KR20230163295A - System and method for increasing gene editing efficiency in algae using autolysin - Google Patents

Abstract

This relates to a system and method for increasing the gene editing efficiency of microalgae using autolysin. According to one aspect, the Cas protein into which autolysin and NLS are introduced significantly improves the gene editing efficiency, ultimately leading to gene correction. The efficiency of algae production can be increased.

Description

System and method for increasing gene editing efficiency in algae using autolysin}

This relates to a system and method for increasing the gene editing efficiency of microalgae using autolysin.

Algae are single-celled organisms that photosynthesize using carbon dioxide and water as raw materials. Because their cell division and growth cycles are much shorter than those of higher plants, they are useful high-value industrial materials such as anti-aging ingredients, health supplements, DHA, and cosmetic raw materials. It is a biological resource that can be used. Among them , Chlamydomonas reinhardtii has been the most studied as a model species in microalgae research, and its genome project has now been completed and is easily used for genetic manipulation and related genetic engineering research. In addition to academic research, various studies are underway for use in industrial fields.

Since its first development in 2013, CRISPR/Cas has developed rapidly and is widely used for various species, including human cells, livestock, insects, plant cells such as rice and wheat, and pathogens. This method uses the CRISPR immune system formed by bacteria to prevent invasion of foreign DNA using genetic scissors. In other words, when a base sequence fragment (CRISPR part) that searches for the base sequence of a specific gene is produced and paired with the Cas9 protein, the paired CRISPR system attaches to the target DNA base sequence and cuts it.

Meanwhile, microalgae are known to have significantly lower transformation and gene editing efficiencies than other biological organisms such as yeast. According to recent academic reports (Doron et al., 2016, Zhang et al., 2019, Kang et al., 2020), gene editing of microalgae was conducted using ribonucleoprotein (RNP) obtained by hybridizing Cas9 protein and sgRNA. There are limited reports of successful cases, but it shows very low efficiency. Accordingly, research is needed to increase the gene editing efficiency of microalgae.

One aspect includes treating algae with autolysin;

The present invention provides a method for editing genes in birds, comprising the step of editing genes by introducing CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system) into the autolysin-treated algae.

Another aspect is the CRISPR/Cas system for gene editing in algae, comprising a Cas protein, a polynucleotide encoding it; Nuclear Localization Sequence (NLS) VirD2, VirE2 or SV40 linked to the Cas protein, or a polynucleotide encoding the same; and a target nucleic acid and a hybridization guide sequence or a polynucleotide encoding the same, wherein the algae are treated with autolysin.

One aspect includes treating algae with autolysin;

Provided is a method for editing genes in birds, comprising the step of editing genes by introducing CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system) into the autolysin-treated algae.

In one embodiment, the algae may include microalgae. More specifically, the algae include Chlamydomonas reinhardtii , Anacystis nidulans , Ankistrodesmus sp., Biddulpha aurita , and Botryocco. Botryococcus braunii , Chaetoceros sp., Chlamydomonas applanata , Chlorella sp., Chlorella ellipsoidea , Chlorella emersonii , Chlorella Protothecoides, Chlorella pyrenoidosa, Chlorella sorokiniana , Chlorella vulgaris , Chlorella minutissima , Chlorococcu littorale , Cyclotella cryptica , Dunaliella bardawil , Dunaliella salina, Dunaliella tertiolecta , Dunaliella primolecta , Gymnodinum sp., Hymenomonas carterae , Isochrysis galbana , Isochrysis sp., Microcystis aeruginosa , Micromonas pusilla , Monodus subterraneous , Nanochloris sp., Nannochloropsis sp., Nannochloropsis atomus , Nanochloris Nannochloropsis salina , Navicula pelliculosa , Nitzschia sp., Nitzscia closterium, Nitzscia palea , Osistis polymorphia ( Oocystis polymorpha , Ourococcus sp., Oscillatoria rubescens, Pavlova lutheri, Phaeodactylum tricornutum , Pycnococcus provasolii ), Pyramimonas cordata , Spirulina platensis , Stephanodiscus minutulus , Stichococcus sp., Synedra ulna , ske. Scenedesmus obliquus , Selenastrum gracile , Skeletonoma costalum , Tetraselmis chui , Tetraselmis maculata , Tetraselmis sp., Tetraselmis suecica , Thalassiostra pseudomona , Anabaena sp., Calothrix sp., Camae Chiffon ( Chaemisiphon sp.), Chroococcidiopsis sp., Cyanothece sp., Cylindrospermum sp., Dermocarpella sp., Fischerella sp. ), Gloeocapsa sp., Myxosarcina sp., Nostoc sp., Oscillatoria sp., Phormidium corium , Pleurocapsa ( Pleurocapsa sp.), Prochlorococcus sp., Pseudanabaena sp., Synechococcus sp., Synechocystis sp., Tolypothrix sp. And it may be any one selected from the group consisting of Xenococcus sp.

In one embodiment, the autolysin may be obtained by mixing Chlamydomonas reinhardtii CC-620 and CC-621.

In one embodiment, the step of increasing the cell wall permeability of algae may be further included.

In one embodiment, the introduction of CRISPR/Cas includes a CRISPR protein or a polynucleotide encoding the same; and a guide polynucleotide comprising a guide sequence capable of hybridizing with a target nucleic acid; Alternatively, it may be introducing a polynucleotide encoding it.

In one embodiment, the introduction of CRISPR/Cas may be the introduction of a Cas protein-RNA RNP (ribonucleoprotein) in which the Cas protein and guide RNA are pre-combined.

In one embodiment, the CRISPR protein may be Cas9, Cas12, Cas13, or Cas14.

In one embodiment, the CRISPR protein may be a wild-type Cas protein or an engineered Cas protein expressed by engineering by adding one or more nucleotide sequences to the nucleotide encoding the wild-type Cas protein.

In one embodiment, the engineered and expressed Cas protein may further include a nuclear localization sequence (NLS) at the N or C terminus of the nucleotide encoding the Cas protein.

In one embodiment, the nuclear localization sequence (NLS) may be derived from Agrobacterium.

In one embodiment, the nuclear localization sequence (NLS) may be VirD2, VirE2, or SV40.

In one embodiment, the nuclear localization sequence (NLS) may be any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein.

In one embodiment, the nuclear localization sequence (NLS) may be any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein.

In one embodiment, a step of increasing the efficiency of nuclear localization of the wild-type Cas protein may be further included.

Another aspect is the CRISPR/Cas system for gene editing in algae, comprising a Cas protein, a polynucleotide encoding it; Nuclear Localization Sequence (NLS) VirD2, VirE2 or SV40 linked to the Cas protein, or a polynucleotide encoding the same; and a hybridization guide sequence with a target nucleic acid or a polynucleotide encoding the same, wherein the algae is treated with autolysin.

In one embodiment, the nuclear localization sequence (NLS) may be any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein.

In one embodiment, the nuclear localization sequence (NLS) may be any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein.

According to the Cas protein into which autolysin and NLS are introduced according to one aspect, gene editing efficiency is significantly improved and ultimately the efficiency of gene editing algae production can be increased.

Figure 1 is an image showing the occurrence of mating during mixed culture of Chlamydomonas reinhardtii strains according to one embodiment; Arrow: mating occurs
Figure 2 is an image confirming the extraction of autolysin according to one embodiment.
Figure 3 is an image showing the effect of increasing cell wall permeability of autolysin according to one embodiment.
Figure 4 is a graph showing the results of gene editing efficiency upon autolysin treatment according to one embodiment.
Figure 5 is a confocal microscope image of the nuclear localization effect of NLS fused to the N or C terminus of the fluorescent protein mCherry; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion DIC: Differential interference contrast channel.
Figure 6 is a schematic image showing a Cas 9 plasmid in which an NLS is fused to the N or C terminus of the Cas9 protein; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.
Figure 7 is a graph showing the number of colonies generated through transformation according to the type of Cas9 protein after autolysin treatment according to one embodiment; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.

One aspect includes treating algae with autolysin;

Provided is a method for editing genes in birds, comprising the step of editing genes by introducing CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system) into the autolysin-treated algae.

As used herein, “algae” includes “algae” or “micro algae.” As used herein, the term "algae" refers to Chlamydomonas reinhardtii , Anacystis nidulans , Ankistrodesmus sp., Biddulpha aurita , and Botri. Botryococcus braunii , Chaetoceros sp., Chlamydomonas applanata , Chlorella sp., Chlorella ellipsoidea , Chlorella emersonii , Chlorella protothecoides, Chlorella pyrenoidosa , Chlorella sorokiniana , Chlorella vulgaris , Chlorella minutissima , Chlorococcu littorale ), Cyclotella cryptica , Dunaliella bardawil , Dunaliella salina, Dunaliella tertiolecta , Dunaliella primolecta , Gymnodinum sp., Hymenomonas carterae , Isochrysis galbana , Isochrysis sp., Microcystis aeruginosa , Micromonas pusilla , Monodus subterraneous , Nanochloris sp., Nannochloropsis sp., Nannochloropsis atomus , Nano Chloropsis salina ( Nannochloropsis salina ), Navicula pelliculosa ( Navicula pelliculosa ), Nitzschia sp., Nitzscia closterium ( Nitzscia palea ), Osistis polymorphia ( Oocystis polymorpha ), Ourococcus sp., Oscillatoria rubescens, Pavlova lutheri, Phaeodactylum tricornutum , Pycnococcus provasoli ( Pycnococcus provasolii ), Pyramimonas cordata , Spirulina platensis , Stephanodiscus minutulus , Stichococcus sp., Synedra ulna , Scenedesmus obliquus , Selenastrum gracile , Skeletonoma costalum , Tetraselmis chui , Tetraselmis maculata , Tetraselmis sp., Tetraselmis suecica, Thalassiostra pseudomona , Anabaena sp., Calothrix sp., Cama Chaemisiphon sp., Chroococcidiopsis sp., Cyanothece sp., Cylindrospermum sp., Dermocarpella sp., Fischerella sp. .), Gloeocapsa sp., Myxosarcina sp., Nostoc sp., Oscillatoria sp., Phormidium corium , Pleuro Pleurocapsa sp., Prochlorococcus sp., Pseudanabaena sp., Synechococcus sp., Synechocystis sp., Tolypothrix sp. ) and Xenococcus ( Xenococcus sp.).

The autolysin is an enzyme that specifically decomposes the beta-1,4 glycosidic bond of peptidoglycan.

The autolysin is an endogenous lytic enzyme secreted during separation of daughter cells after cell division.

In one embodiment, the autolysin may be obtained by mixing Chlamydomonas reinhardtii CC-620 and CC-621.

In one embodiment, the introduction of CRISPR/Cas includes a CRISPR protein or a polynucleotide encoding the same; and a guide polynucleotide comprising a guide sequence capable of hybridizing with a target nucleic acid; Alternatively, it may be to introduce a polynucleotide encoding it.

The term “CRISPR/Cas system” or “CRISPR/Cas” used herein may refer to a gene editing system using a Cas protein (eg, Cas9) as an effector protein. The system is a complex containing a nucleic acid degrading enzyme such as a gene editing protein or endonuclease and a nucleic acid targeting molecule corresponding to the nucleic acid degrading enzyme, and binds to the target nucleic acid or target gene to transform the target nucleic acid or gene. This refers to a complex that can cut or edit the target region. At this time, the cleavage of the target region may be done by cutting the outer part of the target nucleic acid or 1 to 5 bp inside the 3' end of the target nucleic acid, thereby causing a double-strand break (DSB). The system can be of various types depending on the gene editing protein and the nucleic acid targeting molecule, which is a guide RNA (gRNA) corresponding to the protein. The function and efficiency of the gene editing protein may vary depending on the type of nucleic acid targeting molecule. . Gene editing proteins use nucleic acid targeting molecules to bind to a target nucleic acid or target gene and perform double-strand or single-strand cleavage or base correction of DNA at that site. Genome editing technology using a gene editing system can introduce mutations into the genes of various organisms such as humans, animals, and plants, and through this, research to reveal the function of genes, production of transformants with new traits, and gene-related It is used as a treatment method for diseases. The system does not require the creation of a customized protein to target a specific sequence, and a diverse repertoire of systems can be created by changing the spacer sequence, which is the target site binding sequence within the guide molecule. The CRISPR/Cas system herein may be an engineered or non-naturally occurring system.

As used herein, the term "guide RNA" generally refers to an RNA molecule (or collectively a group of RNA molecules) that can bind to a Cas protein and help target the Cas protein to a specific location within a target nucleic acid. can refer to. The guide RNA may be any polynucleotide sequence that has sufficient complementarity with the target gene sequence to hybridize with all or part of the sequence of the target nucleic acid and induce sequence-specific binding of the CRISPR complex to the target sequence.

As used herein, the term “target nucleic acid” refers to a target nucleic acid or a sequence present in a target gene, a sequence recognized by the guide RNA of the CRISPR/Cas system, or a target sequence modified by the CRISPR/Cas system. Specifically, The target nucleic acid refers to a sequence that is complementary to the guide sequence included in the guide RNA or a sequence that binds complementary to the guide sequence. “Target strand” refers to the strand containing the target sequence. If the target nucleic acid or target gene is single stranded, that strand may be the target strand. Alternatively, when the target nucleic acid or target gene is double stranded, one of the double strands may be the target strand, and a strand complementary to the target strand may exist. At this time, the strand complementary to the target strand is referred to as the “non-target strand.” The non-target strand includes a Protospacer Adjacent Motif (PAM) sequence and a protospacer sequence. The PAM sequence is a sequence recognized by the Cas protein of the CRISPR/Cas system. The protospacer sequence is a sequence located at the 5' end or 3' end of the PAM sequence. The protospacer sequence is a sequence that is complementary to the target sequence or a sequence that binds complementary to the target sequence. The correlation between the protospacer sequence and the target sequence is similar to the correlation between the target sequence and the guide sequence. Due to these characteristics, the guide sequence can generally be designed using a protospacer sequence. That is, when designing a guide sequence that binds complementary to the target sequence, the guide sequence can be designed as a nucleotide sequence having the same base sequence as the protospacer sequence. At this time, T in the nucleotide sequence of the protospacer sequence is replaced with U to design the guide sequence.

The guide sequence may be capable of hybridizing to a contiguous target sequence of 10 to 40 bp in length located adjacent to the 5' or 3' end of the PAM (proto-spacer-adjacent motif) sequence recognized by the Cas protein.

The target sequence may be a 10 to 40 nucleotide sequence. As an example, the target sequence may be a 15 to 20, 15 to 25, 15 to 30, 15 to 35, or 15 to 40 nucleotide sequence. Alternatively, the target sequence may be a 20 to 25, 20 to 30, 20 to 35 or 20 to 40 nucleotide sequence. Alternatively, the target sequence may be a 25 to 30, 25 to 35 or 25 to 40 nucleotide sequence. Alternatively, the target sequence may be a 30 to 35 or 30 to 40 nucleotide sequence. Alternatively, the target sequence may be a 35 to 40 nucleotide sequence. As another example, the target sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, It may be a sequence of 36, 37, 38, 39 or 40 nucleotides.

In one embodiment, the guide sequence is at least 70% to 75%, at least 70% to 80%, at least 70% to 85%, at least 70% to 90%, at least 70% to 95%, at least 70% of the target sequence. % to 100%, at least 75% to 80%, at least 75% to 85%, at least 75% to 90%, at least 75% to 95%, or at least 75% to 100% complementary sequences. or the guide sequence is at least 80% to 85%, at least 80% to 90%, at least 80% to 95%, at least 80% to 100%, at least 85% to 90%, at least 85% to 95% of the target sequence. Or it may be a sequence that is at least 85% to 100% complementary. Alternatively, the guide sequence may be a sequence that is at least 90% to 95%, at least 90% to 100%, or at least 95% to 100% complementary to the target sequence. or the guide sequence is at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, It may be 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementary sequence.

The term “Cas protein” used herein may be a wild type Cas protein that exists in nature. Alternatively, the Cas protein may be a variant of the wild-type Cas protein, and the Cas variant may be a variant having the same function as the wild-type Cas protein, a variant with some or all of the functions modified, and/or a variant with additional functions added. .

The Cas protein can recognize the Protospacer Adjacent Motif (PAM) sequence present in the target nucleic acid or target gene. At this time, the PAM sequence is a unique sequence determined by the Cas protein. PAM sequences for the Cas protein include T-rich sequences, AT-rich sequences, and G-rich sequences, such as 5'-TTTA-3', 5'-TTTG-3', 5'-TTTC-3', 5'-TTT-3', 5'-TTA-3', 5'-TTC-3', 5'-TTG-3', 5'-GGG-3', 5'-TGG-3', 5' -AGG-3', or 5'-CGG-3'. Alternatively, base G may be required at the Protospacer Flaking Site (PFS) instead of the PAM sequence.

The Cas protein may be a Cas variant. The Cas variant may be one in which at least one amino acid in the amino acid sequence of the wild-type Cas protein has been modified. At this time, the modification may be deletion and/or substitution. Alternatively, the Cas variant may have at least one amino acid sequence added to both ends and/or within the amino acid sequence of the wild-type Cas protein. At this time, the modification may be an insertion. At this time, the Cas variant is referred to as a “Cas mutant.”

The Cas mutant may be a variant having the same function as the wild-type Cas protein or a variant in which part or all of the function is modified. For example, the Cas mutation may be altered to cleave only one strand of the double strands of the target nucleic acid. Alternatively, the Cas mutation may be modified to recognize a PAM sequence other than 5'-TTTA-3' or 5'-TTTG-3'.

The Cas variant may be a wild-type Cas protein or a Cas mutant in which a domain, peptide, or protein with an additional function is added. At this time, the variant to which the domain, peptide or protein having the additional function is added is referred to as an “engineered and expressed Cas protein.” The domains, peptides or proteins having the additional functions can be added within the N-terminus, C-terminus and/or amino acid sequence of the wild-type Cas protein or Cas mutant. The domain, peptide, or protein having the additional function may be a domain, peptide, or protein having the same or different function as the wild-type Cas protein. For example, domains, peptides or proteins with the above additional functions include methylase activity, demethylase activity, transcription activation activity, transcription repression activity, and transcription release factor. It may be a domain, peptide, or protein with transcription release factor activity, histone modification activity, RNA cleavage activity, or nucleic acid binding activity, or separation and purification of proteins (including peptides). It may be a tag or reporter protein, but is not limited thereto. Alternatively, the domain, peptide or protein having the additional function may be a reverse transcriptase or deaminase.

The Cas variant may be a wild-type Cas protein, a Cas mutant, or an engineered Cas protein that selectively further contains a Nuclear Localization Sequence (NLS). The NLS is a signal peptide for determining the position of the Cas protein within the cell, contains all meanings that can be recognized by a person skilled in the art, and can be appropriately interpreted depending on the context. For example, the NLS is the NLS of SV40 virus large T-antigen; NLS from nucleoplasmin; c-myc NLS; hRNPA1 M9 NLS; Alternatively, it may be an NLS sequence derived from Agrobacterium, but is not limited thereto.

Additionally, the Cas variant may be a wild-type Cas protein, a Cas mutant, or an engineered Cas protein that optionally further contains a tag. The tag is a functional domain, peptide, or protein for separation, purification, and/or tracking of Cas protein, and the tag includes a histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, Tag proteins such as VSV-G tag and thioredoxin (Trx) tag; Fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), HcRED, and DsRed; and reporters such as glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, and luciferase. Includes, but is not limited to, proteins (enzymes).

In one embodiment, the engineered and expressed Cas protein may include one NLS at the N-terminus or/and C-terminus of the wild-type Cas protein, and six histidine (His) tags at the C-terminus. At this time, specifically, the NLS may be one selected from VirD2, VirE2, and SV40. Specifically, the engineered and expressed Cas protein is a Cas protein with VirD2 NLS fused to the N terminus (DN), a Cas protein with VirD2 NLS fused to the C terminus (DC), and a VirE2 NLS fused to the N terminus (EN). It may be a Cas protein, a Cas protein with a VirE2 NLS fused to the C terminus (EC), a Cas protein with an SV40 NLS fused to the N terminus (SN), or a Cas protein with an SV40 NLS fused to the C terminus (SC).

Specifically, the introduction of CRISPR/Cas involves introducing a vector containing DNA encoding the Cas protein and DNA encoding the guide RNA, or Cas protein-guide RNA RNP (ribonucleoprotein) in which the Cas protein and guide RNA are pre-assembled. A person skilled in the art may select an appropriate introduction method according to technical knowledge known in the art, including, but not limited to, introducing Cas RNA and guide RNA.

When introducing Cas protein and guide RNA into autolysin-pretreated algae using a plasmid vector, the vector is a chromosomal integration vector that can integrate an exogenous gene into the avian chromosome, or is used to temporarily express the exogenous gene. It may be a transient vector for transient expression that is induced (i.e., not integrated into the chromosome). More preferably, it may be a transient expression vector, and may be delivered to the cytoplasm of the algae by a conventional transformation method (e.g., gene gun, chemical delivery, injection, etc.). In the case of transient expression vectors, components required for chromosomal integration are missing, so chromosomal integration does not occur through Agrobacterium-mediated transformation, and the vector size is smaller than that for chromosomal integration vectors, allowing for introduction into the cytoplasm and gene correction. It has the advantage of higher efficiency.

Introduction of the vector can be performed using suitable standard techniques as known in the art, for example, Agrobacterium-mediated transformation, gene gun, microinjection, electroporation. ), DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein transduction domain-mediated introduction, and PEG-mediated transfection. Preferably, electroporation can be used.

Meanwhile, in the plant gene editing method provided herein, the Cas protein and guide RNA can correct genes by introducing a pre-assembled Cas protein guide RNA RNP (ribonucleoprotein). In this way, introducing RNP into protoplasts is characterized by directly introducing Cas protein and guide RNA into the cytoplasm without using an intracellular expression system such as a vector system.

Here, Cas protein and guide RNA are introduced into the cytoplasm in the form of RNP using gene gun, microinjection, electroporation, DEAE-dextran treatment, lipofection, and nanoparticle-mediated transfection. , protein transfer domain-mediated introduction, and PEG-mediated transfection, etc. can be delivered to cells by various methods known in the art, but are not limited thereto. Cas protein can be delivered into cells in the form of a complex with a guide RNA or in an independent form.

In addition, our technology for increasing gene editing efficiency in microalgae using autolysin can be applied not only to general CRISPR/Cas, but also to various forms of CRISPR/Cas that have been modified. For example, Base Editor (BE or base editing scissors) uses the existing CRISPR/Cas9 guide RNA system while using nCas9 (nickase Cas9) and deaminase to cut one strand of DNA. In addition, unlike the existing CRISPR/Cas9 system that induces gene insertion/deletion (indel), it has the feature of allowing only single base substitution.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

Example 1. Synthesis of Autolysin

To synthesize autolysin, mixed culture of Chlamydomonas reinhardtii ( C. reinhardtii ) CC-620 and CC-621 strains was performed. Chlamydomonas reinhardtii ( C. reinhardtii ) CC-620 and CC-621 strains were each cultured in a 250 mL flask for 5 hours (25°C, 70 rpm, TAP-N medium, working volume=20 mL), then mixed. Then, the cells were further cultured under the same conditions for 1 hour. Referring to Figure 1, it was confirmed that mating occurred when the two strains CC-620 and CC-621 were mixed. Autolysin is a cell wall dissolving substance produced during mating of microalgae and can be used to increase the efficiency of transformation. To harvest autolysin after completion of mixed culture, centrifugation was performed at 4°C, 10,000 rpm for 20 minutes, and the supernatant was collected and filtered through a 0.45μm syringe filter. As a result of analyzing the harvested solution through SDS-PAGE, it was confirmed that autolysin was produced normally, and the results are shown in Figure 2.

Figure 1 is an image showing the occurrence of mating during mixed culture of Chlamydomonas reinhardtii strains according to one embodiment; Arrow: mating occurs

Figure 2 is an image confirming the extraction of autolysin according to one embodiment.

Example 2. Confirmation of the effect of autolysin to increase cell wall permeability

The following experiment was performed to confirm the effect of Autolysin on increasing microalgae cell wall permeability.

Chlamydomonas reinhardtii ( Chlamydomonas reinhardtii ) CC-124 strain was cultured in TAP liquid medium at 25°C, 120 rpm, 120 μmol m ^-2 s ^-1 for about 4 days. When the strain according to one embodiment reached the rapid growth phase (Exponential growth phase), 250 μL of the culture medium was taken, spread on TAP solid medium, and then cultured again for 4 days under the same conditions. Afterwards, 10mL TAP-N liquid medium was added to recover the cells, and then washed twice with TAP-N liquid medium. After resuspension by adding 7 mL of harvested autolysin, it was stirred slowly and treated for 1 hour under light conditions. The control group that was not treated with autolysin was treated with the same amount of 7 mL of TAP-N medium, and the positive control group was treated with MAX EfficiencyTM Transformation Reagent for Algae (A24229), a commercial buffer from Invitrogen ^TM used to weaken cell walls in existing microalgae transformation. It was done as follows. Samples treated with autolysin and samples treated with TAP-N medium or commercial buffer MAX EfficiencyTM Transformation Reagent for Algae (A24229) were further divided into a group treated with Triton X-100 and a group not treated with Triton X-100. The Triton X-100 treatment group was mixed with 10 μL of 0.5% Triton X-100 solution. Referring to Figure 3, Triton When treated with dissolved cells, the shape of the cells disappears. The reaction to Triton

Figure 3 is an image showing the effect of increasing cell wall permeability of autolysin according to one embodiment.

As shown in Figure 3, compared to the group treated with medium or commercial buffer, it was observed that the shape of most cells disappeared in the experimental group treated with both autolysin and Triton It was confirmed that permeability increased.

Experimental Example 1. Confirmation of increased gene editing efficiency by autolysin treatment

To measure gene editing efficiency, the target gene of Chlamydomonas reinhardtii ( C. reinhardtii ) was MAA7.

Gene MAA7 is a gene encoding tryptophan β -synthase and plays an important role in the tryptophan biosynthetic pathway. If this gene is deleted, tryptophan (Trp), one of the essential amino acids, cannot be synthesized, leading to auxotrophy. Additionally, gene MAA7 has the activity of metabolizing 5-FI (5-fluoroindole) and converting it into a toxic substance called 5-Fluorotryptophan. Therefore, when KO (knock-out) of MAA7 is induced using genetic scissors and the cells are plated on solid medium containing both tryptophan and 5-FI, colonies with MAA7 KO (knock-out) are supplied with tryptophan. Colonies that do not survive die due to cytotoxicity due to metabolism of 5-FI. Gene MAA7 has been used several times as a model gene in gene editing studies of microalgae using these characteristics (Ma et al., 2013, Shin et al., 2016).

First, the steps of culturing and treating the Chlamydomonas reinhardtii CC-124 strain with autolysin were performed in the same manner as in Example 2. Afterwards, it was stored at constant temperature for 30 minutes at 40°C to increase the gene editing efficiency by Cas9-RNP. The obtained sample was centrifuged at 20°C, 2,500 rpm for 5 minutes to separate cells, washed once with TAP + 2% sucrose solution, and then resuspended with the same solution to a concentration of 10 ⁸ cells/110 μL. 110 μL of the sample obtained through this was taken and mixed with Cas9 RNP complex for electroporation (350 V, 25 μF and 600 Ω). The autolysin-untreated group was a negative control group, and 7 mL of TAP-N liquid medium was used instead of autolysin. After electroporation, store at 16°C for 1 hour, add 10 mL TAP + 2% sucrose, and recover for 24 hours at 25°C, 70 rpm, 20 μmol m ^-2 s ^-1 . Cells were separated by centrifugation at 20°C, 2,500 rpm, 5 minutes, mixed with 1.5 mL of 0.5% TAP-agar medium, and plated on 1.5% TAP-agar medium (containing 25 μM 5-FI and 1.5 mM tryptophan) (3 plates) (split into 0.5 mL portions) and then incubated for 7 to 10 days at 25°C and 120 μmol m ^-2 s ^-1 . Then, experiments were conducted using colonies obtained.

Specifically, the Cas9 RNP complex was tested by mixing 7.5 μg of commercially available Cas9 and 10 μg of sgRNA (TCCAGCCACGGTCTGGCCTCCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU, ToolGen, Inc.) and storing it at 37°C for 30 minutes. Results Table 1 below and It is shown in Figure 4.

Preprocessing method Before transformation
initial cell count Total number of colonies Gene corrected colony count Colony yield efficiency Gene editing efficiency Invitrogen ^TM commercial buffer
(Shin et al., 2016) 0.9 x 10 ⁸ 5 2 0.56×10 ^-6 0.22×10 ^-7 Invitrogen ^TM commercial buffer (present invention) 1.0 x 10 ⁸ 13 2 0.13×10 ^-6 0.20×10 ^-7 autolysin
(this invention) 2.0 x 10 ⁷ 75 73 0.38×10 ^-5 0.37×10 ^-5

Figure 4 is a graph showing the results of gene editing efficiency upon autolysin treatment according to one embodiment.

As shown in Figure 4 and Table 1, a total of 13 colonies were obtained in the experimental group that was not treated with autolysin, and on-target mutations occurred in 2 of these colonies. On the other hand, 75 colonies were obtained in the experimental group treated with autolysin, and as a result of gene sequence analysis, on-target mutations were found in 73 colonies. By autolysin treatment, the gene editing efficiency was improved about 185 times from 0.20Х10 ^-7 to 0.37Х10 ^-5 , which is about 168 times improved efficiency compared to the case previously reported in academic journals under similar conditions (0.22Х10 ^-7 ). I could see that it was.

Experimental Example 2. Production of new Cas9 protein using nuclear localization sequence (NLS)

Agrobacterium tumefaciens is a bacterium commonly used in the transformation of plant cells, and produces various proteins to effectively transfer foreign genes into the nucleus of the infected host. Among the key proteins involved in this are VirD2 and VirE2 proteins. It is known that the nuclear localization sequence (NLS) contained in the protein plays a key role in locating the target gene into the host nucleus, and the gene and protein sequences for the nuclear localization sequence have been reported. The present invention is Agrobacterium tumefacien Two NLSs shown in VirD2 (AAACGACGTAATGACGAGGAGGCAGGTCCGCGGAGCAAACCGTAAAGGATTGAA, SEQ ID NO: 1) and VirE2 (AAACTAAGACCTGAAGACCGATACGTACAAACAGAGAGATACGGGGCCCG, SEQ ID NO: 2) derived from LBA4404 were obtained and used. Specifically, in order to compare the nuclear localization effect of NLS, mCherry fused with SV40 NLS (CCCAAGAAGAAGAGGAAGGT, SEQ ID NO. 3), which is widely used in existing organism transformation, and mCherry fluorescent protein fused with NLS derived from VirD2 and VirE2 were used, respectively. It was produced, isolated, purified, transformed into C. reinhardtii CC-124, and observed through a confocal microscope. The results are shown in Figure 5. However, mCheery without NLS was used as a control.

In addition, various Cas9 expression plasmids were created by fusing NLS from VirD2 and VirE2 and SV40 NLS to the N or C terminus of Cas9 protein, respectively. The prepared plasmid was transformed into E. coli BL21(DE3) strain, cultured, and then purified with TALON resin using a poly histidine tag and used in the experiment. The plasmid constructed so that each NLS was fused to both ends of the Cas 9 protein is shown in Figure 6.

Figure 5 is a confocal microscope image of the nuclear localization effect of NLS fused to the N or C terminus of the fluorescent protein mCherry; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion DIC: Differential interference contrast channel.

Figure 6 is a schematic image showing a Cas 9 plasmid in which an NLS is fused to the N or C terminus of the Cas9 protein.

As shown in Figure 5, regardless of whether they were fused to the N-terminus or C-terminus, both VirD2 and VirE2 were confirmed to localize the proteins into the microalgae nucleus, as in the case of the existing SV40 NLS fusion.

Experimental Example 3. Autolysin treatment and comparison of gene editing efficiency by type and location of nuclear location sequence

Gene editing efficiency was analyzed in the same manner as in Example 2 using the six types of Cas9 proteins produced in Experimental Example 2 (all experimental groups were treated with autolysin), and the results are shown in Table 2 and Figure 7 below. indicated.

Cas9 type Initial cell number before transformation Total number of colonies Genotyping after random sampling Colony yield efficiency Gene editing efficiency Number of genotypes analyzed Gene corrected colony count Gene correction probability (%) DN-Cas9 2.0×10 ⁷ 230 166 161 96.99 1.15×10 ^-5 1.12×10 ^-5 DC-Cas9 176 127 123 96.85 0.88×10 ^-5 0.85×10 ^-5 EN-Cas9 104 75 70 93.33 0.52×10 ^-5 0.49×10 ^-5 EC-Cas9 113 81 80 98.77 0.57×10 ^-5 0.56×10 ^-5 SN-Cas9 95 68 66 97.06 0.48×10 ^-5 0.46×10 ^-5 SC-Cas9 99 72 71 98.61 0.50×10 ^-5 0.49×10 ^-5

Figure 7 is a graph showing the number of colonies generated through transformation according to the type of Cas9 protein after autolysin treatment according to one embodiment; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.

As shown in Figure 7 and Table 2, the highest gene editing efficiency was shown when NLS from VirD2 was treated at the N terminus, and SV40 NLS was fused to the N terminus after treatment with autolysin, which was used as Takara's commercial Cas9, Guide-itTM. Through comparison with the case of transformation using Recombinant Cas9 (Cat. 632641), when using Cas9 protein (DN-Cas9) with VirD2 NLS fused to the N terminus, gene correction efficiency was increased by increasing movement of Cas9 RNP complex material in the nucleus. It was confirmed that this increased from 0.37Х10 ^-5 to 1.12Х10 ^-5 , increasing the transformation efficiency by more than 3 times. In addition, the above results show that when processing autolysin and using the Cas9 protein (DN-Cas9) in which VirD2 NLS is fused to the N terminus, the gene editing efficiency is compared to the general conditions of NLS (using Invitrogen ^TM commercial buffer, using Takara's commercial Cas9). It was confirmed that the gene editing efficiency was increased by up to 560 times by increasing from 0.20Х10 ^-7 to 1.12Х10 ^-5 .

Through the above results, it was confirmed that gene editing efficiency in algae was significantly improved by pretreatment with autolysin and NLS-introduced Cas9 protein.

The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive.

Claims (17)

Treating algae with autolysin;
A method of editing an avian gene, comprising the step of introducing CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system) into the autolysin-treated algae to edit the gene. The method of claim 1, wherein the algae is Chlamydomonas reinhardtii , Anacystis nidulans , Ankistrodesmus sp., Biddulpha aurita , Botri Botryococcus braunii , Chaetoceros sp., Chlamydomonas applanata , Chlorella sp., Chlorella ellipsoidea , Chlorella emersonii , Chlorella protothecoides, Chlorella pyrenoidosa , Chlorella sorokiniana , Chlorella vulgaris , Chlorella minutissima , Chlorococcu littorale ), Cyclotella cryptica , Dunaliella bardawil , Dunaliella salina, Dunaliella tertiolecta , Dunaliella primolecta , Gymnodinum sp., Hymenomonas carterae , Isochrysis galbana , Isochrysis sp., Microcystis aeruginosa , Micromonas pusilla , Monodus subterraneous , Nanochloris sp., Nannochloropsis sp., Nannochloropsis atomus , Nano Chloropsis salina ( Nannochloropsis salina ), Navicula pelliculosa ( Navicula pelliculosa ), Nitzschia sp., Nitzscia closterium ( Nitzscia palea ), Osistis polymorphia ( Oocystis polymorpha ), Ourococcus sp., Oscillatoria rubescens, Pavlova lutheri, Phaeodactylum tricornutum , Pycnococcus provasoli ( Pycnococcus provasolii ), Pyramimonas cordata , Spirulina platensis , Stephanodiscus minutulus , Stichococcus sp., Synedra ulna , Scenedesmus obliquus , Selenastrum gracile , Skeletonoma costalum , Tetraselmis chui , Tetraselmis maculata , Tetraselmis sp., Tetraselmis suecica, Thalassiostra pseudomona , Anabaena sp., Calothrix sp., Cama Chaemisiphon sp., Chroococcidiopsis sp., Cyanothece sp., Cylindrospermum sp., Dermocarpella sp., Fischerella sp. .), Gloeocapsa sp., Myxosarcina sp., Nostoc sp., Oscillatoria sp., Phormidium corium , Pleuro Pleurocapsa sp., Prochlorococcus sp., Pseudanabaena sp., Synechococcus sp., Synechocystis sp., Tolypothrix sp. ) and Xenococcus ( Xenococcus sp.), which method is any one selected from the group consisting of. The method according to claim 1, wherein the autolysin is obtained by mixed culture of Chlamydomonas reinhardtii CC-620 and CC-621. The method of claim 1, further comprising the step of increasing cell wall permeability of algae. The method according to claim 1, wherein the introduction of CRISPR/Cas is a CRISPR protein or a polynucleotide encoding the same; and
A guide polynucleotide containing a guide sequence capable of hybridizing with a target nucleic acid; Or a method of introducing a polynucleotide encoding the same. The method of claim 1, wherein the introduction of CRISPR/Cas involves introducing a Cas protein-RNA RNP (ribonucleoprotein) in which a Cas protein and a guide RNA are pre-combined. The method of claim 5, wherein the CRISPR protein is Cas9, Cas12, Cas13, or Cas14. The method according to claim 5, wherein the CRISPR protein is a wild-type Cas protein or a Cas protein (engineered Cas protein) expressed by engineering by adding one or more nucleotide sequences to the nucleotide encoding the wild-type Cas protein. The method of claim 8, wherein the engineered and expressed Cas protein further includes a nuclear localization sequence (NLS) at the N or C terminus of the nucleotide encoding the Cas protein. The method of claim 9, wherein the nuclear localization sequence (NLS) is derived from Agrobacterium. The method of claim 9, wherein the nuclear localization sequence (NLS) is VirD2, VirE2, or SV40. The method of claim 9, wherein the nuclear localization sequence (NLS) is any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein. The method of claim 9, wherein the nuclear localization sequence (NLS) is any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein. The method according to any one of claims 5 to 13, further comprising increasing the efficiency of nuclear localization of the wild-type Cas protein. As a CRISPR/Cas system for gene editing in algae,
Cas protein, or polynucleotide encoding the same;
Nuclear Localization Sequence (NLS) VirD2, VirE2 or SV40 linked to the Cas protein or a polynucleotide encoding the same; and
A system comprising a target nucleic acid and a hybridization guide sequence or a polynucleotide encoding the same, wherein the algae are treated with autolysin. The system according to claim 15, wherein the nuclear localization sequence (NLS) is any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein. The system according to claim 15, wherein the nuclear localization sequence (NLS) is any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein.