KR20240032246A - Immune enhancing composition containing phosvitin phosphopeptide and method for preparing the same - Google Patents

Abstract

The present invention relates to an immune-boosting composition containing phosvitin phosphopeptide and a method for producing the same. It is possible to effectively produce phosphopeptides, and the phosphopeptides have excellent immune-enhancing activity, so they have the advantage of being used as functional materials for enhancing immunity in the pharmaceutical and food fields.

Description

Immune enhancing composition containing phosvitin phosphopeptide and method for preparing the same {Immune enhancing composition containing phosvitin phosphopeptide and method for preparing the same}

The present invention relates to an immune-boosting composition containing phosvitin phosphopeptide (PPP) and a method for producing the same, and more specifically, to a HTMP (high-temperature and mild-pressure) pretreatment step and a proteolytic enzyme. Method for producing phosvitin phosphopeptide (PPP) through an addition step, pharmaceutical composition for enhancing immunity and health functional food composition for enhancing immunity containing phosvitin phosphopeptide prepared by the above method will be.

The immune response is the body's defense system against infections from the external environment. Therefore, the process of activating the immune response to protect the body is very important. Immunity can be classified into innate immunity and acquired immunity. Innate immunity is characterized by non-specific defense and is related to macrophages and white blood cells. Macrophages are distributed throughout all tissues in the body, and activated macrophages produce reactive oxygen species and inflammatory cytokines (e.g., interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF) to protect the body from infection. -α) etc. are secreted. Immune activity is regulated by the interaction between the cell surface receptors of macrophages (particularly Toll-like receptor; TLR), bacterial lipopolysaccharide (LPS), and various stimulants. When the receptor is stimulated, the cell signaling pathway is activated and secretion of inflammatory cytokines is induced. Major cell signaling pathways include the nuclear factor (NF)-κB signaling pathway and the mitogen-activated protein kinase (MAPK) signaling pathway.

Meanwhile, eggs are a commonly consumed food on a daily basis and are known as a complete food that contains many nutrients such as carbohydrates, proteins, lipids, and minerals. Additionally, eggs are an excellent source of protein containing essential amino acids. Phosvitin, one of the proteins present in egg yolk, accounts for about 8% of egg yolk proteins and is a phosphoprotein of about 36 kDa with a high phosphorus content. This is because serine residues, which account for about 50% of phosvitin amino acids, are bound to phosphorus. Phosvitin has been reported to have antibacterial, anticancer, and antioxidant activities. Accordingly, research is actively underway to utilize phosvitin as a functional food and pharmaceutical material.

Bioactive peptides obtained by hydrolysis from food proteins such as soybeans, milk, eggs, and fish have functional properties such as antioxidant activity, skin whitening, and anticancer activity, so interest in them is increasing. After the hydrolysis process, the functionality of the bioactive peptide can be improved over that of the parent protein, and this is influenced by the amino acid sequence and composition. A more functional hydrolyzate can be produced by using two or more different enzymes rather than using only one type of enzyme during hydrolysis. In particular, among bioactive peptides, phosphopeptides are attracting attention because of their characteristic structures and functions, and phosvitin can be used to produce the phosphopeptides. However, phosvitin has a problem in that it is difficult to enzymatically hydrolyze.

Accordingly, the present inventors made diligent efforts to effectively hydrolyze egg yolk-derived phosvitin to produce phosphopeptides and develop a technology to utilize them. As a result, HTMP (high-temperature and mild-pressure) pretreatment was performed before hydrolyzing phosvitin. It was confirmed that phosphopeptides can be effectively produced from phosvitin when a specific proteolytic enzyme is used, and the present invention was completed by confirming that the phosphopeptides had excellent immune-enhancing activity.

The purpose of the present invention is to provide a composition for enhancing immunity containing phosvitin phosphopeptide (PPP) and a method for producing the same.

In order to achieve the above object, the present invention provides a method for producing phosvitin phosphopeptide (PPP) comprising the following steps.

(a) preparing a solution containing phosvitin or a fragment thereof;

(b) pretreating the solution at a temperature of 80 to 200°C;

(c) hydrolyzing phosvitin by adding proteolytic enzyme to the pretreated solution; and

(d) adding proteolytic enzyme to the hydrolyzate to further hydrolyze it.

In the present invention, the phosvitin or its fragment may be separated from egg yolk.

In the present invention, step (b) may be characterized as pretreatment at a pressure of 1.0 to 5.0 atm.

In the present invention, the proteolytic enzyme in step (c) may be trypsin and/or multifect.

In the present invention, step (c) may further include the step of inactivating the proteolytic enzyme.

In the present invention, the proteolytic enzyme in step (d) may be trypsin and/or multifect.

In the present invention, step (d) may further include the step of inactivating the proteolytic enzyme.

The present invention also provides a pharmaceutical composition for enhancing immunity containing phosvitin phosphopeptide (PPP) prepared by the above method.

The present invention also provides a health functional food composition for immune enhancement containing phosvitin phosphopeptide (PPP) prepared by the above method.

Phosphopeptides can be effectively produced from phosvitin through HTMP (high-temperature and mild-pressure) pretreatment and proteolytic enzyme treatment of the present invention, and the phosphopeptides can be used in medicine and food fields. It can be used as a functional material to improve immunity.

Figure 1 relates to the cell survival rate of RAW 264.7 cell line according to treatment with phosvitin phosphopeptide.
Figure 2 relates to the effect of phosvitin phosphopeptide treatment on NO production in RAW 264.7 cell line.
Figure 3 relates to the effect of phosvitin phosphopeptide treatment on iNOS mRNA expression in RAW 264.7 cell line.
Figure 4 relates to the effect of phosvitin phosphopeptide treatment on TNF-α and IL-6 production in RAW 264.7 cell line.
Figure 5 relates to the effect of phosvitin phosphopeptide treatment on TNF-α and IL-6 mRNA expression in RAW 264.7 cell line.
Figure 6 relates to the effect of phosvitin phosphopeptide treatment on MAPK phosphorylation in the RAW 264.7 cell line.
Figure 7 relates to the effect of treatment with MAPK inhibitors on NO production in the RAW 264.7 cell line induced with phosvitin phosphopeptide.
Figure 8 relates to the effect of TLR4-IN-C34 and anti-TLR2 antibody treatment on NO production in RAW 264.7 cell line induced with phosvitin phosphopeptide.
In Figures 1 to 8, HTMP is HTMP pretreated phosvitin phosphopeptide, HTMP-M is HTMP pretreated and Multifect 14L enzyme treated phosvitin phosphopeptide, HTMP-T is HTMP pretreated and trypsin enzyme treated phosvitin phosphopeptide, HTMP- TM represents HTMP pretreatment and trypsin-Multifect 14L enzyme-treated phosvitin phosphopeptide, LPS represents lipopolysacchairde (10 ng/mL), GAPDH represents loading control, TLR2 represents anti-TLR2 antibody, and TLR4 represents TLR4-IN-C34.

Hereinafter, the invention will be described in detail.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

The present inventors confirmed that phosphopeptides can be effectively produced through HTMP (high-temperature and mild-pressure) pretreatment and proteolytic enzyme treatment of phosvitin derived from egg yolk, and the phosphopeptide The excellent immune-enhancing activity of the composition containing phopeptide was confirmed.

Specifically, the phosphopeptide increased the production of NO and cytokines (e.g., TNF-α, IL-6) as inflammatory response factors, and increased the production of iNOS, which regulates NO production, and mRNA involved in cytokine production. expression was increased. In addition, as a result of confirming the effect on the intracellular signaling pathway, it was confirmed that the function of macrophages is regulated through the TLR2-MAPK signaling pathway.

Accordingly, the present invention relates to a method for producing phosvitin phosphopeptide (PPP), which consistently includes the following steps.

(a) preparing a solution containing phosvitin or a fragment thereof;

(b) pretreating the solution at a temperature of 80 to 200°C, preferably 100 to 150°C, more preferably 110 to 130°C;

(c) hydrolyzing phosvitin by adding proteolytic enzyme to the pretreated solution; and

(d) adding proteolytic enzyme to the hydrolyzate to further hydrolyze it.

In the present invention, the phosvitin or its fragment may be separated from egg yolk, but is not limited thereto.

In the present invention, step (b) may be characterized as pretreatment at a pressure of 1.0 to 5.0 atm, preferably 1.2 to 2.5 atm, and more preferably 1.2 to 2 atm.

In the present invention, the proteolytic enzyme in step (c) may be trypsin and/or multifect, but is not limited thereto.

In the present invention, step (c) may further include the step of inactivating the proteolytic enzyme, but is not limited thereto.

In the present invention, the proteolytic enzyme in step (d) may be trypsin and/or multifect, but is not limited thereto.

In the present invention, step (d) may further include the step of inactivating the proteolytic enzyme, but is not limited thereto.

From another aspect, the present invention relates to a pharmaceutical composition for enhancing immunity containing phosvitin phosphopeptide (PPP) prepared by the above method.

From another aspect, the present invention relates to a health functional food composition for immune enhancement containing phosvitin phosphopeptide (PPP) prepared by the above method.

In the present invention, the term “pharmaceutical composition” refers to a mixture containing the phosvitin phosphopeptide (PPP) of the present invention and pharmaceutically acceptable excipients such as diluents or carriers. Pharmaceutical compositions include cosmetic compositions as well as compositions for therapeutic use. According to some embodiments, a method of administering a pharmaceutical composition comprising the composition of the present invention to a subject as needed is provided. In some embodiments, compositions of the present invention can be administered to humans.

In the present invention, the description of pharmaceutical compositions principally relates to pharmaceutical compositions for administration to humans, but those skilled in the art will understand that such compositions are generally suitable for administration to all types of animals. A skilled veterinary pharmacologist with a good understanding of the modifications of pharmaceutical compositions for administration to various animals can design and/or perform such modifications, if necessary, simply by routine experimentation.

In the present invention, the pharmaceutical composition may be prepared by any method known in the field of pharmacology or discussed later in the text. Generally, these methods for tableting involve the steps of associating the active ingredient with excipients and/or one or more other auxiliary ingredients, followed by shaping and/or packaging the product into the desired single- or multi-dose units, if necessary or desired. Includes steps.

In the present invention, the pharmaceutical composition may be manufactured, packaged, and/or sold unpackaged as a single unit dose and/or multiple single unit doses. “Unit dose” is a discrete amount of pharmaceutical composition containing a predetermined amount of active ingredient. The amount of active ingredient is generally equal to the dosage of active ingredient administered to the subject and/or a convenient fraction of such dosage such as, for example, one-half or one-third of the dosage.

In the present invention, the relative amounts of the active ingredient, pharmaceutically acceptable excipients, and/or any additional ingredients in the pharmaceutical composition may vary depending on the identity, size, and/or disorder of the subject being treated and the route by which the composition is administered. It will change. By way of example, the composition may include 0.1% to 100% (w/w) active ingredient.

For the purposes of the present invention, pharmaceutically acceptable excipients include any solvent, dispersion medium, diluent, or other liquid vehicle, dispersion or suspension aid, surface active agent, isotonic agent, thickener or emulsifier, preservative, or solid that is suitable for the purpose of the particular dosage form. Includes binders, lubricants, etc. Remington's (The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, (Lippincott, Williams & Wilkins, Baltimore, MD, 2006) describes various excipients used in the preparation of pharmaceutical compositions and known methods for their preparation. The technology is disclosed, except that any conventional carrier medium is incompatible with the substance or derivative thereof, for example by providing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition. and their uses are considered to be within the scope of the present invention. Pharmaceutically acceptable excipients are at least 95%, 96%, 97%, 98%, 99%, or 100% pure.

The excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

In some embodiments, excipients are approved for human and veterinary use. In some embodiments, the excipient is approved by the Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia, and/or International Pharmacopoeia (EP).

Pharmaceutically acceptable excipients used in the preparation of pharmaceutical compositions include, but are not limited to, inert diluents, dispersants and/or granulating agents, surface active agents and/or emulsifiers, disintegrants, binders, preservatives, buffers, lubricants, and/or oils. Not limited.

Such excipients may optionally be included in the formulations of the present invention. Excipients such as cocoa butter and suppository waxes, colorants, coating agents, sweeteners, flavors, and perfumers may be present in the composition at the discretion of the formulator.

Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dried starch, Including, but not limited to, corn starch, powdered sugar, and combinations thereof.

Exemplary granulating and/or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clay, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose and wood products, natural sponges, cation-exchange resins. , Calcium Carbonate, Silicate, Sodium Carbonate, Cross-Linked Poly(vinyl-pyrrolidone) (Crospovidone), Sodium Carboxymethyl Starch (Sodium Starch Glycolate), Carboxymethyl Cellulose, Cross-Linked Sodium Carboxymethyl Cellulose ( croscarmellose), methylcellulose, pregelatinized starch (Starch 1500), microcrystalline starch, water-insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (vegeum), sodium lauryl sulfate, quaternary ammonium compounds, and these. Including, but not limited to, combinations of.

Exemplary surface active agents and/or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g. bentonite [aluminum silicate] and veegum [magnesium aluminum silicate]), long-chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol) , triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymers), carrageenans, cellulose derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxymethylcellulose) Ethylene Sorbitan Monolaurate [Tween 20], Polyoxyethylene Sorbitan [Tween 60], Polyoxyethylene Sorbitan Monooleate [Tween 80], Sorbitan Monopalmitate [Span 40], Sorbitan Monostearate [ span 60], sorbitan tristearate [span 65], glyceryl monooleate, sorbitan monooleate [span 80]), polyoxyethylene ester (e.g. polyoxyethylene monostearate [mirz 45]) , polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. cremophor), polyoxyethylene ethers, ( For example, polyoxyethylene lauryl ether [Brise 30]), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl. Including, but not limited to, lauray, sodium lauryl sulfate, pluronic F 68, poloxamer 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and/or combinations thereof. No.

Exemplary binders include starches (e.g. corn starch and starch paste); gelatin; sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol); Natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, Farnwer gum, Shatty gum, Isapol Husk's slime, carboxymethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropyl) cellulose, hydroxypropyl methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (bigum), and lachi arabogalactan); alginate; polyethylene oxide; polyethylene glycol; inorganic calcium salt; silicic acid; polymethacrylate; wax; water; Alcohol; and combinations thereof.

Exemplary preservatives may include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. Exemplary antioxidants include alpha tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, bisulfite. Including, but not limited to, sodium sulfate, sodium metabisulfite, and sodium sulfite. Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, disodium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and trisodium edetate. . Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, Includes, but is not limited to, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal. Exemplary antifungal preservatives include, but are not limited to, butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid. Exemplary alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol. Exemplary acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid. Other preservatives include tocopherol, tocopherol acetate, deteroxyme mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluende (BHT), ethylenediamine, sodium lauryl sulfate (SLS), Sodium Lauryl Ether Sulfate (SLES), Sodium Bisulfite, Sodium Metabisulfite, Potassium Sulfite, Potassium Metabisulfite, Glydant Plus, Fenonib, Methylparaben, Low Mol 115, Germaben II, Neolon, Katon, and E Including, but not limited to, Uxil. In certain embodiments, the preservative is an antioxidant. In another embodiment, the preservative is a chelating agent.

Exemplary buffering agents include citrate buffer solution, acetate buffer solution, phosphate buffer solution, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium gluvionate, calcium gluceptate, calcium gluconate, D-gluconic acid, glyceroside. Calcium phosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dibasic potassium phosphate, monobasic Basic potassium phosphate, potassium phosphate mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixture, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen -Includes, but is not limited to, free water, isotonic saline, Ringer's solution, ethyl alcohol, and combinations thereof.

Exemplary lubricants include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium. Including, but not limited to, lauryl sulfate, and combinations thereof.

Exemplary oils include almond, apricot kernel, avocado, babassu palm, bergamot, black currant seed, borage, cayenne, chamomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee. , corn, cotton seed, emu, eucalyptus, evening primrose, fish, flax seed, geraniol, pumpkin, grape seed, hazelnut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litthea cucumber. beba, macadamia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange-orange rappi, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower. , sandalwood, sasquana, savory, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oil. Exemplary oils include butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil. , and combinations thereof.

Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active ingredient, liquid dosage forms may contain inert diluents such as, for example, water or other solvents, solubilizers and emulsifiers commonly used in the art such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl. Alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, sprout, olive, castor, and sesame oil), glycerol, tetrahydrofurfuryl alcohol, It may also include polyethylene glycol and fatty acid esters of sorbitan, and mixtures thereof. In addition to inert diluents, oral compositions may include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In certain embodiments for parenteral administration, the phosvitin phosphopeptide (PPP) of the present invention may be dissolved in a solubilizing agent such as cremophor, alcohol, oil, denatured oil, glycol, polysorbate, cyclodextrin, polymer, and combinations thereof.

Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active ingredient may be combined with one or more inert pharmaceutically acceptable excipients or carriers such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol, and silicic acid, b ) binders such as, for example, carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrants such as agar, calcium carbonate, potato or tapioca starch. , alginic acid, certain silicates, and sodium carbonate, e) dissolution retarders such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) humectants such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof.

In the case of capsules, tablets and pills, dosage forms may contain buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using lactose or milk sugar as well as high molecular weight polyethylene glycols and the like as such excipients. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may optionally contain opacifying agents and may be compositions that release the active ingredient only, or preferentially, in a specific part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using lactose or milk sugar as well as high molecular weight polyethylene glycols and the like as such excipients.

The active ingredient may be in micro-encapsulated form with one or more of the excipients described above. Solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, controlled release coatings, and other coatings well known in the pharmaceutical formulation art. In these solid dosage forms the active ingredient may be mixed with one or more inert diluents such as sucrose, lactose or starch. These dosage forms may contain additional substances other than inert diluents as in common practice, such as tablet lubricants and other tablet auxiliaries such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, dosage forms may also contain buffering agents. They may optionally contain opacifying agents and may be compositions that release the active ingredient only, or preferentially, in a specific part of the intestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

In the present invention, dosage forms for topical and/or transdermal administration of phosvitin phosphopeptide (PPP) include ointment, paste, cream, lotion, gel, powder, solution, spray, inhalant and/or patch. It may also include . Generally, the active ingredient is admixed under conditions of sterility with a pharmaceutically acceptable carrier and/or any necessary preservatives and/or buffering agents that may be required. Additionally, the present invention contemplates the use of transdermal patches, which often have the additional advantage of providing controlled delivery of the active ingredient to the body. Such dosage forms can be prepared, for example, by dissolving and/or dispersing the active ingredient in a suitable medium. Alternatively or additionally, the rate may be controlled by providing a rate controlling membrane and/or dispersing the active ingredient in a polymer matrix and/or gel.

Formulations for topical administration include, but are not limited to, liquid and/or semi-liquid preparations such as liniments, lotions, oil-in-water and/or water-in-oil emulsions such as creams, ointments/or pastes, and/or solutions and/or suspensions. Although the concentration of the active ingredient may be as high as the solubility limit of the active ingredient in the solvent, topically-administrable formulations may also comprise, for example, from about 1% to about 10% (w/w) of the active ingredient. Formulations for topical administration may further comprise one or more additional ingredients described herein.

In the present invention, phosvitin phosphopeptide (PPP) is typically prepared in dosage unit form for easy administration and uniform administration. However, it will be understood that the total daily dosage of the composition of the present invention will be determined by the attending physician within the scope of sound medical judgment. The particular therapeutically effective dose level for any particular subject will depend on a variety of factors, including the disease, disorder, or disorder being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; The subject's age, weight, general health, gender, and diet; the time of administration, route of administration, and rate of excretion of the particular active ingredient employed; duration of treatment; Drugs used in combination or simultaneously with the specific active ingredients employed; and factors well known in the medical field.

The pharmaceutical composition containing phosvitin phosphopeptide (PPP) of the present invention may be administered by any route. In some embodiments, the pharmaceutical composition comprising phosvitin phosphopeptide (PPP) can be administered orally, intravenously, intramuscularly, intraarterially, intramedullarily, intrathecally, subcutaneously, intracerebroventricularly, transdermally, intradermally, or rectally. , intravaginally, intraperitoneally, topically (by powder, ointment, cream, and/or drop), mucosal, nasal, oral, enteral, sublingual; endotracheal instillation, bronchial instillation, and/or inhalation; and/or administered by various routes, including oral spray, nasal spray, and/or aerosol. Particularly contemplated routes are permeable intravenous injection, local administration via the blood and/or lymphatic supply, and/or direct administration to the affected area. In general, the most appropriate route of administration will depend on a variety of factors, including the properties of the agent (e.g., stability in the environment of the gastrointestinal tract), and the disorder of the subject (e.g., whether the subject can tolerate oral administration). will be. Currently, oral and/or nasal spray and/or aerosol routes are most commonly used to deliver therapeutic agents directly to the lungs and/or respiratory system. However, the present invention encompasses the delivery of the pharmaceutical composition according to the invention by any suitable route taking into account advances in the field of drug delivery.

In certain embodiments, the pharmaceutical composition comprising phosvitin phosphopeptide (PPP) of the present invention can be administered in an amount of about 0.001 mg/kg to about 100 mg/kg, or about 0.01 mg/kg to about 50 mg/kg, of the subject's body weight daily. mg/kg, about 0.1 mg/kg to about 40 mg/kg, about 0.5 mg/kg to about 30 mg/kg, about 0.01 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 10 mg/kg kg, or about 1 mg/kg to about 25 mg/kg, may be administered at a dosage level sufficient to deliver once or more per day to achieve the desired therapeutic effect. The intended dosage may be delivered three times a day, twice a day, daily, every two days, every three days, weekly, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered via multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more administrations). .

In the present invention, it will be understood that the dosage ranges provide guidance for administration of the provided pharmaceutical composition to adults. For example, the amount administered to a child or adolescent may be determined by a physician or person skilled in the art, and may be less or the same as that administered to an adult. The exact amount of a peptide according to the invention required to achieve an effective amount will vary from subject to subject, depending, for example, on the subject's species, age, and overall disorder, severity of side effects or disorders, identity of the specific compound, mode of administration, etc.

It will be understood that the pharmaceutical composition containing phosvitin phosphopeptide (PPP) in the present invention can be used in combination therapy. The particular combination of treatments (treatments or procedures) for use in combination therapy will take into account the desired therapeutic effect to be achieved and the suitability of the desired treatments and/or procedures.

The pharmaceutical compositions of the invention may be administered alone or in combination with one or more therapeutically active agents. As for "combination", it is not intended to imply that the agents must be administered at the same time and/or be formulated for delivery together, although the following delivery methods are within the scope of the present invention. The composition may be administered concurrently with, prior to, or subsequent to one or more other therapeutic agents or medical procedures. Generally, each agent will be administered at a dose and/or time schedule established for that agent. Additionally, the present invention provides a pharmaceutical form of the present invention in combination with agents capable of improving its bioavailability, reducing and/or modifying its metabolism, inhibiting its secretion, and/or modifying its distribution within the body. It encompasses delivering the composition. It will be further understood that the phosvitin phosphopeptide (PPP) of the invention and the therapeutically active agent used in this combination may be administered together in a single composition or administered separately in different compositions.

The particular combination used in combination therapy will take into account the desired therapeutic effect to be achieved and/or the suitability of the procedure and/or therapeutic active agent comprising the phosvitin phosphopeptide (PPP) of the invention. The combination used may achieve the desired effect for the same disorder (e.g., phosvitin phosphopeptide (PPP) may be administered in combination with another therapeutically active agent used to treat the same disorder). It will be understood that they may achieve different effects (e.g., control of any side effects), and/or they may achieve different effects (e.g., control of any side effects).

As used herein, "therapeutically active agent" refers to any substance used as a medicine to treat, prevent, delay, reduce or ameliorate a disorder, and refers to substances used in treatment, including prophylactic and curative treatments. .

In some embodiments, the pharmaceutical compositions of the invention may be administered in combination with any therapeutically active agent or procedure useful for enhancing immunity (e.g., surgery, radiation therapy).

In the present invention, health functional foods can be manufactured in various forms according to conventional methods known in the art. Health functional foods are not limited to this, but for example, phosvitin phosphopeptide (PPP) of the present invention is manufactured in the form of tea, juice, and drinks and liquefied and granulated so that it can be consumed (health beverage). , can be consumed by encapsulation and powder. In addition, nutritional supplements are not limited to this, but can be prepared by adding phosvitin phosphopeptide (PPP) of the present invention to capsules, tablets, pills, etc. Additionally, in order to use the phosvitin phosphopeptide (PPP) of the present invention in the form of a food additive, it can be prepared and used in the form of powder or concentrate. In addition, the phosvitin phosphopeptide (PPP) of the present invention can be mixed with a known active ingredient known to have an immune-enhancing effect to prepare a composition.

In the present invention, when phosvitin phosphopeptide (PPP) is used as a health drink, the health drink composition may contain various flavoring agents or natural carbohydrates as additional ingredients like a normal drink. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; polysaccharides such as dextrins and cyclodextrins; It may be a sugar alcohol such as xylitol, sorbitol, or erythritol. Sweeteners include natural sweeteners such as thaumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.

In the present invention, phosvitin phosphopeptide (PPP) may be contained as an active ingredient in an immune-enhancing food composition, and the amount is not particularly limited to an amount effective to achieve an immune-enhancing effect, but the total It is preferably 0.01 to 100% by weight based on the total weight of the composition.

In the present invention, the composition for health functional food can be prepared by mixing phosvitin phosphopeptide (PPP) with other active ingredients known to have an immune-boosting effect.

In the present invention, in addition to the above, the food of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, and stabilizers. It may contain topicals, preservatives, glycerin, alcohol, or carbonating agents. Additionally, the food of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverage, or vegetable beverage. These ingredients can be used independently or in combination.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it is obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

[Example]

Experimental materials and methods

(Example 1-1) Method for producing phosvitin phosphopeptide

Phosvitin was added to distilled water and stirred to prepare an aqueous phosvitin solution. Afterwards, the phosvitin aqueous solution was subjected to HTMP (high-temperature and mild-pressure) pretreatment reaction for 60 minutes at a pressure of 1.5 atm and a temperature of 121°C using a high-pressure steam sterilizer. Trypsin or Multifect 14L protease was added at a ratio of 2% to the phosvitin aqueous solution that had undergone the HTMP pretreatment process, and hydrolysis was performed for 6 hours. In the second hydrolysis process, the first proteolytic enzyme was inactivated, and then the second proteolytic enzyme was added and the reaction proceeded for an additional 6 hours. To inactivate the enzyme, the hydrolysis reaction was terminated by heating in boiling water for 10 minutes, and lyophilization was performed to prepare phosvitin phosphopeptide.

(Example 1-2) Cell line culture and method for measuring the effect of phosvitin phosphopeptide on cell viability

The RAW 264.7 cell line is a cell line derived from mouse macrophages and was purchased from the Korea Cell Line Bank. 10% FBS (Hyclone) and 1% penicillin-streptomycin (Hyclone) were added to DMEM medium (Hyclone, Logan, UT, USA). Cultured in a CO ₂ incubator (37°C, 5% CO 2 ). To measure the effect of phosvitin phosphopeptide on cell viability, RAW 264.7 cell line was distributed at 2 × 10 ⁵ cells/well in a 96 well plate, and after 4 hours, phosvitin phosphopeptide (125, 250, 500, 1000 μg/mL) and cultured for 24 hours. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich, St. Louis, MO, USA) solution (2 mg/mL) dissolved in PBS buffer (Hyclone). 20 μL was added to each well, and after 2 hours, the supernatant was removed, 200 μL of DMSO (dimethyl sulfoxide; Samchun, Seoul, Korea) was added, and the absorbance was measured at 570 nm. Cell survival rate was calculated using the following [Equation 1].

[Equation 1]

Cell viability (%) = (ODS/ODC) × 100

In Equation 1, ODS represents the absorbance of the well treated with the sample, and ODC represents the absorbance of the well without processing the sample.

(Example 1-3) Method for measuring the effect of phosvitin phosphopeptide on NO (Nitric oxide) production

The RAW 264.7 cell line was distributed in a 96 well plate at 2 × 10 ⁵ cells/well, and after 4 hours, it was treated with phosvitin phosphopeptide (125, 250, 500 μg/mL) and cultured for 24 hours. LPS (10 ng/mL; Sigma-Aldrich) was used as a positive control. The generated NO was reacted by mixing the culture supernatant and Griess reagent at a ratio of 1:1, and then the absorbance was measured at 540 nm with a microplate reader, and sodium nitrite (Sigma-Aldrich) was used as the standard material.

(Example 1-4) Method for measuring the effect of phosvitin phosphopeptide on pro-inflammatory cytokine production

The RAW 264.7 cell line was distributed in a 12-well plate at 4 × 10 ⁵ cells/well, and after 24 hours, it was treated with phosvitin phosphopeptide (125, 250, 500 μg/mL) and cultured for an additional 24 hours. After culturing, TNF-α and IL-6 produced from the supernatant were quantified using an ELISA (enzyme-linked immunosorbent assay) kit (AB frontier, Seoul, Korea).

(Example 1-5) Method for measuring the effect of phosvitin phosphopeptide on intracellular mRNA expression

The RAW 264.7 cell line was distributed in a 6-well plate at 1 × 10 ⁶ cells/well, and after 24 hours, it was treated with phosvitin phosphopeptide (125, 250, 500 μg/mL) and cultured for an additional 24 hours. To isolate total RNA from cells, an RNA isolation kit (QIAGEN, Hilden, Germany) was used, which was converted into cDNA, and then qRT-PCR was performed with primers for iNOS, TNF-α, and IL-6. . Amplification results were calculated using the delta-delta Ct method. β-actin was used as a housekeeping gene, and the primers used for PCR are listed in Table 1.

Primer sequences used for PCR Primer name Primer sequence (5'→3') iNOS sense CCCTTCCGAAGTTTCTGGCAGC iNOS anti-sense GGCTGTCAGAGCCTCGTGGCTTTGG TNF-α sense TTGACCTCAGCGCTGAGTTG TNF-αanti-sense CCTGTAGCCCACGTCGTAGC IL-6sense GTACTCCAGAAGACCAGAGG IL-6anti-sense TGCTGGTGACAACCACGGCC β-actin sense GTGGGCGCCCTAGGCACCAG β-actin anti-sense GGAGGAAGAGGATGGCGGCAGT

(Example 1-6) Method for measuring the effect of phosvitin phosphopeptide on phosphorylation of MAPK

The RAW 264.7 cell line was distributed in a 6-well plate at 3 × 10 ⁶ cells/well, cultured for 24 hours, and then treated with phosvitin phosphopeptide (125, 250, 500 μg/mL) and cultured for 30 minutes. After collecting the cultured cells, RIPA buffer (Thermo Fisher Scientific, Waltham, MA, US) was added to lyse the cells, and centrifuged at 14000 xg for 30 minutes to obtain the supernatant. After measuring the concentration of the separated proteins, equal amounts of 25 μg of each protein were electrophoresed on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and transferred onto a polyvinylidene difluoride (PVDF) membrane. To prevent non-specific binding of the antibody, 5% skim milk (Difco Laboratories, Detroit, MI, USA) was added to the membrane and reacted with the primary antibody. Washed with TBST, reacted with each secondary antibody, and then washed with TBST. Expression of each protein was confirmed using ECL reagent.

(Example 1-7) Method for measuring the effect of phosvitin phosphopeptide on intracellular signaling pathway

To analyze the intracellular signaling pathway induced by phosphovitin phosphopeptide, 40 μM SB202190 (p38), 20 μM SP600125 (JNK), and 40 μM PD98059 (ERK), which are selective inhibitors of MAPK (Abcam, Cambridge, UK), were used. used. The RAW 264.7 cell line was distributed in a ¹² well plate at 4 Cultured for additional time. Quantification of NO generated in the supernatant was performed using the method described above.

In addition, the RAW 264.7 cell line was distributed at 2 × 10 ⁵ cells/well in a 96 well plate, and after 4 hours, TLR4-IN-C34 (15 μΜ; Sigma-Aldrich) and anti-TLR2 antibody (15 μg/mL; eBioscience, San Diego, CA, USA) for 1 hour, then treated with phosvitin phosphopeptide (500 μg/mL) and cultured for 24 hours. Quantification of NO generated in the supernatant was performed using the method described above.

(Example 1-8) How statistics are processed

The experiment took the mean ± standard deviation value, and the statistical significance of the experimental results was determined using the Student's t-test method and one-way analysis of variance (one-way analysis of variance) using the SPSS software version 18 (SPSS Inc., Chicago, IL, USA) program. It was tested at the P<0.05 level using the ANOVA) method.

Results of analysis of the effect of phosvitin phosphopeptide on cell viability

The cell survival rate of the RAW 264.7 cell line was confirmed when treated with phosvitin phosphopeptide at different concentrations (Figure 1).

As a result, it was confirmed that among the phosphovitin phosphopeptides, HTMP, HTMP-M, and HTMP-TM had no effect on the survival of the RAW 264.7 cell line at concentrations up to 500 μg/mL, and HTMP-T was found to have no effect on the survival of the RAW 264.7 cell line at concentrations up to 500 μg/mL. The concentration showed an effect on the survival rate of the RAW 264.7 cell line (Figure 1).

Results of analysis of the effects of phosvitin phosphopeptide on NO production and iNOS mRNA expression

The amount of NO production in the RAW 264.7 cell line was confirmed as the phosvitin phosphopeptide was treated at different concentrations (Figure 2).

As a result, among phosphovitin phosphopeptides, HTMP-TM showed the highest effect in promoting NO production in macrophages, with concentrations of 20.09 μM and 28.43 at concentrations of 125 μg/mL, 250 μg/mL, and 500 μg/mL, respectively. Concentration-dependent NO production of μM and 32.65 μM was confirmed (Figure 2). On the other hand, the group treated with HTMP-T produced 0.18 μM, 3.25 μM, and 11.80 μM of NO, respectively, showing the lowest NO production effect (Figure 2). Future experiments were conducted using only phosvitin phosphopeptide HTMP-TM.

The iNOS mRNA expression level of RAW 264.7 cell line was confirmed upon treatment with phosvitin phosphopeptide (Figure 3).

As a result, it was confirmed that the iNOS mRNA expression level of the RAW 264.7 cell line increased in a concentration-dependent manner as the phosvitin phosphopeptide HTMP-TM was treated, as did NO production (Figure 3).

In the immune system, NO is one of the substances that acts as a defense against foreign substances, and plays a role in blood vessel relaxation in the circulatory system and nerve transmission in the central nervous system. NO is produced by nitric oxide synthase (NOS), and among NOS, iNOS is induced during immune responses to produce NO. In other words, it was confirmed that phosvitin phosphopeptide induces NO production by increasing the expression of iNOS mRNA in RAW 264.7 cell line.

Results of analysis of the effect of phosvitin phosphopeptide on cytokine production and mRNA expression

The production of pro-inflammatory cytokines TNF-α and IL-6 in the RAW 264.7 cell line upon treatment with phosvitin phosphopeptide was confirmed (Figure 4).

As a result, phosvitin phosphopeptide HTMP-TM had the effect of promoting cytokine production in the RAW 264.7 cell line, and upon treatment with 500 μg/mL of HTMP-TM, TNF-α and IL-6 decreased by 45.86, respectively, from the RAW 264.7 cell line. ng/mL, 10.66 ng/mL was produced (Figure 4).

Additionally, the effect of HTMP-TM on TNF-α and IL-6 mRNA expression in RAW 264.7 cell line was confirmed. As a result of the qRT-PCR experiment, it was confirmed that the mRNA expression levels of TNF-α and IL-6 increased in a concentration-dependent manner as the phosvitin phosphopeptide HTMP-TM was treated (Figure 5).

It is known that when macrophages are activated, they induce an immune response by producing various cytokines such as TNF-α, IL-1β, and IL-6. Among pro-inflammatory cytokines, TNF-α exerts a direct anticancer effect by inducing cell lysis of cancer cells, regulates the activity and growth of T lymphocytes, and induces the secretion of other cytokines. IL-6 is a cytokine with various functions involved in regulating immune responses. It enhances the synthesis of immunoglobulins and exhibits synergistic effects with other cytokines. In other words, it was confirmed that treatment with phosvitin phosphopeptide was effective in enhancing immunity by inducing the secretion of cytokines.

Results of analysis of the effect of phosvitin phosphopeptide on the intracellular signaling pathway

The MAPK signaling pathway, which includes proteins such as extracellular signal-regulated kinase (ERK), c-Jun NH2-termianl kinase (JNK), and p38 MAP kinase (p38), regulates the production of NO as well as TNF-α, IL in macrophages. It is a signal transduction pathway that plays an important role in the activation of macrophages by being involved in the production of cytokines such as -6. Accordingly, western blot was performed to investigate the mechanism of the immune-enhancing effect of phosvitin phosphopeptide HTMP-TM. As a result, phosphorylation of p38, ERK, and JNK increased upon HTMP-TM treatment (Figure 6).

In addition, in order to determine the effect on the intracellular signaling pathway of the RAW 264.7 cell line upon treatment with phosphovitin phosphopeptide, three types of selective inhibitors of MAPK and TLR4-IN-C34 and anti-TLR2 antibodies were used to determine the effect on the intracellular signaling pathway of the RAW 264.7 cell line. The effect on NO production was confirmed. As a result, it was confirmed that when the p38 inhibitor SB202190, the JNK inhibitor SP600125, and the ERK inhibitor PD98059 were treated together with HTMP-TM, the amount of NO production was reduced compared to the control group not treated with the inhibitor (Figure 7), when treated with anti-TLR2 antibody, it was confirmed that the amount of NO production decreased compared to the untreated control group (Figure 8). In other words, macrophage activation by phosvitin phosphopeptide is thought to occur through the TLR2-MAPK pathway.

Claims (9)

Method for producing phosvitin phosphopeptide (PPP) comprising the following steps:
(a) preparing a solution containing phosvitin or a fragment thereof;
(b) pretreating the solution at a temperature of 80 to 200°C;
(c) hydrolyzing phosvitin by adding proteolytic enzyme to the pretreated solution; and
(d) adding proteolytic enzyme to the hydrolyzate to further hydrolyze it.
According to paragraph 1,
The method, wherein the phosvitin or its fragment is separated from egg yolk.
According to paragraph 1,
The method (b) is characterized in that pretreatment is performed at a pressure of 1.0 to 5.0 atm.
According to paragraph 1,
In step (c), the proteolytic enzyme is trypsin and/or multifect.
According to paragraph 1,
The step (c) further comprises the step of inactivating the proteolytic enzyme.
According to paragraph 1,
In step (d), the proteolytic enzyme is trypsin and/or multifect.
According to paragraph 1,
The step (d) further comprises the step of inactivating the proteolytic enzyme. A pharmaceutical composition for enhancing immunity containing phosvitin phosphopeptide (PPP) prepared by the method of any one of claims 1 to 7.
A health functional food composition for immune enhancement containing phosvitin phosphopeptide (PPP) prepared by the method of any one of claims 1 to 7.