KR20230172979A - Composition for inhibiting biofilm comprising hydrolyzate of ovotransferrin and use thereof - Google Patents

Abstract

The present invention relates to a composition for inhibiting biofilm containing ovotransferrin hydrolyzate and its use. Since the ovotransferrin hydrolyzate can effectively inhibit biofilm formed by Listeria monocytogenes strains, it is used as an antibacterial composition, Lys. It has the advantage of being able to be used in pharmaceutical compositions and food compositions for preventing or treating teratosis.

Description

Composition for inhibiting biofilm comprising hydrolyzate of ovotransferrin and use thereof}

The present invention relates to a composition for inhibiting biofilm containing ovotransferrin hydrolyzate and its use, and more specifically, to Listeria monocytogenes biofilm containing ovotransferrin hydrolyzate treated with papain, blomelain, or flabozyme. It relates to an inhibitory composition, an antibacterial composition containing the hydrolyzate, a pharmaceutical composition for preventing or treating listeriosis, and a food composition.

Listeria monocytogenes is a Gram-positive bacterium that exists in a variety of environments and can survive in harsh environments such as high salinity, low temperature, and low pH. Listeria monocytogenes causes listeriosis, one of the most dangerous foodborne diseases with significant mortality. Each year, 1,600 cases of listeriosis are reported, with a mortality rate of 16.25% (FDA, 2020). Additionally, people with weakened immune systems, such as pregnant women, newborns, and the elderly, are more susceptible to Listeria monocytogenes.

Listeria monocytogenes attaches to the surfaces of living and inanimate objects and forms biofilms. Biofilm is composed of a colony of bacteria surrounded by extracellular polymers such as extracellular polysaccharides, DNA, phospholipids, and proteins. Once formed, biofilms become more resistant to antibacterial substances and are more difficult to remove than floating cells. Therefore, biofilms of Listeria monocytogenes present in food and food processing environments are a serious problem for food safety and human health. Therefore, researching effective antibacterial agents against Listeria monocytogenes biofilms has emerged as an important issue. Due to the emergence of these resistant strains and consumer concerns about chemical antibacterial agents, research is being conducted in the food industry on natural antibacterial agents to replace synthetic antibacterial agents.

Meanwhile, egg white proteins, including ovotransferrin and lysozyme, play a role in protecting eggs from external microorganisms. Ovotransferrin, the second major egg white protein, accounting for 12-13% of egg white proteins, is composed of approximately 686 amino acids and is known to have a molecular weight of approximately 78 kDa. In addition, ovotransferrin is a transferrin protein with two iron-binding sites, and this characteristic allows ovotransferrin to remove iron ions from microorganisms and have antimicrobial activity.

Enzymatic hydrolysis is known as a method of producing peptides with improved physiological activity than the parent protein. In addition, it has been reported that various functions such as antioxidant, anticancer, and immune regulation of ovotransferrin are improved after the hydrolysis process. Hydrolysis using various proteolytic enzymes produces peptides with different structural properties, amino acid sequences, and lengths, and the functionality of the peptides may vary depending on their structural properties. Although much research has been conducted on the various functions of ovotransferrin and its hydrolysates, there is little research on its ability to inhibit biofilm formation.

Accordingly, the present inventors completed the present invention by confirming the inhibitory effect of ovotransferrin hydrolyzate on Listeria monocytogenes on biofilm production.

The purpose of the present invention is to provide a composition for inhibiting biofilm containing a hydrolyzate of ovotransferrin as an active ingredient.

In order to achieve the above object, the present invention provides a composition for inhibiting biofilm, comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the biofilm may be characterized as being formed by Listeria monocytogenes.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.

In the present invention, the hydrolyzate of ovotransferrin may be included at a concentration of 1 to 10 ⁵ μg/mL.

The present invention also provides an antibacterial composition comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.

In the present invention, the hydrolyzate of ovotransferrin may be included at a concentration of 1 to 10 ⁵ μg/mL.

From another aspect, the present invention provides a composition for food comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.

In the present invention, the hydrolyzate of ovotransferrin may be included at a concentration of 1 to 10 ⁵ μg/mL.

The present invention also provides a pharmaceutical composition for preventing or treating listerosis, comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.

In the present invention, the hydrolyzate of ovotransferrin may be included at a concentration of 1 to 10 ⁵ μg/mL.

The ovotransferrin hydrolyzate of the present invention can effectively inhibit Listeria monocytogenes biofilm formation. Therefore, the ovotransferrin hydrolyzate has the advantage of being able to be used for antibacterial purposes or for preventing or treating listerosis.

Figure 1 relates to SDS-PAGE analysis of ovotransferrin and ovotransferrin hydrolysate. In Figure 1, M is the marker, lane 1 is OT (ovotransferrin), lane 2 is OTBM (bromelain-treated ovotransferrin hydrolyzate), lane 3 is OTFV (ovotransferrin hydrolyzate treated with Flavourzyme®), lane 4 represents OTNT (ovotransferrin hydrolyzate treated with Neutrase®), lane 5 represents OTPP (ovotransferrin hydrolyzate treated with papain), and lane 6 represents OTPM (ovotransferrin hydrolyzate treated with Protamex®).
Figure 2 relates to the effect of ovotransferrin and ovotransferrin hydrolyzate on biofilm formation of Listeria monocytogenes.
Figure 3 relates to the effect of ovotransferrin and ovotransferrin hydrolyzate on the formed Listeria monocytogenes biofilm.
In Figures 2 and 3, A is ATCC 15313, B is H7962, C is NADC Scott A, OT is ovotransferrin, OTBM is ovotransferrin hydrolyzate treated with bromelain, OTFV is ovotransferrin hydrolyzate treated with Flavourzyme, OTNT stands for ovotransferrin hydrolyzate treated with neutrase, OTPP stands for ovotransferrin hydrolyzate treated with papain, and OTPM stands for ovotransferrin hydrolyzate treated with Protamex. All values were expressed as mean ± standard error. Different letters indicate significant differences between samples (p < 0.05).
Figure 4 relates to the effect of ovotransferrin and ovotransferrin hydrolyzate (500 μg/mL) on EPS production in Listeria monocytogenes.
Figure 5 relates to the effect of ovotransferrin and ovotransferrin hydrolyzate (500 μg/mL) on the metabolic activity of Listeria monocytogenes.
In Figures 4 and 5, black bars are for ATCC 15313, gray bars are for H7962, white bars are for NADC Scott A, OT is ovotransferrin, OTBM is bromelain-treated ovotransferrin hydrolyzate, and OTFV is Flavourzyme-treated ovotransferrin. Transferrin hydrolyzate, OTNT refers to ovotransferrin hydrolyzate treated with Neutrase, OTPP refers to ovotransferrin hydrolyzate treated with papain, and OTPM refers to ovotransferrin hydrolyzate treated with Protamex. All values were expressed as mean ± standard error. Different letters indicate significant differences between samples (p < 0.05).
Figure 6 relates to the effect of ovotransferrin and OTPP (500 μg/mL) on mRNA expression in Listeria monocytogenes H7962. All values were expressed as mean ± standard error. Different letters indicate significant differences between samples (p < 0.05).
Figure 7 relates to a scanning electron micrograph (× 5,000 magnification) of Listeria monocytogenes treated with ovotransferrin and OTPP (500 μg/mL).

Hereinafter, the present invention will be described in detail.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

Listeria monocytogenes is an important foodborne pathogenic microorganism that causes listeriosis and can have harmful effects on humans. Ovotransferrin is one of the proteins that make up egg whites and has various functions such as antioxidant, antimicrobial, and antiviral. However, research on the inhibitory effect of ovotransferrin hydrolyzate on biofilm formation is still lacking.

Therefore, in one aspect, the present invention relates to a composition for inhibiting biofilm, comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the biofilm may be characterized as being formed by Listeria monocytogenes, but is not limited thereto.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme, but is not limited thereto.

The present inventors completed the present invention by confirming the inhibitory effect of ovotransferrin and ovotransferrin hydrolyzate hydrolyzed with five enzymes (bromelain, Flavourzyme, Neutarse, papain, and Protamex) on Listeria monocytogenes on biofilm production. In particular, ovotransferrin hydrolyzate treated with papain effectively reduces the bacterial surface hydrophobicity, self-aggregation ability, EPS production, and metabolic activity of Listeria monocytogenes, thereby significantly inhibiting biofilm formation of Listeria monocytogenes and forming biofilm. The film was removed. The results of qRT-PCR analysis showed that the expression of biofilm-related genes was reduced when the papain-treated ovotransferrin hydrolyzate was treated. In addition, the inhibitory effect of ovotransferrin and its hydrolyzate on the biofilm of Listeria monocytogenes was confirmed through SEM.

In the present invention, the hydrolyzate of ovotransferrin is included at a concentration of 1 to 10 ⁵ μg/mL, preferably 10 to 10 ⁴ μg/mL, and more preferably 10 ² to 10 ³ μg/mL. It can be done, but is not limited to this.

From another perspective, the present invention relates to an antibacterial composition comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme, but is not limited thereto.

In the present invention, the hydrolyzate of ovotransferrin is included at a concentration of 1 to 10 ⁵ μg/mL, preferably 10 to 10 ⁴ μg/mL, and more preferably 10 ² to 10 ³ μg/mL. It can be done, but is not limited to this.

From another aspect, the present invention relates to a composition for food containing a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme, but is not limited thereto.

In the present invention, the hydrolyzate of ovotransferrin is included at a concentration of 1 to 10 ⁵ μg/mL, preferably 10 to 10 ⁴ μg/mL, and more preferably 10 ² to 10 ³ μg/mL. It can be done, but is not limited to this.

From another aspect, the present invention relates to a pharmaceutical composition for preventing or treating listerosis, comprising a hydrolyzate of ovotransferrin as an active ingredient.

In the present invention, the hydrolyzate may be characterized as being hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme, but is not limited thereto.

In the present invention, the hydrolyzate of ovotransferrin is included at a concentration of 1 to 10 ⁵ μg/mL, preferably 10 to 10 ⁴ μg/mL, and more preferably 10 ² to 10 ³ μg/mL. It can be done, but is not limited to this.

In the present invention, the food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and their processed foods (e.g. canned fruit, bottled foods, jam, mamalade, etc.), fish, meat and their processed foods (e.g. ham, sausages, etc.) corned beef, etc.), bread and noodles (e.g. udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine , vegetable protein, retort food, frozen food, various seasonings (e.g. soybean paste, soy sauce, sauce, etc.), etc. can be produced by adding the hydrolyzate of ovotransferrin of the present invention. In addition, nutritional supplements are not limited to this, but can be prepared by adding the hydrolyzate of ovotransferrin of the present invention to capsules, tablets, pills, etc. In addition, the health functional food is not limited to this, but for example, the hydrolyzate of ovotransferrin of the present invention can be prepared in the form of tea, juice, and drink and liquefied, granulated, encapsulated, and powdered for drinking (health beverage). It can be digested and consumed. Additionally, in order to use the hydrolyzate of ovotransferrin of the present invention in the form of a food additive, it can be prepared and used in the form of powder or concentrate. In addition, it can be prepared in the form of a composition by mixing the hydrolyzate of ovotransferrin of the present invention with a known active ingredient known to be effective in preventing or improving listeriosis.

In the present invention, when the hydrolyzate of ovotransferrin is used as a health drink, the health drink composition may contain various flavoring agents or natural carbohydrates as additional ingredients like a normal drink. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; polysaccharides such as dextrins and cyclodextrins; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol. Sweeteners include natural sweeteners such as thaumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.

In the present invention, the hydrolyzate of ovotransferrin may be contained as an active ingredient in a food composition for preventing or improving listeriosis, but the amount is not particularly limited to an amount effective to achieve the action of preventing or improving listeriosis. , it is preferably 0.01 to 100% by weight based on the total weight of the entire composition.

In the present invention, the composition for health functional food can be prepared by mixing the hydrolyzate of ovotransferrin with other active ingredients known to be effective against listeriosis.

In the present invention, in addition to the above, the food of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, and stabilizers. It may contain topicals, preservatives, glycerin, alcohol, or carbonating agents. In addition, the food of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverage, or vegetable beverage. These ingredients can be used independently or in combination.

In the present invention, the term “pharmaceutical composition” refers to a mixture containing a hydrolyzate of ovotransferrin of the present invention and pharmaceutically acceptable excipients such as diluents or carriers. Pharmaceutical compositions include cosmetic compositions as well as compositions for therapeutic use. According to some embodiments, a method of administering a pharmaceutical composition comprising the composition of the present invention to a subject as needed is provided. In some embodiments, compositions of the present invention can be administered to humans.

In the present invention, the description of pharmaceutical compositions principally relates to pharmaceutical compositions for administration to humans, but those skilled in the art will understand that such compositions are generally suitable for administration to all types of animals. A skilled veterinary pharmacologist with a good understanding of the modifications of pharmaceutical compositions for administration to various animals can design and/or perform such modifications, if necessary, simply by routine experimentation.

In the present invention, the pharmaceutical composition may be prepared by any method known in the field of pharmacology or discussed later in the text. Generally, these methods for tableting involve the steps of associating the active ingredient with excipients and/or one or more other auxiliary ingredients, followed by shaping and/or packaging the product into the desired single- or multi-dose units, if necessary or desired. Includes steps.

In the present invention, the pharmaceutical composition may be manufactured, packaged, and/or sold unpackaged as a single unit dose and/or multiple single unit doses. “Unit dose” is a discrete amount of pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dosage of active ingredient administered to the subject and/or a convenient fraction of such dosage such as, for example, one-half or one-third of the dosage.

In the present invention, the relative amounts of the active ingredient, pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical composition may vary depending on the identity, size, and/or disorder of the subject being treated and the route by which the composition is administered. It will change. By way of example, the composition may include 0.1% to 100% (w/w) active ingredient.

For the purposes of the present invention, pharmaceutically acceptable excipients include any solvent, dispersion medium, diluent, or other liquid vehicle, dispersion or suspension aid, surface active agent, isotonic agent, thickener or emulsifier, preservative, or solid that is suitable for the purpose of the particular dosage form. Includes binders, lubricants, etc. Remington's (The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, (Lippincott, Williams & Wilkins, Baltimore, MD, 2006) describes various excipients used in the preparation of pharmaceutical compositions and known methods for their preparation. The technology is disclosed, except that any conventional carrier medium is incompatible with the substance or derivative thereof, for example by providing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition. and their uses are considered to be within the scope of the present invention. Pharmaceutically acceptable excipients are at least 95%, 96%, 97%, 98%, 99%, or 100% pure.

The excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

In some embodiments, excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersants and/or granulating agents, surface active agents and/or emulsifiers, disintegrants, binders, preservatives, buffers, lubricants, and/or oils. Not limited.

Such excipients may optionally be included in the formulations of the present invention. Excipients such as cocoa butter and suppository waxes, colorants, coating agents, sweeteners, flavors, and perfumers may be present in the composition at the discretion of the formulator.

Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dried starch, Including, but not limited to, corn starch, powdered sugar, and combinations thereof.

Exemplary granulating and/or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation-exchange resins. , Calcium Carbonate, Silicate, Sodium Carbonate, Cross-Linked Poly(vinyl-pyrrolidone) (Crospovidone), Sodium Carboxymethyl Starch (Sodium Starch Glycolate), Carboxymethyl Cellulose, Cross-Linked Sodium Carboxymethyl Cellulose ( croscarmellose), methylcellulose, pregelatinized starch (Starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (vegeum), sodium lauryl sulfate, quaternary ammonium compounds, and these. Including, but not limited to, combinations of.

Exemplary surface active agents and/or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and veegum [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol) , triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymers), carrageenans, cellulose derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxymethylcellulose) Ethylene Sorbitan Monolaurate [Tween 20], Polyoxyethylene Sorbitan [Tween 60], Polyoxyethylene Sorbitan Monooleate [Tween 80], Sorbitan Monopalmitate [Span 40], Sorbitan Monostearate [ span 60], sorbitan tristearate [span 65], glyceryl monooleate, sorbitan monooleate [span 80]), polyoxyethylene ester (e.g. polyoxyethylene monostearate [mirz 45]) , polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. cremophor), polyoxyethylene ethers, ( For example, polyoxyethylene lauryl ether [Brise 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl. Including, but not limited to, lauray, sodium lauryl sulfate, pluronic F 68, poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and/or combinations thereof. No.

Exemplary binders include starches (e.g. corn starch and starch paste); gelatin; sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); Natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, Farnwer gum, Shatty gum, Isapol Husk's slime, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl) cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (bigum), and lachi arabogalactan); alginate; polyethylene oxide; polyethylene glycol; inorganic calcium salt; silicic acid; polymethacrylate; wax; water; Alcohol; and combinations thereof.

Exemplary preservatives may include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, bisulfite. Including, but not limited to, sodium sulfate, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, disodium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. . Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, Includes, but is not limited to, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxyme mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluende (BHT), ethylenediamine, sodium lauryl sulfate (SLS), Sodium Lauryl Ether Sulfate (SLES), Sodium Bisulfite, Sodium Metabisulfite, Potassium Sulfite, Potassium Metabisulfite, Glydant Plus, Fenonib, Methylparaben, Low Mol 115, Germaben II, Neolon, Katon, and E Including, but not limited to, Uxil. In certain embodiments, the preservative is an antioxidant. In another embodiment, the preservative is a chelating agent.

Exemplary buffering agents include citrate buffer solution, acetate buffer solution, phosphate buffer solution, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluvionate, calcium gluceptate, calcium gluconate, D-gluconic acid, glyceroside. Calcium phosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic Basic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen -Includes, but is not limited to, free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.

Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium. Including, but not limited to, lauryl sulfate, and combinations thereof.

Exemplary oils include almond, apricot kernel, avocado, babassu palm, bergamot, black currant seed, borage, cayenne, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee. , corn, cotton seed, emu, eucalyptus, evening primrose, fish, flax seed, geraniol, pumpkin, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litthea cucumber. beba, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange-orange rappi, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower. , sandalwood, sasquana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oil. Exemplary oils include butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil. , and combinations thereof.

Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, liquid dosage forms may contain inert diluents such as, for example, water or other solvents, solubilizers and emulsifiers commonly used in the art such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl. Alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, sprout, olive, castor, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, It may also include polyethylene glycol and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In certain embodiments for parenteral administration, hydrolysates of ovotransferrin of the invention are mixed with solubilizing agents such as cremophor, alcohols, oils, denatured oils, glycols, polysorbates, cyclodextrins, polymers, and combinations thereof. do.

Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active ingredient may be combined with one or more inert pharmaceutically acceptable excipients or carriers such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol, and silicic acid, b ) binders such as, for example, carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrants such as agar, calcium carbonate, potato or tapioca starch. , alginic acid, certain silicates, and sodium carbonate, e) dissolution retarders such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) humectants such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof.

In the case of capsules, tablets and pills, dosage forms may contain buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using lactose or milk sugar as well as high molecular weight polyethylene glycols and the like as such excipients. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may optionally contain opacifying agents and may be compositions that release the active ingredient only, or preferentially, in a specific part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using lactose or milk sugar as well as high molecular weight polyethylene glycols and the like as such excipients.

The active ingredient may be in micro-encapsulated form with one or more of the excipients described above. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, controlled release coatings, and other coatings well known in the pharmaceutical formulation art. In these solid dosage forms the active ingredient may be mixed with one or more inert diluents such as sucrose, lactose or starch. These dosage forms may contain additional substances other than inert diluents as in common practice, such as tablet lubricants and other tablet auxiliaries such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, dosage forms may also contain buffering agents. They may optionally contain opacifying agents and may be compositions that release the active ingredient only, or preferentially, in a specific part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

In the present invention, dosage forms for topical and/or transdermal administration of the hydrolyzate of ovotransferrin may include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and/or patches. Generally, the active ingredient is admixed under conditions of sterility with a pharmaceutically acceptable carrier and/or any necessary preservatives and/or buffering agents that may be required. Additionally, the present invention contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the active ingredient to the body. Such dosage forms can be prepared, for example, by dissolving and/or dispersing the active ingredient in a suitable medium. Alternatively or additionally, the rate may be controlled by providing a rate controlling membrane and/or dispersing the active ingredient in a polymer matrix and/or gel.

Formulations for topical administration include, but are not limited to, liquid and/or semi-liquid preparations such as liniments, lotions, oil-in-water and/or water-in-oil emulsions such as creams, ointments/or pastes, and/or solutions and/or suspensions. Although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent, topically-administrable formulations may also comprise, for example, from about 1% to about 10% (w/w) of the active ingredient. Formulations for topical administration may further comprise one or more additional ingredients described herein.

In the present invention, the pharmaceutical composition may be manufactured, packaged, and/or sold as a preparation for pulmonary administration through the oral cavity. Such formulations contain the active ingredient and may comprise dry particles having a diameter in the range of about 0.5 to about 7 nanometers or about 1 to about 6 nanometers. These compositions are suitable for administration using a device comprising a dry powder reservoir into which a stream of propellant may be directed to disperse the powder and/or melt and/or dissolve the low-boiling propellant in a self-propelled solvent/powder dispensing vessel such as a sealed container. It is conveniently in the form of a dry powder for administration using a device containing the suspended active ingredient. Such powders include particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. Alternatively, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. The dry powder composition may include a solid fine powder diluent such as a sugar and is conveniently presented in unit dosage form.

Low boiling propellants generally include liquid propellants having a boiling point of less than 65°F at atmospheric pressure. Typically the propellant may make up 50 to 99.9% (w/w) of the composition and the active ingredient may make up 0.1 to 20% (w/w) of the composition. The propellant may further comprise additional ingredients such as liquid non-ionic and/or solid anionic surfactants and/or solid diluents (which may have the same grade of particle size as the particles comprising the active ingredient).

Pharmaceutical compositions of the invention formulated for pulmonary delivery may provide the active ingredient in the form of droplets of solution and/or suspension. Such preparations may be prepared, packaged, and/or sold as aqueous and/or dilute alcoholic solutions and/or suspensions, optionally sterile containing the active ingredients, conveniently using any nebulizing and/or nebulizing device. It may also be administered using. Such formulations may further include one or more additional ingredients including, but not limited to, flavoring agents such as saccharin sodium, volatile oils, buffering agents, surface active agents, and/or preservatives such as methylhydroxybenzoate. Droplets provided by this route of administration may have an average diameter within the range of about 0.1 to about 200 nanometers.

Formulations useful for pulmonary delivery are useful for intranasal delivery of the pharmaceutical compositions of the invention. Another formulation for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 to 500 micrometers. These preparations are administered in the manner in which snuff is taken, i.e. by rapid inhalation through the nasal passages from a powder container held close to the nostrils.

Formulations for nasal administration may comprise, for example, from about 0.1% (w/w) to 100% (w/w) of the active ingredient, and may also include one or more additional ingredients described herein. The pharmaceutical composition of the present invention may be manufactured, packaged, and/or sold as a formulation for oral administration. Such preparations may, for example, be in the form of tablets and/or lozenges manufactured by conventional methods, comprising, for example, 0.1 to 20% (w/w) of the active ingredient, an orally soluble and/or dissolvable composition. A balance and optionally one or more additional ingredients described herein may also be included. Alternatively, formulations for oral administration may comprise powders and/or aerosolized and/or nebulized solutions and/or suspensions containing the active ingredient. When dispersed, such powdered, aerosolized, and/or nebulized formulations may have a droplet size and/or average particle size in the range of about 0.1 to about 200 nanometers and may further comprise one or more additional ingredients described herein. It may also be included.

In the present invention, the hydrolyzate of ovotransferrin is typically prepared in dosage unit form for easy administration and uniform administration. However, it will be understood that the total daily dosage of the composition of the present invention will be determined by the attending physician within the scope of sound medical judgment. The particular therapeutically effective dose level for any particular subject will depend on a variety of factors, including the disease, disorder, or disorder being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; The subject's age, weight, general health, gender, and diet; the time of administration, route of administration, and rate of excretion of the particular active ingredient employed; duration of treatment; Drugs used in combination or simultaneously with the specific active ingredients employed; and factors well known in the medical field.

The pharmaceutical composition containing the hydrolyzate of ovotransferrin of the present invention may be administered by any route. In some embodiments, pharmaceutical compositions comprising a hydrolyzate of ovotransferrin may be administered orally, intravenously, intramuscularly, intraarterially, intramedullarily, intrathecally, subcutaneously, intracerebroventricularly, transdermally, intradermally, rectally, intravaginally, intraperitoneally, Topically (by powder, ointment, cream, and/or drop), mucosal, nasal, oral, enteral, sublingual; endotracheal instillation, bronchial instillation, and/or inhalation; and/or administered by various routes, including oral spray, nasal spray, and/or aerosol. Particularly contemplated routes are permeable intravenous injection, local administration via the blood and/or lymphatic supply, and/or direct administration to the affected area. In general, the most appropriate route of administration will depend on a variety of factors, including the properties of the agent (e.g., stability in the environment of the gastrointestinal tract), and the disorder of the subject (e.g., whether the subject can tolerate oral administration). will be. Currently, oral and/or nasal spray and/or aerosol routes are most commonly used to deliver therapeutic agents directly to the lungs and/or respiratory system. However, the present invention encompasses the delivery of the pharmaceutical composition according to the invention by any suitable route taking into account advances in the field of drug delivery.

In certain embodiments, pharmaceutical compositions comprising a hydrolyzate of ovotransferrin of the present invention may be used to administer from about 0.001 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, or from about 0.1 mg/kg to about 0.1 mg/kg of the subject's body weight per day. mg/kg to about 40 mg/kg, about 0.5 mg/kg to about 30 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 10 mg/kg, or about 1 mg. /kg to about 25 mg/kg may be administered at a dosage level sufficient to deliver once or more per day to achieve the desired therapeutic effect. The intended dosage may be delivered three times a day, twice a day, daily, every two days, every three days, weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered via multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more administrations). .

In the present invention, it will be understood that the dosage ranges provide guidance for administration of the provided pharmaceutical composition to adults. For example, the amount administered to a child or adolescent may be determined by a physician or person skilled in the art, and may be less or the same as that administered to an adult. The exact amount of a peptide according to the invention required to achieve an effective amount will vary from subject to subject, depending, for example, on the subject's species, age, and overall disorder, severity of side effects or disorders, identity of the specific compound, mode of administration, etc.

It will be understood that the pharmaceutical composition comprising a hydrolyzate of ovotransferrin in the present invention can be used in combination therapy. The particular combination of treatments (treatments or procedures) for use in combination therapy will take into account the desired therapeutic effect to be achieved and the suitability of the desired treatments and/or procedures.

The pharmaceutical compositions of the invention may be administered alone or in combination with one or more therapeutically active agents. As for "combination", it is not intended to imply that the agents must be administered at the same time and/or be formulated for delivery together, although the following delivery methods are within the scope of the present invention. The composition may be administered concurrently with, prior to, or subsequent to one or more other therapeutic agents or medical procedures. Generally, each agent will be administered at a dose and/or time schedule established for that agent. Additionally, the present invention provides a pharmaceutical form of the present invention in combination with agents capable of improving its bioavailability, reducing and/or modifying its metabolism, inhibiting its secretion, and/or modifying its distribution within the body. It encompasses delivering the composition. It will be further understood that the hydrolyzate of ovotransferrin and the therapeutically active agent of the invention used in this combination may be administered together in a single composition or separately in different compositions.

The particular combination used in combination therapy will take into account the desired therapeutic effect to be achieved and/or the suitability of the procedure and/or therapeutically active agent comprising the peptide of the invention. The combination used can achieve the desired effect for the same disorder (e.g., a hydrolyzate of ovotransferrin of the invention can be administered in combination with another therapeutically active agent used to treat the same disorder), and/or they may achieve different effects (eg, control of any side effects).

As used herein, "therapeutically active agent" refers to any substance used as a medicine to treat, prevent, delay, reduce or ameliorate a disorder, and refers to substances used in treatment, including prophylactic and curative treatments. .

In some embodiments, the pharmaceutical compositions of the present invention treat, alleviate, ameliorate, alleviate, delay the onset, inhibit the progression, reduce the severity, and/or one or more symptoms or characteristics of listeriosis. or in combination with any therapeutically active agent or procedure (e.g., surgery, radiation therapy) useful to reduce its incidence.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

[Example]

Experimental materials and methods

Tryptic soy broth (TSB) was purchased from Difco Laboratories (Detroit, MI, USA), and phosphate buffered saline (PBS) was purchased from HyClone (Logan, UT, USA). Dimethyl sulfoxide (DMSO) was purchased from Sigma-Aldrich (St Louis, Mo, USA). The EZNA Bacterial RNA Kit for total RNA extraction was purchased from Omega Bio-tek (Norcross, GA, USA), and the cDNA Synthesis Kit and SYBR Green No-ROX Kit for qRT-PCR were purchased from SensiFAST (Bioline, London, UK). .

(Example 1-1) Strain and culture conditions

Listeria monocytogenes ATCC 15313 (ATCC 15313), Listeria monocytogenes H7962 (H7962), and Listeria monocytogenes NADC 2045 Scott A (NADC Scott A), which form biofilms, were used in the study. Listeria monocytogenes strains were cultured in tryptic soy broth (TSBYE) supplemented with 0.6% yeast extract at a temperature of 37°C for 24 hours. All strains were stored at -80°C in 20% glycerol.

(Example 1-2) Preparation of ovotransferrin hydrolyzate

Ovotransferrin was added to distilled water and stirred to prepare an ovotransferrin aqueous solution. Afterwards, the pH of the ovotransferrin aqueous solution was adjusted to pH 7, which is the optimal pH of the proteolytic enzyme to be used, and bromelain, flabozyme, nutrace, papain, and Protamax proteolytic enzymes were each added at a ratio of 5%. After addition, the hydrolysis reaction proceeded for 6 hours. To inactivate the enzyme, the hydrolysis reaction was terminated by heating in boiling water for 10 minutes and centrifugation (10,000 × g, 4°C) for 15 minutes. Only the supernatant was recovered and freeze-dried to prepare ovotransferrin hydrolyzate. Ovotransferrin hydrolysates prepared using bromelain, flabozyme, Nutrace, papain, and Protamax were named OTBM, OTFV, OTNT, OTPP, and OTPM, respectively. The molecular weight of ovotransferrin hydrolyzate was analyzed by SDS-PAGE (15% gel).

(Example 1-3) Inhibitory ability of Listeria monocytogenes to form biofilm

Three species of Listeria monocytogenes were cultured in TSBYE at 37°C for 24 hours. To evaluate the initial ability to inhibit biofilm formation, 200 μL each of ovotransferrin hydrolyzate (125, 250, 500 μg/mL) and the bacterial solution diluted to a concentration of 10 ⁶ CFU/mL were dispensed into a 24 well plate. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. After culturing at 37°C for 24 hours, each well was washed by adding 400 μL of distilled water, 400 μL of 0.5% (w/v) crystal violet solution was added and stained for 30 minutes, then washed three times with tap water and dried. . After decolorizing by adding 400 μL of acid-methanol solution, it was transferred to a new 96 well plate and the absorbance was measured at 570 nm.

To evaluate the ability to inhibit the formed biofilm, 100 μL of the bacterial solution diluted to a concentration of 10 ⁶ CFU/mL was added to a 96 well plate and incubated at 37°C for 24 hours, followed by TSBYE and ovotransferrin hydrolyzate (125, 250, 500). μg/mL) was dispensed in 50 μL each. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. After culturing at 37°C for 24 hours, the absorbance was measured and calculated using the following equation 1 after washing, staining, and decolorization in the same manner as above.

(Equation 1)

Biofilm formation inhibition ability (%) = {1-(absorbance of treatment group/absorbance of control group)} × 100

(Example 1-4) Surface hydrophobicity of Listeria monocytogenes

15 mL of Listeria monocytogenes bacterial solution diluted to a concentration of ^{10 7} CFU/mL and 5 mL of ovotransferrin hydrolyzate (500 μg/mL) were placed in a 50 mL tube and incubated at 37°C for 24 hours. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. After centrifugation for 5 minutes (17,709 × g, 4°C), the supernatant was removed, and the settled bacteria were washed twice with PBS buffer. The bacteria were dissolved in PBS buffer and the absorbance of the bacterial suspension (absorbance before reaction) was adjusted to 0.2 ± 0.02 at 600 nm. The bacterial suspension and hydrophobic solvent were mixed in a 4:1 ratio in a 2 mL tube and vortexed evenly for 2 minutes. After standing at 37°C for 15 minutes, the water-soluble portion was transferred to a 96 well plate and the absorbance (post-reaction absorbance) was measured at 600 nm to calculate the bacterial surface hydrophobicity using Equation 2 below.

(Equation 2)

Bacterial surface hydrophobicity (%) = {1-(absorbance after reaction/absorbance before reaction)} × 100

(Example 1-5) Aggregation ability of Listeria monocytogenes

Listeria monocytogenes cultured in TSBYE at 37°C for 24 hours was placed in a 50 mL tube and centrifuged for 5 minutes (17,709 × g, 4°C). The supernatant was removed, and the settled bacteria were washed twice with PBS buffer. Bacteria were dissolved in PBS buffer and the absorbance of the bacterial suspension was adjusted to 0.1 ± 0.03 at 600 nm. Add 3 mL of bacterial suspension and ovotransferrin hydrolyzate (500 μg/mL) to a 15 mL tube, mix, transfer to a 96 well plate, and measure absorbance (absorbance before reaction) at 600 nm. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. After culturing at 37°C for 24 hours, the supernatant was transferred to a 96 well plate, the absorbance (absorbance after reaction) was measured at 600 nm, and the bacterial aggregation ability was calculated using Equation 3 below.

(Equation 3)

Bacterial aggregation ability (%) = {1-(absorbance after reaction/absorbance before reaction)} × 100

(Example 1-6) EPS (exopolysaccharides) production ability of Listeria monocytogenes

1 mL each of the bacterial solution and ovotransferrin hydrolyzate (500 μg/mL) diluted to a concentration of 10 ⁷ CFU/mL were added to a 6-well plate, incubated at 37°C for 24 hours, and washed twice with PBS buffer. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. After washing with 2 mL of distilled water in each well, 1 mL of PBS buffer was added, and the bacteria formed on the bottom of the plate were collected, transferred to a 1.5 mL microtube, and centrifuged for 10 minutes (8,000 × g, 4°C). After removing the supernatant, 500 μL of 0.5M NaOH was added and reacted for 3 hours. After centrifugation for another 10 minutes (8,000 It was transferred to a 96 well plate and the absorbance was measured at 625 nm, and the EPS production rate was calculated using the following equation 4.

(Equation 4)

EPS production rate (%) = (absorbance of treatment group/absorbance of control group) × 100

(Example 1-7) Metabolic activity of Listeria monocytogenes

Add 200 μL each of the bacterial solution and ovotransferrin hydrolyzate (500 μg/mL) diluted to a concentration of ^{10 6} CFU/mL into a 24 well plate and culture at 37°C for 24 hours, then remove the supernatant from each well. 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) solution (1 mg/mL) was added. After reaction for 4 hours, it was dissolved in dimethyl sulfoxide, the absorbance was measured at 570 nm, and the metabolic activity was calculated using the following equation 5.

(Equation 5)

Metabolic activity (%) = (absorbance of treatment group/absorbance of control group) × 100

(Example 1-8) mRNA expression in Listeria monocytogenes

Add 2 mL each of the bacterial solution diluted to a concentration of 10 ⁶ CFU/mL and ovotransferrin hydrolyzate (500 μg/mL) and incubate at 37°C for 24 hours. Use the EZNA Bacterial RNA Kit to isolate total RNA. did. After converting this to cDNA, qRT-PCR was performed with primers actA, agrD, dltB, flaA, flgE, and prfA (Table 1), and 16s rRNA was used as a reference gene. Gene amplification results were calculated using the delta-delta Ct method.

Primer sequences used for qRT-PCR Gene ¹ Primer Sequence of primers (5'-3') 16s rRNA Forward AGCGTCAAGGGACAAGCA Reverse GGGAGGCAGCAGTAGGGA actA Forward CGGGTAAATGGGTACGTGAT Reverse TGGTCAATTAACCTTGCACTT agrD Forward AAATCAGTTGGTAAATTCCTTTCTAG Reverse AATGGACTTTTTGGTTTCGTATACA dltB Forward CGAGCTGCGAAAGGTTTGTT Reverse TGTTGTTCCACTAGACATCGC flaA Forward CTGGTATGAGTCGCCTTAG Reverse CATTGCGGTGTTTGGTTTG flgE Forward AATGCCAACACGACAGGATA Reverse TTTGTTCCAGCGTAAAGTCC prfA Forward CGGGAAGCTTGGCTCTATTTG Reverse GCTAACAGCTGAGCTATGTGC

In Table 1, ¹ 16S rRNA was used as a reference gene. actA is an actin assembly-inducing protein gene, agrD is an accessory gene regulator D gene, dltB is a transmembrane protein gene, and flaA is a flagellin motility gene. (flagellin motility gene), flgE represents a flagellar hook protein gene, and prfA represents a listeriolysin regulatory protein gene.

(Example 1-9) Ability to inhibit biofilm formation of Listeria monocytogenes using field-emission scanning electron microscopy

Add 2 mL each of the bacterial solution diluted to a concentration of 10 ⁶ CFU/mL and ovotransferrin hydrolyzate (500 μg/mL) into a 6-well plate containing a glass coupon, and culture at 37°C for 24 hours. Then, incubate with PBS buffer for 2 hours. Washed twice. In the control group, an equal amount of distilled water was added instead of ovotransferrin hydrolyzate. 4 mL of 2.5% glutaraldehyde diluted in PBS was added and the biofilm was fixed to the glass coupon for 1 hour. After washing the glass coupon twice with PBS buffer, it was dehydrated with ethanol of various concentrations (50%, 70%, 90%, 100%) for 15 minutes each, placed in isoamyl acetate-ethanol solution, and then freeze-dried. After coating a glass coupon with gold, the effect of ovotransferrin hydrolyzate on the form of Listeria monocytogenes was confirmed using FESEM.

(Example 1-10) Statistical analysis

The results were expressed as mean ± standard deviation values by repeating three or more independent experiments. Statistical analysis was performed using the IBM SPSS statistics version 25.0 (IBM Corp., Armonk, New York, USA) program. The statistical significance of the experimental results was tested at the p < 0.05 level using one-way ANOVA.

Molecular weight analysis of ovotransferrin hydrolyzate.

The SDS-PAGE form of ovotransferrin and ovotransferrin hydrolyzate is shown in Figure 1. Ovotransferrin showed a thick band around 75 kDa and several thin bands around 37 kDa and 50 kDa. Although the same amount (10 mg/mL) of ovotransferrin hydrolyzate was added to lanes 2-6, all hydrolysates showed different band shapes: OTBM and OTPP were composed of peptides of various molecular weights (10-37 kDa). It could be seen that OTFV showed a thick band around 37-50 kDa. In particular, the molecular weight of OTNT was confirmed to be less than 10 kDa. Therefore, it can be seen that the five proteolytic enzymes produced various types of peptides from ovotransferrin, and that the ovotransferrin hydrolyzate showed various effects.

Confirmation of the effect of ovotransferrin hydrolyzate on biofilm formation of Listeria monocytogenes

Biofilms are communities of microorganisms surrounded by extracellular polymeric substances and adhere to various surfaces. Listeria monocytogenes in biofilms is resistant to antibiotics, making it more difficult to remove. Therefore, biofilm can cause cross-contamination problems between foods in the food processing environment.

The effect of ovotransferrin and ovotransferrin hydrolyzate on early-stage biofilm formation of Listeria monocytogenes is shown in Figure 2. Ovotransferrin and ovotransferrin hydrolyzate inhibited biofilm formation in a concentration-dependent manner, and it was confirmed that among ovotransferrin hydrolysates, OTBM, OTNT, and OTPP significantly inhibited early-stage biofilm formation compared to OTFV or OTPM (Figure 2). In particular, OTPP effectively inhibited the early stage biofilm of Listeria monocytogenes, and when treated with 500 μg/mL OTPP, the degree of biofilm formation for ATCC 15313, H7962, and NADC Scott A was 13.76%, respectively, compared to the control group. decreased to 19.18% and 39.80% (p < 0.05). However, when ovotransferrin was hydrolyzed with Nutrace and Protamax, the effect of inhibiting biofilm formation was reduced (p < 0.05).

Unlike the results of inhibiting biofilm formation in the early stage (Figure 2), ovotransferrin did not remove the formed biofilm of the mature Listeria monocytogenes strain (Figure 3). The reason why the degree of biofilm formation in the early stage (Figure 2) is lower than that in the mature biofilm (Figure 3) is because the mature biofilm is more resistant to antibiotics than the biofilm in the early stage, making it more difficult to remove. The formed biofilm of mature Listeria monocytogenes strains was significantly eliminated with increasing concentrations of OTFV and OTPP (Figure 3) (p < 0.05). In particular, the biofilm formed when treated with OTPP at concentrations of 125, 250, and 500 μg/mL was removed by 48.61-74.43%, 40.89-67.75%, and 37.51-61.07%, respectively.

Effect of ovotransferrin hydrolyzate on surface hydrophobicity and aggregation ability of Listeria monocytogenes

Cellular properties, including bacterial surface hydrophobicity and self-aggregation ability, enhance bacterial attachment, colonization, and biofilm growth. Biofilm formation goes through several stages: adhesion, maturation, separation, and dispersion. Attachment is the most important step in the development of disease caused by pathogens in the food and medical industries. Bacterial surface hydrophobicity and electron exchange properties are important determinants of bacterial attachment, and bacteria with hydrophobic properties tend to adhere to hydrophobic surfaces.

Additional analysis was performed at the highest concentration (500 μg/mL) among those used in the previous experiment. The bacterial surface hydrophobicity of Listeria monocytogenes treated with ovotransferrin and its hydrolyzate was evaluated through affinity with polar solvents including chloroform and ethyl acetate. In addition, the affinity for chloroform (polar acidic solvent) and ethyl acetate (polar basic solvent) was considered as electron donor and electron acceptor characteristics, respectively.

Ovotransferrin significantly increased the bacterial surface hydrophobicity of Listeria monocytogenes (Table 2) (p < 0.05). However, when all ovotransferrin hydrolysates were treated, the affinity of H7962 for chloroform and NADC Scott A for ethyl acetate were significantly decreased (p < 0.05). OTPP reduced the affinity for chloroform and ethyl acetate of all Listeria monocytogenes strains (p < 0.05). The consistent inhibitory effect of OTPP on bacterial surface hydrophobicity (Table 2) and biofilm formation (Figures 2 and 3) suggests that surface hydrophobicity may promote bacterial adhesion, leading to biofilm formation.

Effect of ovotransferrin and ovotransferrin hydrolyzate (500 μg/mL) on bacterial surface hydrophobicity (%) of Listeria monocytogenes. Treatment ¹ L. monocytogenes ATCC 15313 H7962 NADC 2045 Scott A Chloroform Control 26.78 ± 5.47 ^de 16.36 ± 1.92 ^b 19.70 ± 5.41 ^c OT 69.11 ± 4.87 ^a 42.86 ± 3.73 ^a 68.66 ± 6.84 ^a OTBM 29.45 ± 4.98 ^cd 12.41 ± 3.05 ^c 26.26 ± 3.63 ^b OTFV 31.03 ± 6.87 ^c 10.76 ± 3.55 ^cd 25.28 ± 3.37 ^b OTNT 36.32 ± 5.81 ^b 7.86 ± 3.20 ^e 26.74 ± 4.66 ^b OTPP 24.22 ± 3.04 ^e 3.55 ± 2.32 ^f 14.76 ± 4.74 ^d OTPM 30.26 ± 5.26 ^c.d. 8.84 ± 3.60 ^de 23.52 ± 4.87 ^b Ethyl acetate Control 38.24 ± 5.74 ^b 19.67 ± 5.56 ^c.d. 32.02 ± 4.76 ^b OT 66.80 ± 6.08 ^a 51.27 ± 6.28 ^a 67.87 ± 5.61 ^a OTBM 38.64 ± 5.41 ^b 20.24 ± 5.07 ^cd 14.69 ± 4.88 ^d OTFV 35.16 ± 5.83 ^b.c. 16.31 ± 5.23 ^d 14.76 ± 4.94 ^d OTNT 34.87 ± 5.70 ^b.c. 24.71 ± 5.53 ^b 22.72 ± 4.96 ^c OTPP 34.08 ± 5.32 ^c 11.62 ± 5.00 ^e 14.76 ± 4.74 ^d OTPM 33.06 ± 5.72 ^c 20.65 ± 4.88 ^c 23.52 ± 4.87 ^c

In Table 2, OT is ovotransferrin, OTBM is ovotransferrin hydrolyzate treated with bromelain, OTFV is ovotransferrin hydrolyzate treated with Flavourzyme, OTNT is ovotransferrin hydrolyzate treated with neutrase, and OTPP is ovotransferrin hydrolyzate treated with papain. Lysate, OTPM refers to ovotransferrin hydrolyzate treated with Protamex. All values were expressed as mean ± standard error. Different letters indicate significant differences between samples (p < 0.05).

Overall, for all Listeria monocytogenes strains, the affinity for ethyl acetate was higher than that for chloroform. Therefore, the surface of Listeria monocytogenes shows electron acceptor characteristics rather than electron donor characteristics, which means that the electron acceptor-plastic surface material can show higher adhesion and biofilm formation ability than the electron donor-stainless steel surface material. . Therefore, it is believed that stainless steel can be applied to the food processing industry instead of plastic to prevent food spoilage.

Unlike co-aggregation, which is the ability to bind to other strains, autoaggregation is a bacterial self-binding characteristic associated with early-stage biofilm formation. Through these characteristics, pathogens can protect themselves from external stress. The autoaggregation ability of Listeria monocytogenes was inhibited by ovotransferrin and ovotransferrin hydrolyzate compared to the control group (Table 3). However, there was no significant difference between the self-aggregation ability of bacteria treated with ovotransferrin and hydrolyzate.

Effect of ovotransferrin and ovotransferrin hydrolyzate (500 μg/mL) on the bacterial aggregation ability (%) of Listeria monocytogenes. Treatment ¹ L. monocytogenes ATCC 15313 H7962 NADC 2045 Scott A Control 86.33 ± 6.01 ^a 90.63 ± 5.50 ^a 94.69 ± 1.65 ^a OT 69.76 ± 4.71 ^b.c. 72.06 ± 6.52 ^d 82.18 ± 3.01 ^d OTBM 73.39 ± 6.42 ^b 80.52 ± 8.78 ^b.c. 88.39 ± 7.24 ^B.C. OTFV 75.69 ± 7.89 ^b 72.89 ± 7.04 ^d 85.56 ± 4.52 ^cd OTNT 75.08 ± 5.72 ^b 76.52 ± 3.34 ^cd 87.42 ± 4.29 ^B.C. OTPP 65.75 ± 8.11 ^c.d. 84.80 ± 7.42 ^ab 91.32 ± 3.26 ^ab OTPM 61.05 ± 7.89 ^d 74.80 ± 4.61 ^cd 89.84 ± 3.73 ^b

In Table 3, all values are expressed as mean ± standard error. Different letters indicate significant differences between samples (p < 0.05).

Effect of ovotransferrin hydrolyzate on EPS production ability of Listeria motocytogenes

EPS is a major component of the extracellular polymer material surrounding bacterial biofilms, and plays an important role in biofilm formation activity by contributing to the structural stability and nutrient circulation of biofilms. Ovotransferrin, OTBM, OTFV. EPS production was significantly reduced in Listeria monocytogenes strains treated with OTNT and OTPP (Figure 4) (p < 0.05). In particular, OTPP (500 μg/mL) reduced EPS production by 24.85%, 27.96%, and 54.51% compared to the control group in ATCC 15313, H7962, and NADC Scott A, respectively. The effect of ovotransferrin and ovotransferrin hydrolyzate on EPS production shows a correlation with their inhibitory effect on early stage biofilm formation (Figure 2), indicating that EPS production is critical for Listeria monocytogenes biofilm formation. there is. Reduction of EPS content in extracellular polymeric substances can loosen the biofilm structure, making bacterial cells within the biofilm more easily exposed to antibacterial agents.

Effect of ovotransferrin hydrolyzate on the metabolic activity of Listeria monocytogenes

Unlike the crystal violet assay, which can measure attached biomass, which includes both viable and non-viable cells within a biofilm, the MTT assay indicates the metabolic state of attached viable cells. The tetrazolium dye MTT is reduced to insoluble purple formazan crystals by succinate dehydrogenase present in metabolically active cells. In all Listeria monocytogenes strains, ovotransferrin did not affect the metabolic activity of the bacteria (Figure 5) (p < 0.05). In NADC Scott A, only OTPP reduced the metabolic activity of bacteria, and in ATCC 15313 and H7962 strains, not only OTPP but also OTBM and OTFV showed metabolic activity inhibition effects. In particular, OTPP significantly inhibited metabolic activity by 27.84%, 57.85%, and 65.71% in ATCC 15313, H7962, and NADC Scott A, respectively, compared to the control group.

Effect of ovotransferrin hydrolyzate on mRNA expression in Listeria monocytogenes

As can be seen from the above results, among ovotransferrin hydrolysates, OTPP had the highest antibiofilm effect against Listeria monocytogenes. Therefore, only the effects of ovotransferrin and OTPP on biofilm-related genes were analyzed using qRT-PCR. The expression of genes related to intracellular movement ( actA ), quorum sensing ( agrD ), cell wall ( dltB ), flagellum ( flaA, flgE ), and virulence regulation ( prfA ) of H7962 was evaluated, and 16s rRNA was designated as the reference gene ( Figure 6). Compared to the control group, OTPP (500 μg/mL) reduced the transcription level of all virulence genes.

actA is important for biofilm formation and bacterial aggregation ability, and induces actin polymerization to enhance intracellular motility and intercellular diffusion. Quorum sensing is a bacterial communication system to promote biofilm development by regulating gene expression when cell numbers reach a density threshold . dltB encodes lipoteichoic acid D-alanyltransferase, which regulates the cell wall of Gram-positive bacteria through lipoteichoic acid biosynthesis. flaA and flgE are flagellum-related genes, and OTPP may have suppressed the flagellum-dependent swimming motility of Listeria monocytogenes. prfA activates the transcription of listeriolysin O, a major virulence factor of Listeria monocytogenes. Therefore, OTPP has the ability to reduce biofilm formation against Listeria monocytogenes by regulating intracellular movement, quorum sensing, cell wall synthesis, flagellum production, and virulence factors.

Analysis of the effect of ovotransferrin hydrolyzate on biofilm formation of Listeria monocytogenes using field-emission scanning electron microscopy

The effect of ovotransferrin and OTPP on biofilm formation on glass coupons of Listeria monocytogenes was analyzed by FE-SEM (FIG. 7). Listeria monocytogenes in the control group was observed as aggregated bacilli in a dense biofilm layer. However, ovotransferrin and OTPP significantly reduced the number of cells attached to the glass coupon, which was similar to previous results; Biofilm formation (Figures 2 and 3), fungal surface hydrophobicity (Table 2), self-aggregation ability (Table 3), EPS production (Figure 4), metabolic activity (Figure 5), and virulence gene expression (Figure 6). Due to the property of ovotransferrin not being completely soluble, SEM images of Listeria monocytogenes treated with ovotransferrin could not be clearly observed.

Claims (13)

A composition for inhibiting biofilm, comprising a hydrolyzate of ovotransferrin as an active ingredient.
According to paragraph 1,
A composition, characterized in that the biofilm is formed by Listeria monocytogenes.
According to paragraph 1,
A composition, characterized in that the hydrolyzate is hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.
According to paragraph 1,
A composition comprising the hydrolyzate of ovotransferrin at a concentration of 1 to 10 ⁵ μg/mL.
An antibacterial composition comprising a hydrolyzate of ovotransferrin as an active ingredient.
According to clause 5,
A composition, characterized in that the hydrolyzate is hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.
According to clause 5,
A composition comprising the hydrolyzate of ovotransferrin at a concentration of 1 to 10 ⁵ μg/mL.
A composition for food comprising a hydrolyzate of ovotransferrin as an active ingredient.
According to clause 8,
A composition, characterized in that the hydrolyzate is hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.
According to clause 8,
A composition comprising the hydrolyzate of ovotransferrin at a concentration of 1 to 10 ⁵ μg/mL.
A pharmaceutical composition for preventing or treating listerosis, comprising a hydrolyzate of ovotransferrin as an active ingredient.
According to clause 11,
A composition, characterized in that the hydrolyzate is hydrolyzed with one or more proteolytic enzymes selected from the group consisting of papain, blomelain, and flabozyme.
According to clause 11,
A composition comprising the hydrolyzate of ovotransferrin at a concentration of 1 to 10 ⁵ μg/mL.