menopause animal models, LDL- It was confirmed that cholesterol reduction, physical ability improvement and anti-fatigue effect were shown. Accordingly, the seokchangpo extract according to the present invention can be usefully used as an active ingredient in a composition for preventing, improving or treating androgenic syndrome.

1 is a diagram schematically illustrating a method for preparing an ethanol aqueous solution extract of Acorus gramineus Solander according to an embodiment of the present invention.
2 is a diagram confirming the level of testosterone in TM3 cells to which human chorionic gonadotropin (hCG) and H ₂ O ₂ have been added in an in vitro model of androgenic menopausal in accordance with an embodiment of the present invention.
3 is a diagram confirming the mRNA expression of testosterone synthesis-related factors in TM3 cells to which hCG and H ₂ O ₂ have been added in an in vitro model of andropause according to an embodiment of the present invention.
FIG. 4 is a diagram confirming the mRNA expression of testosterone degradation-related factors in TM3 cells to which hCG and H ₂ O ₂ were added in an in vitro model of male menopause according to an embodiment of the present invention.
Figure 5 is an in vitro model of male menopause according to an embodiment of the present invention in TM3 cells to which hCG and H ₂ O ₂ are added, an ethanol aqueous solution extract of seokchangpo of the present invention and three kinds of material extracts, vitamin tree ( Hippophae rhamnoides ), mistletoe ( Viscum album ) and Safflower ( Carthamus tinctorius ) It is a diagram confirming the change in testosterone level by treatment of each ethanol extract.
Figure 6 is an in vitro model of male menopause according to an embodiment of the present invention in TM3 cells to which hCG and H ₂ O ₂ are added, an ethanol aqueous solution extract of seokchangpo of the present invention, three kinds of material extracts, vitamin tree, mistletoe and safflower ethanol extract It is a diagram confirming the change in mRNA expression of testosterone synthesis-related factors by each treatment.
7 is an ethanol solution extract of seokchangpo of the present invention and three kinds of material extracts, vitamin tree, mistletoe and safflower ethanol extract in TM3 cells to which hCG and H ₂ O ₂ were added as an in vitro model of male menopause according to an embodiment of the present invention; It is a diagram confirming the change in mRNA expression of testosterone degradation-related factors by each treatment.
8 is a view confirming the change in cell viability by treatment with the ethanol aqueous solution of Seokchangpo of the present invention in TM3 cells and TM3 cells to which hCG and H ₂ O ₂ were added as an in vitro model of male menopause according to an embodiment of the present invention.
9 is an in vitro model of male menopause according to an embodiment of the present invention, in TM3 cells to which hCG and H ₂ O ₂ were added, the testosterone level change by treatment of each concentration of the Seokchangpo ethanol aqueous solution extract and the Seokchangpo hot water extract It is confirmed
10 is an in vitro model of male menopause according to an embodiment of the present invention, in TM3 cells to which hCG and H ₂ O ₂ were added, mRNA expression changes of testosterone synthesis-related factors by treatment of each concentration of the ethanol aqueous solution extract of Seokchangpo of the present invention. It is confirmed
11 is an in vitro model of male menopause according to an embodiment of the present invention, in TM3 cells to which hCG and H ₂ O ₂ were added, mRNA expression changes of testosterone degradation-related factors by treatment of each concentration of the ethanol aqueous solution extract of Seokchangpo of the present invention. It is confirmed
12 is a diagram schematically illustrating the preparation of an in vivo model of male menopause according to an embodiment of the present invention and a method of administering an ethanol aqueous solution extract of Seokchangpo of the present invention.
13 is a diagram confirming the change in serum testosterone level before and after administration of the ethanol aqueous solution of Seokchangpo of the present invention in an in vivo model of male menopause according to an embodiment of the present invention.
14 is a view confirming the change in mRNA expression of testosterone synthesis-related factors in the testis by administration of the ethanol solution of Seokchangpo of the present invention in an in vivo model of male menopause according to an embodiment of the present invention.
15 is a view confirming the mRNA expression change of testosterone degradation-related factors in the testis by the administration of the ethanol solution of Seokchangpo of the present invention in the male menopause in vivo model according to an embodiment of the present invention.
16 is a view confirming the change in physical ability by administration of the ethanol solution of Seokchangpo of the present invention in the male menopause in vivo model according to an embodiment of the present invention.
17 is a diagram confirming changes in the level of fatigue-related factors in blood and serum by administration of the ethanol solution of Seokchangpo of the present invention in an in vivo model of male menopause according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail.

In the present invention, the term "prevention" refers to inhibiting the occurrence of a disease or disease in an individual who has never been diagnosed with a disease or disease, but is prone to such disease or disease. As used herein, the term “treatment” refers to (i) inhibiting the development of a disease or disorder; (ii) alleviation of the disease or condition; and (iii) disease or disease elimination.

The present invention provides a pharmaceutical composition for preventing or treating androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

The active ingredient of the present invention, seokchangpo extract, is preferably prepared by a method comprising the following steps, but is not limited thereto:

1) extracting by adding an extraction solvent to Seokchangpo; and

2) filtering the extract of step 1).

In the manufacturing method of the present invention, the cultivated or commercially available seokchangpo in step 1) may be used without limitation. In addition, the rhizomes, flowers, leaves, fruits and/or seeds of Seok-Changpo extract may be used, but the present invention is not limited thereto.

In the preparation method of the present invention, the extraction solvent in step 1) may be water, alcohol, or a mixture thereof. As the alcohol, a lower alcohol of C ₁ to C ₄ may be used, and as the lower alcohol, ethanol or methanol may be used. Specifically, the extraction solvent may be a mixture of water and ethanol, that is, an aqueous ethanol solution, and more specifically, a 20 to 40% aqueous ethanol solution may be used. The extraction method may be ultrasonic extraction, shaking extraction, Soxhelt extraction, or reflux extraction, but is not limited thereto. After washing the extraction solvent, it can be extracted by adding 1 to 15 times the amount of well-dried stone chives, specifically, it can be extracted by adding 2 to 10 times, and more specifically, it can be extracted by adding 3 to 6 times. The extraction temperature may be 20 to 130 ℃, but is not limited thereto. In addition, the extraction time may be 10 minutes to 72 hours, may be 1 hour to 48 hours, may be 12 hours to 30 hours, but is not limited thereto. In addition, the number of extractions may be 1 to 5 times, but is not limited thereto.

In the manufacturing method of the present invention, after the step 2), the following steps may be additionally included:

3) concentrating the filtrate of step 2) under reduced pressure; and

4) drying the concentrate of step 3).

In the manufacturing method of the present invention, the vacuum concentration in step 3) may use a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, the drying may be reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, but is not limited thereto.

In the present invention, the male menopause syndrome is decreased sperm count and activity accompanied by testosterone decrease, increased visceral fat, decreased muscle mass, decreased muscle strength and endurance, decreased bone density, increased arteriosclerosis and increased carotid artery thickness, increased insulin resistance, intellectual activity , a decrease in cognitive ability and spatial orientation, mood changes that pollinate fatigue, depression, irritability, or sleep disturbance, but is not limited thereto.

In the present invention, the seokchangpo extract has the following properties, and can prevent or treat androgenic syndrome through the following properties:

1) increased testosterone;

2) increased testosterone synthesis-related factors;

3) decrease testosterone degradation related factors;

4) help increase muscle mass;

5) LDL-cholesterol reduction; and

6) Improving physical ability and anti-fatigue.

Specifically, the seokchangpo extract can increase testosterone by promoting testosterone synthesis and inhibiting the decomposition of testosterone, that is, conversion to DHT (Dihydrotestosterone) and estradiol. More specifically, the extract of seokchangpo may increase the expression of testosterone synthesis-related factors, such as StAR protein, SYP11A1, CYP17A1, 3β-HSD4 and/or 17β-HSD1. In addition, the seokchangpo extract can reduce the expression of testosterone degradation-related factors that convert testosterone into DHT and estradiol, such as 5α-reductase2 (5α-reductase2) and/or aromatase. This can prevent or treat androgenic syndrome.

In addition, the seokchangpo extract can help to prevent or treat andropause syndromes such as muscle mass decrease by helping to increase muscle mass.

In addition, the seokchangpo extract can prevent or treat androgenetic syndromes such as increased visceral fat, increased arteriosclerosis and increased carotid artery thickness, and increased insulin resistance by reducing LDL-cholesterol.

In addition, the seokchangpo extract can prevent or treat androgenetic syndrome such as decreased physical ability such as muscle strength and endurance, fatigue and related symptoms through improvement of physical ability and anti-fatigue effect.

In a specific embodiment of the present invention, the present inventors prepared an ethanol aqueous solution extract of Acorus gramineus Solander, and as a result of processing it in an in vitro model of male menopause, the effect of increasing testosterone, increasing testosterone synthesis related factors and reducing testosterone degradation related factors was confirmed to appear.

In addition, the present inventors found that, as a result of administering the extract to an in vivo model of male menopause, LDL-cholesterol reduction, physical ability improvement and anti-fatigue effect were shown, along with the effects of increasing testosterone, increasing testosterone synthesis-related factors and reducing testosterone degradation-related factors, It was confirmed that it can help increase muscle mass.

In addition, the present inventors confirmed that the extract does not show toxicity in an in vitro model of male menopause and an in vivo model of male menopause.

Therefore, the present inventors found that the extract according to the present invention has little toxicity in cells and animals, increases testosterone synthesis and inhibits degradation, as well as helps increase muscle mass in andropause animal models, and LDL- Since it was confirmed that it reduces cholesterol, improves physical ability, and exhibits an anti-fatigue effect, the seokchangpo extract according to the present invention can be usefully used as an active ingredient in a pharmaceutical composition for preventing or treating androgenic syndrome.

The pharmaceutical composition of the present invention may further include an appropriate carrier, excipient or diluent commonly used in the preparation thereof.

The pharmaceutical dosage form of the composition according to the present invention may be used alone or in combination with other pharmaceutically active compounds as well as in any suitable group. The pharmaceutical composition according to the present invention may be formulated in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and injections, respectively, according to a conventional method. . Carriers, excipients and diluents that may be included in the pharmaceutical composition comprising the extract according to the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, Various compounds or mixtures including calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil can be heard In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the mixed extract. prepared by mixing In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin fat, glycerogelatin, etc. may be used.

The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route and duration of administration, but may be appropriately selected by those skilled in the art. The pharmaceutical composition of the present invention may be administered to mammals such as rats, mice, livestock, and humans by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection. However, for a desirable effect, in the case of oral administration, the composition of the present invention per 1 kg of body weight per day is generally administered to adults at 0.0001 to 1,000 mg/kg per day, preferably 0.001 to 500 mg/kg per day. have. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.

In addition, the present invention provides a health functional food composition for preventing or improving androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.

In the present invention, the content of the extraction method and extraction target, characteristics and diseases of the extract of seok iris is the same as the content described in the pharmaceutical composition for the prevention or treatment of androgenic syndrome comprising the extract of seok iris as an active ingredient, so the specific description is the above The contents are cited, and below, only the specific composition of the health functional food composition will be described.

On the other hand, the present inventors found that the extract according to the present invention has little toxicity in cells and animals, increases testosterone synthesis and inhibits degradation, as well as helps increase muscle mass in male menopause animal models, LDL- Since it was confirmed that it reduces cholesterol, improves physical ability, and exhibits an anti-fatigue effect, the seokchangpo extract according to the present invention can be usefully used as an active ingredient in a health functional food composition for preventing or improving androgenic syndrome.

The health functional food composition of the present invention may be prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto. In addition, the extract shall include any one of an extract obtained by extraction treatment, a diluted or concentrated liquid of the extract, a dried product obtained by drying the extract, a crude product or a purified product.

The health functional food composition is not particularly limited as long as it can be ingested in order to prevent or improve the androgenic symptom root. When the health functional food composition of the present invention is used as a food additive, the health functional food composition may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The active ingredient may be used appropriately depending on the purpose of its use (prevention or improvement). In general, it is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the health functional food composition of the present invention when preparing food or beverage. However, in the case of long-term intake for the purpose of health control, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range. There is no particular limitation on the type of the food. Examples of foods to which the health functional food composition can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea There are drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the ordinary sense. In addition, the health functional food composition of the present invention may be prepared as a food, particularly a functional food.

The functional food of the present invention includes ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients and seasonings. For example, when manufactured as a drink, natural carbohydrates or flavoring agents may be included as additional ingredients in addition to the active ingredient. The natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrin, cyclodextrin, etc.) or sugar alcohols (eg, , xylitol, sorbitol, erythritol, etc.). As the flavoring agent, natural flavoring agents (eg, taumatine, stevia extract, etc.) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) may be used. In addition to the health functional food composition, various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid It may further contain a carbonation agent and the like used in beverages.

Hereinafter, the present invention will be described in detail by way of Examples.

However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

<Example 1> Seokchangpo ( Acorus gramineus Solander) Preparation of ethanol aqueous solution extract

<1-1> Seokchangpo ( Acorus gramineus Solander) Preparation of ethanol aqueous solution extract

We purchased dried Acorus gramineus Solander grown in Jeju Special Self-Governing Province and sold by Pure Mind Company (Yeongcheon, Korea). The dried stone iris was extracted with 30% ethanol as shown in the schematic diagram of FIG. 1 .

Specifically, after adding 4 times the volume of 1.2 L 30% ethanol (w/v) to 300 g of dried stone iris, extraction was performed three times at room temperature at 24 hour intervals. Each extract was combined, filtered through filter paper (Whatman No.1, Whatman International Ltd., Maidstone, UK), and concentrated under reduced pressure at 50°C (N-1200A, EYELA, Tokyo, Japan) and then freeze-dried (FD8508, ilShinBioBase, Dongducheon, Korea) to obtain an ethanol aqueous solution extract from Seokchangpo. The obtained Seokchangpo ethanol aqueous solution extract was named AGE and stored at -70°C until use.

<1-2> Seokchangpo ( Acorus gramineus Solander) Preparation of ethanol aqueous solution extract

An ethanol aqueous solution extract of Seokchangpo was prepared in the same manner as in Example <1-1>, except that 99.9% ethanol (w/v) was added as an extraction solvent.

<Experimental Example 1> Male menopause in vitro Efficacy evaluation of Seokchangpo ethanol aqueous solution extract in the model

<1-1> Male menopause in vitro model making

As men age, various external stimuli such as oxidative stress continuously damage Leydig cells, decrease testosterone synthesis ability, and lower testosterone levels. On the other hand, Luteinizing hormone (LH) stimulation is increased to increase testosterone levels in the pituitary gland. Human chorionic gonadotropin (hCG) shares a receptor with LH and expresses StAR protein (Steroidogenic acute regulatory protein) and CYP11A1 (Cholesterol side-chain cleavage enzyme) through the cAMP/PKA pathway. It produces testosterone by expressing testosterone-related synthetase enzymes. Therefore, after increasing testosterone by treating Leydig cells with hCG, H ₂ O ₂ , one of the reactive oxygen species generated by aging and various external stimuli, was added to produce an in vitro model of andropause in which testosterone synthesis was suppressed, and testosterone level and mRNA expression of testosterone synthesis and degradation-related factors. Testosterone levels were confirmed by ELISA, and mRNA expression of testosterone synthesis and degradation-related factors was confirmed by real-time PCR (RT-PCR).

Specifically, TM3 cells, a Leydig cell line from mouse testis (ATCC, Manassas, VA, USA) were mixed with 10% FBS (Gibco, Grand Island, NY, USA) and 1% antibiotic antimycotic solution (Corning Cellgro, Manassas, VA, USA). High glucose DMEM medium (Hyclone, Logan, UT, USA) containing this was used and cultured at 37°C and 5% CO ₂ conditions. Then, TM3 cells were seeded in a 96-well plate at 1 × 10 ⁴ cells/well, cultured to reach a density of 80-90%, the medium was removed, and washed with PBS (pH 7.4). Then, 0.05 IU/mL of hCG (Sigma-Aldrich (St. Louis, MO, USA) was added to serum-free medium without 10% FBS and cultured for 20 hours. After 20 hours, 200 μM H ₂ O ₂ (St. Louis, MO, USA) was added and further incubated for 4 hours Testosterone was measured at absorbance at 450 nm using the testosterone ELISA kit (ARBOR ASSAYSTM, Michigan, USA) after collecting the culture medium. Measurement values were calculated using curve expert 1.3 (Hyams Development, Starkville, MS, USA) (FIG. 2).

In addition, TM3 cells were seeded in a 6-well plate at 0.3 × 10 ⁶ cells/well, and hCG and H ₂ O ₂ were added in the same manner as above, and then the cells were harvested and RNAiso Plus (Takara Bio Inc, Kusatsu, Japan) was used. was used to extract mRNA. Then, cDNA was synthesized using a T100 ^tm ThermalCycler (BioRad, Munich, Germany). To measure the mRNA expression of testosterone synthesis and degradation-related factors, SYBR Green was used and amplified with Light Cycler 96 (Roche, Mannheim, Germany). Real-time PCR conditions were preincubated at 95°C for 10 minutes, followed by a total of 40 times in the order of 95°C 10 seconds, 55°C 10 seconds, and 72°C 10 seconds. It had a cooling time of 30 seconds. Testosterone synthesis-related factors include StAR protein (Steroidogenic acute regulatory protein), CYP11A1 (Cholesterol side-chain cleavage enzyme), CYP17A1 (17,20-desmolase), 3β-HSD (3β-hydroxysteroid dehydrogenase), and 17β-HSD (17β-HSD). hydroxysteroid dehydrogenase) was confirmed, testosterone degradation related factors were 5alpha-reductase2 (5α-reductase2) and aromatase, and GAPDH was confirmed as an internal standard (Fig. 3 and Fig. 4). The primer nucleotide sequences for their confirmation are shown in [Table 1] below.

Primer Sequence (5'→3') SEQ ID NO: GAPDH Forward GTGTTCCTACCCCCAATGTGT One Reverse AGGAGACAACCTGGTCCTCAGT 2 StAR protein Forward TCTCTAGTGTCTCCCACTGCATAGC 3 Reverse TTAGCATCCCCTGTTCGAGCT 4 CYP11A1 Forward ACATGGCCAAGATGGTACAGTTG 5 Reverse ACGAAGCACCAGGTCATTCAC 6 CYP17A1 Forward ACGCTCATCTTCAAGTCAGTAAT 7 Reverse GGTCTGTATGGTAGTCAGTATCG 8 3β-HSD4 Forward GTGATATGAAGAGGGAGAGGAC 9 Reverse AAGACAAGTTGGACAGAGTGT 10 17β-HSD1 Forward ACAATGGGCAGTGATTAC 11 Reverse GTGGTCCTCTCAATCTCTTC 12 5α-reductase2 Forward GCAAGCCTATTACCTGGTT 13 Reverse AGAAGACACCGACGCTAA 14 aromatase Forward ACAATAAGATGTATGGAGAGTTCA 15 Reverse GCTTGAGGACTTGCTGATAA 16

As a result, as shown in FIG. 2 , the testosterone level of hCG-stimulated TM3 cells (5.65 ± 0.90 pg/mL) was about 47 times higher than that of TM3 cells not treated with hCG (0.12 ± 0.09 pg/mL). It was confirmed that there was a significant increase. On the other hand, when H ₂ O ₂ was added to hCG-stimulated TM3 cells, it was confirmed that the testosterone level (1.12 ± 0.55 pg/mL) was significantly reduced by about 80%.

In addition, as shown in FIG. 3 , in the case of testosterone synthesis-related factors, mRNA expression of StAR protein, CYP11A1, CYP17A1, and 17β-HSD1, except for 3β-HSD4 ( FIG. 3D ), in TM3 cells stimulated with hCG did not indicate that hCG was not treated. It was confirmed that there was a significant increase over the On the other hand, it was confirmed that the mRNA expression of CYP17A1 and 17β-HSD1 was significantly decreased when H ₂ O ₂ was added to hCG-stimulated TM3 cells. In the case of CYP11A1, a tendency to decrease mRNA expression was also confirmed.

In addition, as shown in FIG. 4 , in the case of testosterone degradation-related factors, mRNA expression of 5-alpha-reductase 2 was decreased in hCG-stimulated TM3 cells, whereas when H ₂ O ₂ was added, about 2.2 times significantly was confirmed to increase.

From the above results, it can be seen that TM3 cells to which hCG and H ₂ O ₂ have been added are suitable as an in vitro model of andropause.

<1-2> Male menopause in vitro Comparison of efficacy of extracts of seokchangpo and various materials in the model

Decreased physical ability, such as muscle mass, strength, and endurance, is one of the symptoms of male menopause. In addition, testosterone stimulates skeletal muscle protein synthesis in men, inhibits its breakdown, and is involved in muscle hypertrophy and bone health. Therefore, testosterone level and testosterone synthesis and degradation-related factors according to the treatment of the ethanol aqueous solution extract of Seokchangpo of Example <1-2> and the extract of a material known to increase physical ability in the androgenic in vitro model of Experimental Example <1-1> mRNA expression was compared.

Specifically, hCG and H ₂ O ₂ were added after culturing TM3 cells in the same manner as described in Experimental Example <1-1>, but when hCG was added, Seokchangpo prepared in Example <1-2> 250 μg/mL of an ethanol aqueous solution extract was added together. In addition, in the case of the control group, 250 μg/mL of a 99.9% methanol aqueous solution extract of vitamin tree ( Hippophae rhamnoides ), mistletoe ( Viscum album ) or safflower ( Carthamus tinctorius ) was added as a material extract known to increase physical ability. Extracts used as a control group were purchased from Korea Plant Extracts Bank (Cheongju, Korea).

After the addition of each sample to the TM3 cells and completion of culturing, ELISA was performed in the same manner as described in Experimental Example <1-1> to confirm the testosterone level (FIG. 5), and testosterone synthesis related by performing real-time PCR The mRNA expression of the factor (FIG. 6) and the mRNA expression of the factor related to testosterone degradation (FIG. 7) were confirmed.

As a result, as shown in Figure 5, compared with the testosterone level when the extract was not treated, the ethanol aqueous solution extract treatment group of Seokchangpo of Example <1-2> was about 14.8 times, the vitamin tree extract treatment group was about 29.1 times, It was confirmed that the testosterone level significantly increased in the mistletoe extract treatment group by about 6.2 times, and in the safflower extract treatment group by about 23.5 times.

In addition, as shown in FIG. 6, mRNA expression of StAR protein, CYP11A1, CYP17A1, 3β-HSD4, and 17β-HSD1 as testosterone synthesis-related factors in the group treated with the ethanol aqueous solution extract of Seokchangpo of Example <1-2> was significantly was found to increase the most.

In addition, as shown in FIG. 7, it was confirmed that the mRNA expression of aromatase as a testosterone degradation-related factor was significantly reduced in the group treated with the ethanol aqueous solution extract of Seokchangpo of Example <1-2>.

Combining the results of comparison of the testosterone level, testosterone synthesis, and mRNA expression of factors related to degradation, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention is the most suitable material for the treatment of male menopause syndrome.

<1-3> Male menopause in vitro Evaluation of cell viability according to treatment by concentration of Seokchangpo ethanol aqueous solution extract in the model

In order to investigate the cytotoxicity of the ethanol aqueous solution extract of Seokchangpo of the present invention in TM3 cells and in vitro model of andropause, TM3 cells and in vitro model of andropause of Example <1-1> were analyzed in Example <1-1>. After adding the AGE prepared by concentration by concentration, MTT assay was performed to confirm cell viability.

Specifically, TM3 cells were seeded in a 96-well plate at 1 × 10 ⁴ cells/well and cultured for 24 hours, then the medium was removed and washed with PBS (pH 7.4). Then, the AGEs prepared in Example <1-1> were added at concentrations of 100, 250 and 500 μg/mL, and incubated for 24 hours again. Thereafter, MTT solution (1 mg/mL) was added to each well and further incubated for 2 hours. After removing the medium, 100 μL of DMSO was added to dissolve formazan, and the absorbance was measured at 570 nm (Epoch, BioTek Instruments, Winooski, VT, USA). Cell viability was determined through the following formula (FIG. 8A): Cell viability (%) = [(Experimental group absorbance - Blank absorbance) / (Control group absorbance - Blank absorbance)] × 100.

In addition, after culturing TM3 cells in the same manner as in Experimental Example <1-1>, hCG and H ₂ O ₂ were added, but when hCG was added, the AGE prepared in Example <1-1> was used. were added together at concentrations of 100, 250 and 500 μg/mL. After completion of the culture, MTT assay was performed in the same manner as above (FIG. 8B).

As a result, as shown in FIG. 8 , in the case of normal TM3 cells, cell viability was similar in the Control group without AGE and the AGE treatment group at 100 and 250 μg/mL concentrations ( FIG. 8A ). In addition, in the case of the male menopause in vitro model, it was confirmed that the cell viability did not decrease when AGE was treated by concentration compared to the male menopause in vitro model that was not treated with AGE (FIG. 8B).

From the above results, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention has almost no cytotoxicity in the male menopause in vitro model.

<1-4> Male menopause in vitro Efficacy evaluation according to treatment by concentration of Seokchangpo ethanol aqueous solution extract in the model

In order to examine the efficacy of the treatment according to the concentration of the ethanol aqueous solution extract of Seokchangpo of the present invention in the male menopause in vitro model, the AGE of Example <1-1> was applied to the male menopause in vitro model of Experimental Example <1-1> by concentration. After addition, testosterone levels and mRNA expression of factors related to testosterone synthesis and degradation were compared.

Specifically, after culturing TM3 cells in the same manner as in Experimental Example <1-1>, hCG and H ₂ O ₂ were added, but when hCG was added, the AGE prepared in Example <1-1> were added together at concentrations of 100, 250 and 500 μg/mL. After completion of the culture, testosterone levels were confirmed by performing ELISA in the same manner as in Experimental Example <1-1> (FIG. 9), and mRNA expression of testosterone synthesis-related factors by performing real-time PCR (FIG. 10) and mRNA expression of testosterone degradation-related factors (FIG. 11).

On the other hand, in order to compare the efficacy of extracts with different extraction solvents, testosterone levels were checked after adding Seokchangpo hot water extract instead of AGE as a comparison group (FIG. 9).

As a result, as shown in FIG. 9, the testosterone level increased in a concentration-dependent manner in the AGE treatment group compared to the Control group, and in particular, the testosterone level significantly increased in the AGE 250 μg/mL treatment group and the AGE 500 μg/mL treatment group. confirmed that In addition, it was confirmed that the testosterone level was significantly increased in the AGE-treated group compared to the Seokchangpo hot water extract-treated group.

In addition, as shown in FIG. 10 , it was confirmed that the mRNA expression of testosterone synthesis-related factors was overall increased in the AGE-treated group at concentrations of 100, 250 and 500 μg/mL compared to the Control group, except for 3β-HSD4. . In particular, it was confirmed that the mRNA expression of StAR protein and CYP11A1 in the AGE 250 μg/mL treatment group, and the expression of CYP17A1 and 17β-HSD1 in the AGE 500 μg/mL treatment group were the highest.

In addition, as shown in FIG. 11 , it was confirmed that the expression of 5 alpha-reductase 2 was significantly reduced in the AGE-treated group at concentrations of 100, 250 and 500 μg/mL compared to the Control group.

From the above results, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention increases testosterone levels by promoting the synthesis of testosterone and inhibiting the conversion of testosterone to DHT.

<Experimental Example 2> Male menopause in vivo Efficacy evaluation of Seokchangpo ethanol aqueous solution extract in the model

<2-1> Male menopause in vivo Model production and administration of ethanol aqueous solution extract of Seokchangpo

In order to implement the male menopause that appears in middle-aged men in vivo , many studies use experimental animals of high age. Accordingly, an in vivo model of male menopause was prepared using a mouse model of high age, and the ethanol aqueous solution extract of Seokchangpo of the present invention was administered.

Specifically, 7-week-old male ICR mice (20-30 g) and 6-week-old male ICR mice (20-30 g) were purchased from Samtako BIO KOREA (Osan, Korea). As shown in the schematic diagram of FIG. 12, ICR mice (7 weeks old, male, 20-30 g) were fed freely with water and feed for 10 weeks. After 10 weeks, ICR mice (6 weeks old, male, 20-30 g) were received. After 1 week, 18-week-old male ICR mice and 7-week-old male ICR mice were used for the experiment. Experimental animals were maintained at 22 ± 2℃, relative humidity of 55 ± 5%, and a 12-hour light-dark cycle, and the experiment was conducted with the approval of the Suwon University Animal Experiment Ethics Committee (USW-IACUC-R-2020-002).

The experimental animals were divided into a total of 4 groups as shown in [Table 2]: Control group, AGE50 group, AGE200 group, and Normal Control group (N.C group). Each group was 10 animals, and 18-week-old male ICR mice were used for the Control group, AGE50 group, and AGE200 group, and 7-week-old male ICR mice were used for the N.C group, 6 times a week for 4 weeks with saline or Example <1-1 > The AGE prepared in was orally administered.

group (n=10/group) Test Methods Control Oral administration of saline at the age of 18 weeks AGE50 Oral administration of AGE (50 mg/kg of BW/day) at 18 weeks of age AGE200 Oral administration of AGE (200 mg/kg of BW/day) at 18 weeks of age Normal Control (N.C.) Oral administration of saline at 7 weeks of age

In addition, a forced swimming test (FST) was conducted once a week for 4 weeks to evaluate the decrease in physical ability, which is one of the symptoms of male menopause. The forced swimming test was carried out in a plastic barrel filled with water at 32-36℃ with a weight corresponding to 5% of each mouse's weight hung on its tail. Swimming retention time was recorded for endurance evaluation, and swimming retention time was defined as the time for a total of 10 seconds for the nose to sink based on the surface of the water while the experimental animal was swimming.

<2-2> Male menopause in vivo Evaluation of body weight and organ weight after administration of ethanol aqueous solution extract of Seokchangpo in the model

In order to examine the effect on the toxicity and muscle mass of the ethanol aqueous solution extract of seokchangpo of the present invention in an in vivo model of male menopause, the body weight of the experimental animal of Experimental Example <2-1> and the organ weight including the leg muscles were measured. .

Specifically, the body weight of the experimental animals was measured twice a week from the time the experiment was started. The body weight (BW) increase was the difference between the last weight and the initial weight, and the food efficiency ratio (FER) was calculated by dividing the weight gain (g) by the food intake (g).

In addition, after performing the experiment for 4 weeks, the experimental animals that were fasted for 12 hours were sacrificed using a CO ₂ chamber, and blood and organs of the sacrificed animals were collected. For serum separation, centrifugation was performed at 3,000 rpm for 20 minutes (MF-80, Hanil Science industrial, Incheon, Korea). The collected organs are liver, muscle, epididymal fat, and testis, and the muscles are leg muscles of a total of 5 regions, which correspond to the tibialisanterior, EDL, gastrocnimivs, plantaris, and soleus. Each organ was washed with PBS (pH 7.4), dried, and weighed. In addition, the total muscle weight was measured by adding the leg muscle weights of a total of 5 sites. The results of body weight and organ weight measurement are shown in [Table 3] to [Table 7] below.

Weight gain and FER (n=10/group) group Initial weight (g) Last weight (g) Weight gain ¹⁾ (g) FER ²⁾ Control 48.22 ± 1.87 ^a 44.67 ± 1.61 ^a -3.55 ± 0.50 ^b -0.02 ± 0.00 ^b AGE50 47.70 ± 1.68 ^a 45.22 ± 1.55 ^a -2.48 ± 0.71 ^b -0.02 ± 0.00 ^b AGE200 45.97 ± 1.78 ^a 43.78 ± 1.33 ^ab -2.20 ± 0.56 ^b -0.01 ± 0.00 ^b N.C. 34.18 ± 0.26 ^b 39.98 ± 0.75 ^b 5.80 ± 0.72 ^a 0.04 ± 0.00 ^{a 1)} Weight gain (g): Last weight (g) - First weight (g)
²⁾ FER: Weight gain (g) / Food intake (g)

Liver weight and ratio (n=10/group) group Liver weight (g) Liver ratio ¹⁾ (mg/100g of BW) Control 1.54 ± 0.09 3.65 ± 0.18 AGE50 1.54 ± 0.06 3.63 ± 0.07 AGE200 1.58 ± 0.06 3.78 ± 0.05 N.C. 1.46 ± 0.05 3.88 ± 0.11 ¹⁾ Liver ratio: liver weight (mg) / body weight (mg) × 100 (g)

Epididymal fat weight and ratio (n=10/group) group Epididymal fat weight (g) Epididymal fat ratio ¹⁾ (mg/100g of BW) Control 0.93 ± 0.15 2.56 ± 0.24 AGE50 1.22 ± 0.25 2.46 ± 0.46 AGE200 1.19 ± 0.17 2.60 ± 0.29 N.C. 1.00 ± 0.12 2.63 ± 0.27 ¹⁾ Epididymal fat ratio: Epididymal fat weight (mg) / body weight (mg) × 100 (g)

leg muscle weight (n=10/group) group tibialis anterior muscle
Weight (g) EDL
Weight (g) gastrocnemius
Weight (g) plantar muscle
Weight (g) splenic muscle
Weight (g) total muscle ¹⁾
Weight (g) Control 0.07 ± 0.00 0.01 ± 0.00 0.16 ± 0.01 0.02 ± 0.00 0.01 ± 0.00 ^b 0.27 ± 0.01 AGE50 0.07 ± 0.00 0.01 ± 0.00 0.17 ± 0.00 0.02 ± 0.00 0.01 ± 0.00 ^ab 0.29 ± 0.01 AGE200 0.07 ± 0.00 0.01 ± 0.00 0.16 ± 0.01 0.02 ± 0.00 0.01 ± 0.00 ^a 0.28 ± 0.01 N.C. 0.07 ± 0.00 0.01 ± 0.00 0.15 ± 0.00 0.02 ± 0.00 0.01 ± 0.00 ^b 0.27 ± 0.00 ¹⁾ Total muscle weight (g): tibialis anterior + EDL + gastrocnemius + plantar + splenic muscle weight (g)

Leg muscle ratio (n=10/group) group Tibialis anterior muscle ratio ¹⁾ (mg/100g of BW) EDL
Ratio ¹⁾ (mg/100g of BW) gastrocnemius
Ratio ¹⁾ (mg/100g of BW) plantar muscle
Ratio ¹⁾ (mg/100g of BW) splenic muscle
Ratio ¹⁾ (mg/100g of BW) total muscle ²⁾
Ratio ¹⁾ (mg/100g of BW) Control 0.16 ± 0.01 ^b 0.03 ± 0.00 ^b 0.37 ± 0.01 ^b 0.05 ± 0.00 ^b 0.02 ± 0.00 ^b 0.65 ± 0.02 ^b AGE50 0.18 ± 0.01 ^ab 0,03 ± 0.00 ^ab 0.40 ± 0.01 ^ab 0.05 ± 0.00 ^b 0.03 ± 0.00 ^ab 0.69 ± 0.02 ^ab AGE200 0.18 ± 0.01 ^ab 0.03 ± 0.00 ^ab 0.38 ± 0.01 ^ab 0.06 ± 0.00 ^b 0.03 ± 0.00 ^a 0.68 ± 0.01 ^ab N.C. 0.18 ± 0.01 ^a 0.04 ± 0.00 ^a 0.41 ± 0.01 ^a 0.06 ± 0.00 ^a 0.03 ± 0.00 ^a 0.72 ± 0.01 ^{a 1)} Muscle ratio: muscle weight (g) / body weight (mg) × 100 (g)
²⁾ Total muscle ratio: tibialis anterior + EDL + gastrocnemius + plantar + spleen (g)

As a result, as shown in Table 3, there was a significant difference in weight gain and FER of the 10-week-old N.C group, the 21-week-old Control group, the AGE50 group, and the AGE200 group, but the same week-old Control group and the AGE50 group. , it was confirmed that there was no significant difference within the AGE200 group.

In addition, as shown in Tables 4 and 5, it was confirmed that there was no significant difference in the liver and epididymal fat ratios per body weight in each group.

In addition, as shown in Tables 6 and 7, it was confirmed that the leg muscle and total muscle ratio of 5 parts per body weight of the N.C group was significantly higher than that of the Control group. In addition, the ratio of tibialis anterior, EDL, gastrocnemius and total muscle per body weight in the AGE50 and AGE200 groups, excluding the plantar muscle, did not show a significant difference compared to the Control group, but showed a tendency to increase to a level similar to that of the N.C group, and the splenic muscle In the case of , it was confirmed that the AGE200 group increased to the same level as the N.C group.

From the above results, it can be seen that the ethanol aqueous solution extract of seokchangpo of the present invention helps to improve muscle mass loss, which is one of the symptoms of male menopause, without toxicity.

<2-3> Male menopause in vivo Evaluation of hepatocellular damage index after administration of ethanol aqueous solution extract of Seokchangpo in the model

Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are sensitive indicators of hepatocellular injury, and elevations in ALT and AST reflect liver damage. Accordingly, in order to examine the effect of the ethanol aqueous solution extract of Seokchangpo on the liver in an in vivo model of male menopause, ALT and AST, which are hepatocellular damage indexes, were measured in the serum of the experimental animals of Experimental Example <2-1>.

Specifically, ALT and AST were analyzed in the serum obtained in Experimental Example <2-2> using a biochemical analyzer (FUJI DRY CHEM 500i, FUJI photo film Co., LTD, Tokyo, Japan). The measurement results are shown in [Table 8].

ALT, AST in serum (n=10/group) group ALT (U/I) AST (U/I) Control 25.70 ± 1.91 60.67 ± 5.20 ^a AGE50 25.00 ± 1.88 53.40 ± 4.47 ^ab AGE200 23.13 ± 1.19 47.50 ± 2.31 ^b N.C. 25.29 ± 1.87 51.8 ± 3.21 ^ab

As a result, as shown in Table 8, it was confirmed that there was no significant difference in ALT in all experimental groups. On the other hand, AST was slightly lower in the AGE200 group, but it was confirmed that there was no significant difference between the N.C group and the AGE50 group.

Combining the above results and the results of the liver-to-body ratio of Experimental Example <2-2>, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention does not exhibit liver toxicity.

<2-4> Male menopause in vivo Blood lipid evaluation after administration of ethanol aqueous solution extract of Seokchangpo in the model

Andropause, obesity, and metabolic syndrome are closely related, and it is known that an increase in LDL-cholesterol and a decrease in HDL-cholesterol increase the risk of cardiovascular disease. Therefore, in order to investigate the effect of the ethanol aqueous solution extract of seokchangpo on blood lipids in the male menopause in vivo model, the blood lipids TG (triglyceride), total-cholesterol, HDL in the serum of the experimental animal of Experimental Example <2-1> -Cholesterol and LDL-cholesterol were measured.

Specifically, TG, total-cholesterol, HDL-cholesterol were analyzed using a biochemical analyzer (FUJI DRY CHEM 500i, FUJI photo film Co., LTD, Tokyo, Japan) in the serum obtained in Experimental Example <2-2>. did. LDL-cholesterol was determined through the following formula: LDL-cholesterol = total-cholesterol - HDL-cholesterol - (TG / 5). The measurement results are shown in [Table 9].

Serum TG, total-cholesterol, HDL-cholesterol and LDL-cholesterol (n=10/group) group TG (mg/dL) Total-cholesterol (mg/dL) HDL-Cholesterol (mg/dL) LDL-Cholesterol (mg/dL) Control 141.44 ± 19.58 161.00 ± 10.48 33.67 ± 3.61 103.43 ± 6.76 ^a AGE50 141.33 ± 13.73 153.00 ± 6.14 36.17 ± 2.93 94.68 ± 3.63 ^ab AGE200 144.89 ± 14.33 147.00 ± 4.95 34.57 ± 1.43 87.34 ± 4.18 ^b N.C. 151.70 ± 10.81 148.70 ± 4.64 34.00 ± 1.18 86.16 ± 5.44 ^b

As a result, as shown in Table 9, it was confirmed that there was no significant difference in TG, total-cholesterol and HDL cholesterol in all experimental groups. On the other hand, it was confirmed that LDL cholesterol was significantly decreased in the AGE200 group and the N.C group compared to the Control group.

From the above results, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention has an effect of reducing LDL cholesterol.

<2-5> Male menopause in vivo Evaluation of testosterone and testosterone-related factors after administration of ethanol aqueous solution extract of Seokchangpo in the model

In order to examine the effect of the ethanol aqueous solution extract of Seokchangpo on testosterone and testosterone-related factors in an in vivo model of male menopause, testosterone was measured in the serum of the experimental animals of Experimental Example <2-1>, and mRNA of testosterone-related factors in the testis Expression was measured.

Specifically, as described in Experimental Example <2-1>, blood was obtained before and after AGE administration to experimental animals and after completion of the experiment, and serum was separated from the blood in the same manner as in Experimental Example <2-2>. did. The separated serum was measured for testosterone using the testosteron ELISA kit in the same manner as described in Experimental Example <1-1> (FIG. 13).

In addition, after the end of the experiment, the animals were sacrificed and testes were collected. The collected testes were homogenized, mRNA was extracted using RNAiso Plus, and cDNA was synthesized using T100 ^tm ThermalCycler. Thereafter, real-time PCR was performed in the same manner as described in Experimental Example <1-1> to measure the mRNA expression of the testosterone synthesizing factor ( FIG. 14 ) and the mRNA expression of the testosterone degrading factor ( FIG. 15 ).

As a result, as shown in FIG. 13 , the serum testosterone levels of the AGE50 and AGE200 groups before AGE administration were similar to those of the Control group, whereas the serum testosterone levels of the AGE50 and AGE200 groups after 4 weeks of AGE administration were compared with the Control group. It was confirmed that there was a significant increase. In particular, it was confirmed that the serum testosterone level of the AGE200 group was higher than that of the N.C group.

In addition, as shown in FIG. 14 , it was confirmed that mRNA expression of StAR protein, CYP11A1, CYP17A1, and 17β-HSD1, which are testosterone synthesizing factors, increased in the testes of the AGE50 and AGE200 groups after 4 weeks of AGE administration compared to the Control group.

In addition, as shown in FIG. 15 , it was confirmed that the mRNA expression of testosterone decomposing factors 5alpha-reductase 2 and aromatase in the testis of the AGE50 and AGE200 groups after 4 weeks of AGE administration decreased compared to the Control group.

From the above results, it can be seen that the ethanol aqueous solution extract of Seokchangpo of the present invention increases testosterone levels by promoting the synthesis of testosterone and inhibiting the conversion of testosterone to DHT and estradiol.

<2-6> Male menopause in vivo Evaluation of physical ability after administration of ethanol aqueous solution extract of Seokchangpo in the model

In order to examine the effect of the ethanol aqueous solution extract of Seokchangpo on the physical ability in the male menopause in vivo model, the swimming retention time was measured while the forced swimming test was performed on the experimental animals of Experimental Example <2-1>, and after the test was completed Fatigue-related factors, lactate and lactate dehydrogenase (LDH), were measured in animal blood and serum.

Specifically, as disclosed in Experimental Example <2-1>, a forced swimming test was performed on the experimental animals once a week for 4 weeks to measure the swimming retention time (sec) (FIG. 16).

In addition, after the 4th week forced swimming test, blood was obtained and analyzed for lactic acid 30 minutes later, and serum was separated from the blood in the same manner as described in Experimental Example <2-2>, and then LDH was analyzed. Lactic acid and LDH were analyzed using a biochemical analyzer (FUJI DRY CHEM 500i, FUJI photo film Co., LTD, Tokyo, Japan) (FIG. 17).

As a result, as shown in FIG. 16 , it was confirmed that the swimming retention time increased in proportion to the AGE administration period in both the AGE50 group and the AGE200 group compared to the Control group.

In addition, as shown in FIG. 17 , it was confirmed that the level of factors related to fatigue was decreased in the AGE50 group and the AGE200 group compared to the Control group.

From the above results, it can be seen that the ethanol aqueous solution extract of seokchangpo of the present invention improves the decrease in physical ability such as muscle strength and endurance due to andropause symptoms, and exhibits an anti-fatigue effect.

<110> Industry-university Cooperation of USW <120> Composition for preventing, ameliorating or treating andropause syndrome comprising Acorus gramineus Solander extract as an active ingredient <130> KR2160040-SWUI <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 1 gtgttcctac ccccaatgtg t 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 2 aggagacaac ctggtcctca gt 22 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> StAR protein forward primer <400> 3 tctctagtgt ctcccactgc atagc 25 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> StAR protein reverse primer <400> 4 ttagcatccc ctgttcgagc t 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CYP11A1 forward primer <400> 5 acatggccaa gatggtacag ttg 23 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CYP11A1 reverse primer <400> 6 acgaagcacc aggtcattca c 21 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CYP17A1 forward primer <400> 7 acgctcatct tcaagtcagt aat 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CYP17A1 reverse primer <400> 8 ggtctgtatg gtagtcagta tcg 23 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 3beta-HSD4 forward primer <400> 9 gtgatatgaa gagggagagg ac 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3beta-HSD4 reverse primer <400> 10 aagacaagtt ggacagagtg t 21 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 17beta-HSD1 forward primer <400> 11 acaatgggca gtgattac 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 17beta-HSD1 reverse primer <400> 12 gtggtcctct caatctcttc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 5alpha-reductase2 forward primer <400> 13 gcaagcctat tacctggtt 19 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 5alpha-reductase2 reverse primer <400> 14 agaagacacc gacgctaa 18 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> aromatase forward primer <400> 15 acaataagat gtatggagag ttca 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aromatase reverse primer <400> 16 gcttgaggac ttgctgataa 20

Claims (13)

A pharmaceutical composition for preventing or treating androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.
According to claim 1, wherein the seokchangpo extract is water, C ₁ to C ₄ It is characterized in that extracted with a lower alcohol or a mixed solvent thereof, a pharmaceutical composition for the prevention or treatment of male menopausal syndrome.
[Claim 3] The pharmaceutical composition for preventing or treating androgenic syndrome according to claim 2, wherein the seokchangpo extract is extracted with an aqueous ethanol solution.
According to claim 3, wherein the seokchangpo extract is characterized in that the extraction with 20 to 40% ethanol aqueous solution, the prophylaxis or treatment of androgenic syndrome pharmaceutical composition.
[Claim 2] The pharmaceutical composition for the prevention or treatment of androgenic syndrome according to claim 1, wherein the extract of seok iris is composed of one or more extracts selected from the group consisting of rhizomes, flowers, leaves, fruits and seeds of seok iris.
The method of claim 1, wherein the androgenic syndrome is decreased sperm count and activity accompanied by testosterone decrease, increased visceral fat, decreased muscle mass, decreased strength and endurance, decreased bone density, increased arteriosclerosis and increased carotid artery thickness, increased insulin resistance, A pharmaceutical composition for the prevention or treatment of androgenic syndrome, characterized in that it is selected from the group consisting of a decrease in intellectual activity, cognitive ability and spatial orientation, fatigue, depression, mood changes that pollinate irritability, and sleep disorders.
[Claim 2] The pharmaceutical composition for the prevention or treatment of androgenic syndrome according to claim 1, wherein the extract of seokchangpo is characterized in that it has one or more of the following characteristics:
1) increased testosterone;
2) increased testosterone synthesis-related factors;
3) decrease testosterone degradation related factors;
4) help increase muscle mass;
5) LDL-cholesterol reduction; and
6) Improving physical ability and anti-fatigue.
According to claim 7, wherein the testosterone synthesis-related factor is StAR protein, SYP11A1, CYP17A1, 3β-HSD4 and 17β-HSD1, characterized in that any one or more selected from the group consisting of, the prevention or treatment of andropausal syndrome, the pharmaceutical composition for treatment.
According to claim 7, wherein the testosterone degradation-related factor is 5-alpha-reductase 2 or aromatase, characterized in that the, prophylactic or therapeutic pharmaceutical composition for androgenic syndrome.
According to claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient, the prophylactic or therapeutic pharmaceutical composition for androgenic syndrome.
The method of claim 1, wherein the composition is prepared in any one formulation selected from the group consisting of capsules, powders, granules, tablets, suspensions, emulsions, syrups and aerosols, for the prevention or treatment of androgenic syndrome pharmaceutical composition.
A health functional food composition for preventing or improving androgenic syndrome comprising an extract of Acorus gramineus Solander as an active ingredient.
According to claim 12, wherein the composition is powder, granules, pills, tablets, capsules, candies, syrups and beverages, characterized in that prepared in any one formulation selected from, the prevention or improvement of male menopausal syndrome health functional food composition .

Images