KR20230151919A - Composition for antiinflammation comprising rose extract as an active ingredient - Google Patents

Composition for antiinflammation comprising rose extract as an active ingredient Download PDF

Info

Publication number
KR20230151919A
KR20230151919A KR1020230053348A KR20230053348A KR20230151919A KR 20230151919 A KR20230151919 A KR 20230151919A KR 1020230053348 A KR1020230053348 A KR 1020230053348A KR 20230053348 A KR20230053348 A KR 20230053348A KR 20230151919 A KR20230151919 A KR 20230151919A
Authority
KR
South Korea
Prior art keywords
rose
inflammatory
extract
active ingredient
velvet
Prior art date
Application number
KR1020230053348A
Other languages
Korean (ko)
Inventor
김윤배
최은경
김태명
Original Assignee
주식회사 디자인셀
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 디자인셀 filed Critical 주식회사 디자인셀
Publication of KR20230151919A publication Critical patent/KR20230151919A/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/73Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn
    • A61K36/738Rosa (rose)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00General protective or antinoxious agents
    • A61P39/06Free radical scavengers or antioxidants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324Foods, ingredients or supplements having a functional effect on health having an effect on the immune system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/52Stabilizers
    • A61K2800/522Antioxidants; Radical scavengers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Birds (AREA)
  • Polymers & Plastics (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 조성물에 관한 것이다. 구체적으로, 본 발명에 따른 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종의 장미 추출물이 세포독성을 나타내지 않으면서 항산화 활성이 우수하고, 세포 수준에서 산화질소 생성, iNOS 및 COX-2 유전자 발현 증가 및 염증 매개체의 수준 증가를 억제하고, 공기주머니 염증이 유도된 동물 모델에서 삼출물의 부피 증가, 염증성 세포의 증가, 염증성 사이토카인의 증가, 염증 매개체의 증가, 및 혈관 면적의 증가를 유의적으로 억제함으로써, 상기 추출물은 항염증 용도로 유용하게 사용될 수 있다.The present invention relates to an anti-inflammatory composition containing rose extract as an active ingredient. Specifically, the rose extracts of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna, and Ice Wing varieties according to the present invention are excellent in antioxidant activity without showing cytotoxicity, and produce nitric oxide at the cellular level. Inhibits increased iNOS and COX-2 gene expression and increased levels of inflammatory mediators, increases exudate volume, increases inflammatory cells, increases inflammatory cytokines, increases inflammatory mediators, and blood vessels in animal models in which air sac inflammation is induced. By significantly suppressing the increase in area, the extract can be usefully used for anti-inflammatory purposes.

Description

장미 추출물을 유효성분으로 함유하는 항염증용 조성물{COMPOSITION FOR ANTIINFLAMMATION COMPRISING ROSE EXTRACT AS AN ACTIVE INGREDIENT}Anti-inflammatory composition containing rose extract as an active ingredient {COMPOSITION FOR ANTIINFLAMMATION COMPRISING ROSE EXTRACT AS AN ACTIVE INGREDIENT}

본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 조성물에 관한 것이다.The present invention relates to an anti-inflammatory composition containing rose extract as an active ingredient.

염증은 외부 자극에 대한 생체조직의 방어반응 중 하나이다. 염증반응이 일어나면 여러 염증 인자들이 만들어지는데, 이로 인하여 임상적으로는 발적, 발열, 종창, 동통, 기능장애 등의 증상이 나타나기도 한다. 염증 인자에는 iNOS (inducible nitric oxide synthase)에 의해서 만들어지는 산화질소(NO)와, COX-2 (cyclooxygenase-2)에 의해 만들어지는 PGE2 (prostaglandin E2) 등이 있다. 이와 같은 염증 인자는 염증반응의 전사인사인 NF-κB (nuclear factor-κB)를 활성화시키며, 그 결과 과량의 NO 및 PGE2를 생성하여 염증을 유발한다. 포유동물 세포의 NOS (nitric oxide synthase)는 3종류가 존재하는데, nNOS (neuronal NOS), eNOS (endothelial NOS) 및 iNOS가 있다. 그 중, iNOS가 염증반응에 관여하며, nNOS 및 eNOS는 항상 발현되어 있다. iNOS는 IFN-γ (interferon-γ), LPS (lipopolysaccharide)나 다양한 염증성 사이토카인의 자극에 의해서만 발현된다.Inflammation is one of the defense responses of living tissue to external stimuli. When an inflammatory reaction occurs, various inflammatory factors are produced, which may cause clinical symptoms such as redness, fever, swelling, pain, and dysfunction. Inflammatory factors include nitric oxide (NO) produced by iNOS (inducible nitric oxide synthase) and PGE2 (prostaglandin E2) produced by COX-2 (cyclooxygenase-2). These inflammatory factors activate NF-κB (nuclear factor-κB), a transcription factor for the inflammatory response, and as a result, produce excessive amounts of NO and PGE2, causing inflammation. There are three types of NOS (nitric oxide synthase) in mammalian cells: nNOS (neuronal NOS), eNOS (endothelial NOS), and iNOS. Among them, iNOS is involved in inflammatory responses, and nNOS and eNOS are always expressed. iNOS is expressed only by stimulation of interferon-γ (IFN-γ), lipopolysaccharide (LPS), or various inflammatory cytokines.

염증 인자 중, 산화질소는 급성 및 만성 염증반응을 조절하는 역할을 하며, iNOS의 전사단계에서의 발현조절은 산화질소의 지속시간 및 생성정도를 결정하는데 중요하다. 한편, PGE2는 COX에 의해 아라키돈산(arachidonic acid)으로부터 생산된다. COX는 거의 모든 조직에서 발현되어 있는 COX-1과 대식세포에 의해 발현되는 COX-2가 있다. COX-1은 프로스타글란딘을 생산하여 신장의 혈액 흐름을 조절하거나 위장의 세포를 보호하는 등의 생리기능에 관여한다. 반면, COX-2는 미생물에 의한 감염이나 손상 또는 다른 요인에 의한 스트레스에 의해 발현되며 대표적인 염증인자로 알려져 있다.Among inflammatory factors, nitric oxide plays a role in regulating acute and chronic inflammatory responses, and regulating the expression of iNOS at the transcription stage is important in determining the duration and level of production of nitric oxide. Meanwhile, PGE2 is produced from arachidonic acid by COX. COX includes COX-1, which is expressed in almost all tissues, and COX-2, which is expressed by macrophages. COX-1 produces prostaglandins and is involved in physiological functions such as regulating blood flow in the kidneys and protecting cells in the stomach. On the other hand, COX-2 is expressed due to stress caused by infection or damage by microorganisms or other factors and is known as a representative inflammatory factor.

이에, 이들 염증인자들을 표적으로 하는 항염증 활성을 나타내는 새로운 기능성 소재의 개발이 활발이 진행되고 있다. 관련하여, 대한민국 공개특허 제10-2022-0163330호는 쓴메밀 추출물을 포함하는 항염증 조성물에 관한 것으로, 쓴메밀 추출물이 일반메밀 추출물과 비교하여 페놀, 플라보노이드, 루틴 및 퀘세틴 함량이 높아 항산화능, 항염증 및 NO 생성 억제 활성이 뛰어나 항염증 용도로 사용될 수 있음을 개시하고 있다.Accordingly, the development of new functional materials that exhibit anti-inflammatory activity targeting these inflammatory factors is actively underway. In relation to this, Republic of Korea Patent Publication No. 10-2022-0163330 relates to an anti-inflammatory composition containing bitter buckwheat extract, in which bitter buckwheat extract has higher phenol, flavonoid, rutin and quercetin content compared to general buckwheat extract, and thus has antioxidant capacity. , it is disclosed that it has excellent anti-inflammatory and NO production inhibitory activities and can be used for anti-inflammatory purposes.

대한민국 공개특허 제10-2022-0163330호Republic of Korea Patent Publication No. 10-2022-0163330

본 발명의 목적은 장미 추출물의 항염증 용도를 제공하는 것이다.The object of the present invention is to provide an anti-inflammatory use of rose extract.

상기 목적을 달성하기 위하여, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 화장료 조성물로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 화장료 조성물을 제공한다.In order to achieve the above object, the present invention is an anti-inflammatory cosmetic composition containing rose extract as an active ingredient, wherein the rose is composed of Rubbershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna and Ice Wing varieties. Provided is an anti-inflammatory cosmetic composition comprising at least one selected from the group.

또한, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 약학적 조성물로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 약학적 조성물을 제공한다.In addition, the present invention is an anti-inflammatory pharmaceutical composition containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna, and Ice Wing varieties. Provided is one or more anti-inflammatory pharmaceutical compositions.

또한, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 피부외용제로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 피부외용제를 제공한다.In addition, the present invention is an anti-inflammatory skin external preparation containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Rubbershy, Red Perfume, Onnuri, Jaminar Red, Pretty Velvet, Hyangna, and Ice Wing varieties. Provided is one or more anti-inflammatory external skin preparations.

나아가, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 건강기능식품으로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 건강기능식품을 제공한다.Furthermore, the present invention is an anti-inflammatory health functional food containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Rubbershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna and Icewing varieties. We provide one or more anti-inflammatory health functional foods.

본 발명에 따른 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종의 장미 추출물이 세포독성을 나타내지 않으면서 항산화 활성이 우수하고, 세포 수준에서 산화질소 생성, iNOS 및 COX-2 유전자 발현 증가 및 염증 매개체의 수준 증가를 억제하고, 공기주머니 염증이 유도된 동물 모델에서 삼출물의 부피 증가, 염증성 세포의 증가, 염증성 사이토카인의 증가, 염증 매개체의 증가, 및 혈관 면적의 증가를 유의적으로 억제함으로써, 상기 추출물은 항염증 용도로 유용하게 사용될 수 있다.The rose extracts of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna and Icewing varieties according to the present invention have excellent antioxidant activity without showing cytotoxicity, and produce nitric oxide, iNOS and COX at the cellular level. -2 Inhibits increased gene expression and increased levels of inflammatory mediators, increased exudate volume, increased inflammatory cells, increased inflammatory cytokines, increased inflammatory mediators, and increased blood vessel area in animal models in which air sac inflammation was induced. By significantly inhibiting, the extract can be usefully used for anti-inflammatory purposes.

도 1은 본 발명의 일 실시예에서 제조된 24종류 장미 추출물의 총 폴리페놀 함량을 확인한 결과 그래프이다(LS: 러버샤이, LSc: 러블리스칼렛, LH: 러빙하트, RP: 레드퍼퓸, Lu: 루미너스, MG: 미리내골드, Be: 베티, Bi: 비치나, Ai: 에일린, On: 온누리, Yu: 유니나, JR: 재미나레드, Ji: 진선미, Ch: 칠백리, Tn: 타미나, Tr: 탐나리, PV: 프리티벨벳, PG: 피치그레이스, PL: 핑크러브, PP: 핑크퍼퓸, Hr: 하나로, Hm: 한아람, Ha: 향기나, IW: 아이스윙).
도 2는 본 발명의 일 실시예에서 제조된 24종류 장미 추출물의 ABTS 소거능을 확인한 결과 그래프이다(LS: 러버샤이, LSc: 러블리스칼렛, LH: 러빙하트, RP: 레드퍼퓸, Lu: 루미너스, MG: 미리내골드, Be: 베티, Bi: 비치나, Ai: 에일린, On: 온누리, Yu: 유니나, JR: 재미나레드, Ji: 진선미, Ch: 칠백리, Tn: 타미나, Tr: 탐나리, PV: 프리티벨벳, PG: 피치그레이스, PL: 핑크러브, PP: 핑크퍼퓸, Hr: 하나로, Hm: 한아람, Ha: 향기나, IW: 아이스윙).
도 3은 본 발명의 일 실시예에서 제조된 24종류 장미 추출물의 DPPH 소거능을 확인한 결과 그래프이다(LS: 러버샤이, LSc: 러블리스칼렛, LH: 러빙하트, RP: 레드퍼퓸, Lu: 루미너스, MG: 미리내골드, Be: 베티, Bi: 비치나, Ai: 에일린, On: 온누리, Yu: 유니나, JR: 재미나레드, Ji: 진선미, Ch: 칠백리, Tn: 타미나, Tr: 탐나리, PV: 프리티벨벳, PG: 피치그레이스, PL: 핑크러브, PP: 핑크퍼퓸, Hr: 하나로, Hm: 한아람, Ha: 향기나, IW: 아이스윙).
도 4는 본 발명의 일 실시예에서 제조된 24종류 장미 추출물의 산화질소 생성 억제 효과를 확인한 결과 그래프이다(LS: 러버샤이, LSc: 러블리스칼렛, LH: 러빙하트, RP: 레드퍼퓸, Lu: 루미너스, MG: 미리내골드, Be: 베티, Bi: 비치나, Ai: 에일린, On: 온누리, Yu: 유니나, JR: 재미나레드, Ji: 진선미, Ch: 칠백리, Tn: 타미나, Tr: 탐나리, PV: 프리티벨벳, PG: 피치그레이스, PL: 핑크러브, PP: 핑크퍼퓸, Hr: 하나로, Hm: 한아람, Ha: 향기나, IW: 아이스윙).
도 5는 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)의 세포독성을 확인한 결과 그래프이다.
도 6은 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)의 iNOS 및 COX-2 유전자 발현 억제를 확인한 결과 그래프이다.
도 7은 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 NO 및 PGE2 수준 증가 억제를 확인한 결과 그래프이다.
도 8은 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 공기주머니(air-pouch) 염증 동물모델의 삼출물 부피 증가 억제를 확인한 결과 그래프이다.
도 9는 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 공기주머니 염증 동물모델의 삼출물 내 백혈구, 호중구, 단핵구 및 림프구 증가 억제를 확인한 결과 그래프이다.
도 10은 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 공기주머니 염증 동물모델의 삼출물 내 TNF-α 및 IL-1β 증가 억제를 확인한 결과 그래프이다.
도 11은 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 공기주머니 염증 동물모델의 삼출물 내 NO 및 PGE2 증가 억제를 확인한 결과 그래프이다.
도 12는 본 발명의 일 실시예에서 프리티벨벳 장미 추출물(PVRE)에 의한 공기주머니 염증 동물모델의 혈관 면적 증가 억제를 촬영한 결과 도면(A) 및 면적을 계산한 결과 그래프(B)이다.
Figure 1 is a graph showing the results of confirming the total polyphenol content of 24 types of rose extracts prepared in an example of the present invention (LS: Lovershy, LSc: Lovely Scarlet, LH: Loving Heart, RP: Red Perfume, Lu: Lumi Nurse, MG: Mirinaegold, Be: Betty, Bi: Bichina, Ai: Eileen, On: Onnuri, Yu: Yuna, JR: Funnared, Ji: Jinseonmi, Ch: Chilbaekri, Tn: Tamina, Tr: Tamnari, PV: Pretty Velvet, PG: Peach Grace, PL: Pink Love, PP: Pink Perfume, Hr: Hanaro, Hm: Han A-ram, Ha: Fragrance, IW: Ice Wing).
Figure 2 is a graph showing the results of confirming the ABTS scavenging ability of 24 types of rose extracts prepared in an example of the present invention (LS: Lovershy, LSc: Lovely Scarlet, LH: Loving Heart, RP: Red Perfume, Lu: Luminous, MG: Mirinaegold, Be: Betty, Bi: Bichina, Ai: Eileen, On: Onnuri, Yu: Yuna, JR: Funnared, Ji: Jinseonmi, Ch: Chilbaekri, Tn: Tamina, Tr: Tamnari , PV: Pretty Velvet, PG: Peach Grace, PL: Pink Love, PP: Pink Perfume, Hr: Hanaro, Hm: Han A-ram, Ha: Fragrance, IW: Ice Wing).
Figure 3 is a graph showing the results of confirming the DPPH scavenging ability of 24 types of rose extracts prepared in an example of the present invention (LS: Lovershy, LSc: Lovely Scarlet, LH: Loving Heart, RP: Red Perfume, Lu: Luminous, MG: Mirinaegold, Be: Betty, Bi: Bichina, Ai: Eileen, On: Onnuri, Yu: Yuna, JR: Funnared, Ji: Jinseonmi, Ch: Chilbaekri, Tn: Tamina, Tr: Tamnari , PV: Pretty Velvet, PG: Peach Grace, PL: Pink Love, PP: Pink Perfume, Hr: Hanaro, Hm: Han A-ram, Ha: Fragrance, IW: Ice Wing).
Figure 4 is a graph showing the results of confirming the nitric oxide production inhibition effect of 24 types of rose extracts prepared in an example of the present invention (LS: Lovershy, LSc: Lovely Scarlet, LH: Loving Heart, RP: Red Perfume, Lu: Luminous, MG: Mirinaegold, Be: Betty, Bi: Vichina, Ai: Eileen, On: Onnuri, Yu: Yuna, JR: Funnared, Ji: Jinseonmi, Ch: Chilbaekri, Tn: Tamina, Tr : Tamnari, PV: Pretty Velvet, PG: Peach Grace, PL: Pink Love, PP: Pink Perfume, Hr: Hanaro, Hm: Han A-ram, Ha: Fragrance, IW: Ice Wing).
Figure 5 is a graph showing the results of confirming the cytotoxicity of pretty velvet rose extract (PVRE) in an example of the present invention.
Figure 6 is a graph showing the results confirming the inhibition of iNOS and COX-2 gene expression by pretty velvet rose extract (PVRE) in an embodiment of the present invention.
Figure 7 is a graph showing the results confirming the inhibition of increase in NO and PGE2 levels by pretty velvet rose extract (PVRE) in one embodiment of the present invention.
Figure 8 is a graph showing the results of confirming the inhibition of increase in exudate volume in an air-pouch inflammation animal model by pretty velvet rose extract (PVRE) in an embodiment of the present invention.
Figure 9 is a graph showing the results confirming the inhibition of increase in white blood cells, neutrophils, monocytes, and lymphocytes in the exudate of an air sac inflammation animal model by pretty velvet rose extract (PVRE) in an embodiment of the present invention.
Figure 10 is a graph showing the results confirming the inhibition of increase in TNF-α and IL-1β in the exudate of an air sac inflammation animal model by pretty velvet rose extract (PVRE) in an embodiment of the present invention.
Figure 11 is a graph showing the results confirming the inhibition of increase in NO and PGE2 in the exudate of an air sac inflammation animal model by pretty velvet rose extract (PVRE) in an embodiment of the present invention.
Figure 12 is a drawing (A) showing the results of photographing the inhibition of increase in blood vessel area in an air sac inflammation animal model by pretty velvet rose extract (PVRE) in an embodiment of the present invention (A), and a graph (B) showing the results of calculating the area.

이하, 본 발명을 상세하 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 화장료 조성물로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 화장료 조성물을 제공한다.The present invention is an anti-inflammatory cosmetic composition containing rose extract as an active ingredient, wherein the rose is one or more selected from the group consisting of Lovershy, Red Perfume, Onnuri, Jaminar Red, Pretty Velvet, Hyangna, and Ice Wing varieties. An anti-inflammatory cosmetic composition is provided.

상기 장미 추출물은 장미의 꽃잎, 줄기, 잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상으로부터 추출된 것일 수 있고, 구체적으로 장미의 꽃잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상으로부터 추출된 것일 수 있다. 본 발명의 일 실시예에서, 상기 장미 추출물은 꽃봉오리로부터 추출된 것일 수 있다.The rose extract may be extracted from any one or more selected from the group consisting of rose petals, stems, leaves, sepals, and buds, and specifically any one selected from the group consisting of rose petals, sepals, and buds. It may have been extracted from the above. In one embodiment of the present invention, the rose extract may be extracted from flower buds.

상기 장미 추출물은 하기의 단계를 포함하는 제조방법에 의해 제조될 수 있다:The rose extract can be prepared by a production method comprising the following steps:

1) 장미에 추출용매를 가하여 추출물을 제조하는 단계;1) Preparing an extract by adding an extraction solvent to roses;

2) 단계 1)의 추출물을 여과하는 단계; 및2) filtering the extract of step 1); and

3) 단계 2)의 여과된 여과물을 감압농축한 후 건조하는 단계.3) Concentrating the filtrate from step 2) under reduced pressure and drying it.

또한, 상기 추출용매는 물, 알코올 또는 이의 혼합물일 수 있다. 상기 알코올은 C1 내지 C2의 저급 알코올 수 있고, 구체적으로, 상기 알코올은 에탄올, 메탄올 또는 주정일 수 있다. 상기 추출용매는 건조된 장미 무게의 1 내지 100배, 1 내지 70배, 1 내지 50배, 20 내지 100배, 20 내지 70배, 20 내지 50배로 첨가될 수 있다. 상기 추출용매를 알코올로 사용하는 경우, 상기 알코올은 50 내지 100%, 50 내지 90%, 50 내지 85%, 70 내지 100%, 70 내지 90% 또는 70 내지 85% 알코올일 수 있다.Additionally, the extraction solvent may be water, alcohol, or a mixture thereof. The alcohol may be a C 1 to C 2 lower alcohol, and specifically, the alcohol may be ethanol, methanol, or alcohol. The extraction solvent may be added in an amount of 1 to 100 times, 1 to 70 times, 1 to 50 times, 20 to 100 times, 20 to 70 times, and 20 to 50 times the weight of the dried rose. When alcohol is used as the extraction solvent, the alcohol may be 50 to 100%, 50 to 90%, 50 to 85%, 70 to 100%, 70 to 90%, or 70 to 85% alcohol.

상기 추출방법은 진탕추출, 냉침추출, 환류추출 또는 초음파추출일 수 있다. 이때, 추출 시간은 1 내지 20시간, 2 내지 20시간, 1 내지 10시간, 2 내지 10시간, 1 내지 5시간, 2 내지 5시간일 수 있다. 상기 추출은 1회 이상 반복 추출할 수 있다.The extraction method may be shaking extraction, cold extraction, reflux extraction, or ultrasonic extraction. At this time, the extraction time may be 1 to 20 hours, 2 to 20 hours, 1 to 10 hours, 2 to 10 hours, 1 to 5 hours, or 2 to 5 hours. The extraction can be repeated one or more times.

한편, 상기 단계 3)의 감압농축은 진공감압농축기 또는 진공회전증발기를 이용할 수 있다. 또한, 상기 건조는 감압건조, 진공건조, 비등건조, 분무건조 또는 동결건조일 수 있고, 구체적으로는 동결건조일 수 있다.Meanwhile, the vacuum concentration in step 3) can be performed using a vacuum vacuum concentrator or a vacuum rotary evaporator. Additionally, the drying may be reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, and specifically may be freeze drying.

본 명세서에서 사용된 용어, "염증(inflammation)"은 특정 조직의 손상 또는 감염에 대한 일종의 생체 내 반응으로서, 면역세포에 의해 매개되는 반응을 의미한다. 상기 염증은 물리적 또는 화학적 자극이나, 세균, 바이러스, 진균 등에 의한 미생물에 의해 발생할 수 있고, 동통, 발열, 발적 등의 임상 증상을 나타낼 수 있다. 또한, 조직학적으로는 소동맥, 모세혈관 및 소정맥의 투과성과 혈류증가를 동반한 혈관 확장, 혈장 단백을 함유한 혈장의 삼출, 백혈구의 염증 부위로의 이동 등을 포함하는 증상을 보일 있다.As used herein, the term “inflammation” refers to a type of in vivo response to damage or infection of a specific tissue, and is mediated by immune cells. The inflammation may be caused by physical or chemical stimulation or microorganisms such as bacteria, viruses, and fungi, and may show clinical symptoms such as pain, fever, and redness. Additionally, histologically, symptoms may include vasodilation with increased permeability and blood flow of arterioles, capillaries, and venules, exudation of plasma containing plasma proteins, and migration of leukocytes to the inflammatory site.

본 발명의 화장료 조성물은 장미 추출물을 0.1 내지 50 중량%, 구체적으로 1 내지 10 중량%로 포함할 수 있다. 상기 화장료 조성물은 항염증 활성을 목적으로 피부에 직접 도포될 수 있다.The cosmetic composition of the present invention may contain 0.1 to 50% by weight of rose extract, specifically 1 to 10% by weight. The cosmetic composition can be applied directly to the skin for the purpose of anti-inflammatory activity.

상기 화장료 조성물은 통상적으로 제조되는 화장료 제형으로 제제화될 수 있다. 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 로션, 크림, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있다. 구체적으로는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더일 수 있다.The cosmetic composition may be formulated into a commonly manufactured cosmetic formulation. The cosmetic composition may be formulated as a solution, suspension, emulsion, paste, gel, lotion, cream, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray. Specifically, it may be softening lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, or powder.

본 발명의 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라가칸트, 셀룰로오스 유도체, 폴리에틸렌글리콜, 실리콘, 벤토나이트, 실리카, 탈크, 산화아연 또는 이의 혼합물을 포함할 수 있다. 또한, 상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 락토스, 탈크, 실리카, 알루미늄 하이드록시드, 칼슘 실리케이트, 폴리아미드 파우더 또는 이의 혼합물을 포함할 수 있다. 특히, 스프레이인 경우에는 추가로 클로로플루오로하이드로카본, 프로판/부탄 또는 디메틸에테르 등을 더 포함할 수 있다.When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or It may include mixtures thereof. Additionally, when the formulation of the cosmetic composition is powder or spray, it may contain lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures thereof. In particular, in the case of a spray, it may further include chlorofluorohydrocarbon, propane/butane, or dimethyl ether.

본 발명의 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는 담체로서 용매, 용매화제, 유탁화제 또는 이의 혼합물을 포함할 수 있다. 이의 예로는, 물, 에탄올, 이소프로판올, 에틸카보네이트, 에틸아세테이트, 벤질알코올, 벤질벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌글리콜, 소르비탄 지방산 에스테르 등이 있다.When the formulation of the cosmetic composition of the present invention is a solution or emulsion, it may include a solvent, solvating agent, emulsifying agent, or a mixture thereof as a carrier. Examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, sorbitan fatty acid ester, etc.

본 발명의 화장료 조성물의 제형이 현탁액인 경우에는 담체로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미세결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가, 트라가칸트 또는 이의 혼합물을 포함할 수 있다. 또한, 상기 화장료 조성물의 제형이 계면활성제 함유 클렌징인 경우에는 담체로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르설페이트, 알칼아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체, 에톡실화 글리세롤 지방산 에스테르 또는 이의 혼합물을 포함할 수 있다.When the formulation of the cosmetic composition of the present invention is a suspension, the carrier may include water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, It may include microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth, or mixtures thereof. In addition, when the formulation of the cosmetic composition is a cleansing surfactant, the carrier may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid. It may include amide ethersulfate, alkalamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, ethoxylated glycerol fatty acid ester, or mixtures thereof.

본 발명의 화장료 조성물은 담체 성분 이외에도, 보조제로서 항산화제, 안정화제, 용해화제, 보습제, 안료, 향료, 자외선 차단제, 발색제, 계면활성제 또는 이의 혼합물을 포함할 수 있다. 상기 보조제는 화장료 조성물의 제조에 통상적으로 사용되는 물질이라면 모두 사용가능하다.In addition to the carrier component, the cosmetic composition of the present invention may include antioxidants, stabilizers, solubilizers, moisturizers, pigments, fragrances, sunscreens, coloring agents, surfactants, or mixtures thereof as auxiliaries. The auxiliary agent can be any material commonly used in the production of cosmetic compositions.

또한, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 약학적 조성물로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 약학적 조성물을 제공한다.In addition, the present invention is an anti-inflammatory pharmaceutical composition containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna, and Ice Wing varieties. Provided is one or more anti-inflammatory pharmaceutical compositions.

본 발명에 따른 약학적 조성물에 유효성분으로 포함되는 장미 추출물은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 장미 추출물은 장미의 꽃잎, 줄기, 잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상으로부터 추출된 것일 수 있다. 또한, 상기 장미 추출물은 물, C1 내지 C2의 저급 알코올 또는 이의 혼합물로 추출된 것일 수 있고, 이때, C1 내지 C2의 저급 알코올은 에탄올, 메탄올 또는 주정일 수 있다.The rose extract included as an active ingredient in the pharmaceutical composition according to the present invention may have the characteristics described above. For example, the rose extract may be extracted from any one or more selected from the group consisting of rose petals, stems, leaves, sepals, and flower buds. Additionally, the rose extract may be extracted with water, a C 1 to C 2 lower alcohol, or a mixture thereof, and in this case, the C 1 to C 2 lower alcohol may be ethanol, methanol, or alcohol.

본 발명에 따른 약학적 조성물은 조성물 전체 중량에 대하여 유효성분인 장미 추출물을 10 내지 95 중량%로 포함할 수 있다. 또한, 본 발명의 약학적 조성물은 상기 유효성분 이외에 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 추가로 포함할 수 있다.The pharmaceutical composition according to the present invention may contain 10 to 95% by weight of rose extract, which is an active ingredient, based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may further include one or more active ingredients that exhibit the same or similar functions in addition to the above-mentioned effective ingredients.

본 발명의 약학적 조성물은 생물학적 제제에 통상적으로 사용되는 담체, 희석제, 부형제 또는 이의 혼합물을 포함할 수 있다. 약학적으로 허용가능한 담체는 조성물을 생체 내에 전달하는데 적합한 것이면 모두 사용할 수 있다. 구체적으로, 상기 담체는 Merck Index, 13th ed., Merck & Co. Inc.에 기재된 화합물, 식염수, 멸균수, 링거액, 덱스트로스 용액, 말토덱스트린 용액, 글리세롤, 에탄올 또는 이의 혼합물일 수 있다. 또한, 필요에 따라 항산화제, 완충액, 정균제 등과 같은 통상의 첨가제를 첨가할 수 있다.The pharmaceutical composition of the present invention may include carriers, diluents, excipients, or mixtures thereof commonly used in biological products. Any pharmaceutically acceptable carrier can be used as long as it is suitable for delivering the composition in vivo. Specifically, the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline solution, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or mixtures thereof. Additionally, conventional additives such as antioxidants, buffers, bacteriostatic agents, etc. can be added as needed.

상기 조성물을 제제화하는 경우, 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 첨가할 수 있다.When formulating the composition, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be added.

본 발명의 조성물은 경구용 제제 또는 비경구용 제제로 제형화될 수 있다. 경구용 제제로는 고형 제제 및 액상 제제가 포함될 수 있다. 상기 고형 제제는 정제, 환제, 산제, 과립제, 캡슐제 또는 트로키제일 수 있고, 이러한 고형 제제는 상기 조성물에 적어도 하나 이상의 부형제를 첨가하여 조제할 수 있다. 상기 부형제는 전분, 탄산칼슘, 수크로스, 락토오스, 젤라틴 또는 이의 혼합물일 수 있다. 또한, 상기 고형 제제는 윤활제를 포함할 수 있고, 그 예로는 마그네슘 스티레이트, 탈크 등이 있다. 한편, 상기 액상 제제는 현탁제, 내용액제, 유제 또는 시럽제일 수 있다. 이때, 상기 액상 제제에는 습윤제, 감미제, 방향제, 보존제 등과 같은 부형제가 포함될 수 있다.The composition of the present invention may be formulated as an oral preparation or a parenteral preparation. Oral preparations may include solid preparations and liquid preparations. The solid preparation may be a tablet, pill, powder, granule, capsule, or troche, and such solid preparation may be prepared by adding at least one excipient to the composition. The excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or mixtures thereof. Additionally, the solid preparation may contain a lubricant, examples of which include magnesium styrate and talc. Meanwhile, the liquid preparation may be a suspension, oral solution, emulsion, or syrup. At this time, the liquid formulation may contain excipients such as wetting agents, sweeteners, fragrances, preservatives, etc.

상기 비경구용 제제는 주사제, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 파우더 및 크림 등을 포함할 수 있다. 상기 주사제는 멸균된 수용액, 비수성용제, 현탁용제, 유제 등을 포함할 수 있다. 이때, 비수성용제 또는 현탁용제로서는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름이나, 에틸올레이트와 같이 주사가능한 에스테르 등이 사용될 수 있다.The parenteral preparations may include injections, suppositories, powders for respiratory inhalation, aerosols for sprays, powders and creams. The injection may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, etc. At this time, the non-aqueous solvent or suspension may be propylene glycol, polyethylene glycol, vegetable oil such as olive oil, or injectable ester such as ethyl oleate.

본 발명의 조성물은 목적하는 방법에 따라 경구 또는 비경구로 투여될 수 있다. 비경구 투여는 복강내, 직장내, 피하, 정맥, 근육내 또는 흉부내 주사 방식을 포함할 수 있다.The composition of the present invention can be administered orally or parenterally depending on the desired method. Parenteral administration may include intraperitoneal, intrarectal, subcutaneous, intravenous, intramuscular, or intrathoracic injection.

상기 조성물은 약학적으로 유효한 양으로 투여될 수 있다. 이는 질환의 종류, 중증도, 약물의 활성, 약물에 대한 환자의 민감도, 투여 시간, 투여 경로, 치료기간, 동시에 사용되는 약물 등에 따라 달라질 수 있다. 그러나, 바람직한 효과를 위해서, 본 발명에 따른 약학적 조성물에 포함되는 유효성분의 양은 0.0001 내지 1,000 ㎎/㎏, 구체적으로 0.001 내지 500 ㎎/㎏일 수 있다. 상기 투여는 하루에 1회 또는 수회일 수 있다.The composition can be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, activity of the drug, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used simultaneously, etc. However, for a desirable effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg. The administration may be once or several times a day.

본 발명의 조성물은 단독 또는 다른 치료제와 병용하여 투여될 수 있다. 병용 투여시, 투여는 순차적 또는 동시일 수 있다.The composition of the present invention can be administered alone or in combination with other therapeutic agents. When administered in combination, administration may be sequential or simultaneous.

또한, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 피부외용제로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 피부외용제를 제공한다.In addition, the present invention is an anti-inflammatory skin external preparation containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Rubbershy, Red Perfume, Onnuri, Jaminar Red, Pretty Velvet, Hyangna, and Ice Wing varieties. Provided is one or more anti-inflammatory external skin preparations.

본 발명에 따른 피부외용제에 유효성분으로 포함되는 장미 추출물은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 장미 추출물은 장미의 꽃잎, 줄기, 잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상으로부터 추출된 것일 수 있다. 또한, 상기 장미 추출물은 물, C1 내지 C2의 저급 알코올 또는 이의 혼합물로 추출된 것일 수 있고, 이때, C1 내지 C2의 저급 알코올은 에탄올, 메탄올 또는 주정일 수 있다.The rose extract included as an active ingredient in the external skin preparation according to the present invention may have the characteristics described above. For example, the rose extract may be extracted from any one or more selected from the group consisting of rose petals, stems, leaves, sepals, and flower buds. Additionally, the rose extract may be extracted with water, a C 1 to C 2 lower alcohol, or a mixture thereof, and in this case, the C 1 to C 2 lower alcohol may be ethanol, methanol, or alcohol.

본 발명의 피부외용제는 약학적으로 허용가능한 담체 및 부형제를 포함할 수 있다. 상기 담체 및 부형제는 방부제, 안정화제, 수화제, 유화 촉진제 및 완충제 등을 포함할 수 있다. 구체적으로, 상기 부형제는 유당, 덱스트린, 전분, 만니톨, 소르비톨, 글루코스, 사카로스, 미세결정 셀룰로스, 젤라틴, 폴리비닐피롤리돈 또는 이의 혼합물일 수 있다. 상기 피부외용제는 당업계에 잘 알려진 방법에 따라 적절히 제조될 수 있다. 상기 피부외용제는 파우더, 젤, 연고, 크림, 액체 및 에어로졸의 형태로 제조될 수 있다.The external skin preparation of the present invention may contain a pharmaceutically acceptable carrier and excipient. The carrier and excipients may include preservatives, stabilizers, wetting agents, emulsification accelerators, and buffering agents. Specifically, the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone, or mixtures thereof. The skin external preparation can be appropriately prepared according to methods well known in the art. The skin external preparations can be manufactured in the form of powder, gel, ointment, cream, liquid, and aerosol.

나아가, 본 발명은 장미 추출물을 유효성분으로 함유하는 항염증용 건강기능식품으로서, 상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 건강기능식품을 제공한다.Furthermore, the present invention is an anti-inflammatory health functional food containing rose extract as an active ingredient, wherein the rose is selected from the group consisting of Rubbershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna and Icewing varieties. We provide one or more anti-inflammatory health functional foods.

본 발명에 따른 건강기능식품에 유효성분으로 포함되는 장미 추출물은 상기 서술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 장미 추출물은 장미의 꽃잎, 줄기, 잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상으로부터 추출된 것일 수 있다. 또한, 상기 장미 추출물은 물, C1 내지 C2의 저급 알코올 또는 이의 혼합물로 추출된 것일 수 있고, 이때, C1 내지 C2의 저급 알코올은 에탄올, 메탄올 또는 주정일 수 있다.The rose extract included as an active ingredient in the health functional food according to the present invention may have the characteristics described above. For example, the rose extract may be extracted from any one or more selected from the group consisting of rose petals, stems, leaves, sepals, and flower buds. Additionally, the rose extract may be extracted with water, a C 1 to C 2 lower alcohol, or a mixture thereof, and in this case, the C 1 to C 2 lower alcohol may be ethanol, methanol, or alcohol.

본 발명의 장미 추출물은 식품에 그대로 첨가하거나, 다른 식품 또는 식품 성분과 함께 사용될 수 있다. 이때, 첨가되는 유효성분의 함량은 목적에 따라 결정될 수 있고, 일반적으로는 전체 건강기능식품 중량의 0.01 내지 90 중량부일 수 있다.The rose extract of the present invention can be added as is to food or used together with other foods or food ingredients. At this time, the content of the added active ingredient may be determined depending on the purpose, and may generally be 0.01 to 90 parts by weight of the total weight of the health functional food.

건강기능식품의 형태 및 종류는 특별히 제한되지 않는다. 구체적으로, 상기 건강기능식품은 정제, 캅셀, 분말, 과립, 액상 및 환의 형태일 수 있다. 상기 건강기능식품은 추가성분으로서 여러 가지 향미제, 감미제 또는 천연 탄수화물을 포함할 수 있다. 상기 감미제는 천연 또는 합성 감미제일 수 있고, 천연 감미제의 예로는 타우마틴, 스테비아 추출물 등이 있다. 한편, 합성 감미제의 예로는 사카린, 아스파르탐 등이 있다. 또한, 상기 천연 탄수화물은 모노사카라이드, 디사카라이드, 폴리사카라이드, 올리고당 및 당알코올 등일 수 있다.The form and type of health functional food are not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids, and pills. The health functional food may contain various flavors, sweeteners, or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of natural sweeteners include thaumatin and stevia extract. Meanwhile, examples of synthetic sweeteners include saccharin and aspartame. Additionally, the natural carbohydrate may be monosaccharide, disaccharide, polysaccharide, oligosaccharide, sugar alcohol, etc.

본 발명의 건강기능식품은 상기 서술한 추가성분 외에, 영양제, 비타민, 전해질, 풍미제, 착색제, 펙스탄 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올 등을 더 포함할 수 있다. 이러한 성분은 독립적으로 또는 조합으로 사용될 수 있다. 상기 첨가제의 비율은 본 발명의 조성물의 100 중량부당 0.01 내지 0.1 중량부의 범위에서 선택될 수 있다.In addition to the additional ingredients described above, the health functional food of the present invention contains nutrients, vitamins, electrolytes, flavors, colorants, pexane and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, and preservatives. , glycerin, alcohol, etc. may be further included. These ingredients can be used independently or in combination. The ratio of the additive may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

이하, 본 발명을 하기 실시예에 의해 상세히 설명한다, 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 이들에 의해 본 발명이 제한되는 것은 아니다. 본 발명의 청구범위에 기재된 기술적 사상과 실질적으로 동일한 구성을 갖고 동일한 작용 효과를 이루는 것은 어떠한 것이라도 본 발명의 기술적 범위에 포함된다.Hereinafter, the present invention will be described in detail through the following examples. However, the following examples are only for illustrating the present invention and are not intended to limit the present invention thereto. Anything that has substantially the same structure as the technical idea described in the claims of the present invention and achieves the same operation and effect is included in the technical scope of the present invention.

실시예 1. 러버샤이 장미 꽃봉오리 추출물의 제조Example 1. Preparation of rubbershy rose bud extract

국내에서 육종된 신품종인 러버샤이(Love Shy, 출원2008-484)의 꽃봉오리를 이용하여 다음과 같은 방법으로 추출물을 제조하였다.An extract was prepared using the flower buds of Love Shy (application 2008-484), a new variety bred domestically, using the following method.

먼저, 러버샤이 꽃봉오리(경상북도 농업기술원 구미화훼연구소, 한국)의 건조물을 분쇄하여 80% 에탄올이 담긴 초음파 항온수조(ultrasonic water bath)에 넣었다. 이를 60 내지 70℃에서 2시간 동안 온탕 후, 1시간 동안 초음파 추출하였다. 이때, 추출 가수비는 49:1 (980 ㎖의 80% 에탄올 : 20 g 건조 장미 꽃봉오리)로 설정하였다. 추출 후, 추출액을 실온에서 냉각 및 여과하고 감압농축기(rotary vacuum evaporator N-N series, Eyela, 일본)를 사용하여 50 브릭스(brix)로 감압회전농축하여 러버샤이 장미 꽃봉오리 추출물을 수득하였다.First, the dried material of Lovershy flower buds (Gumi Flower Research Institute, Gyeongsangbuk-do Agricultural Research and Extension Services, Korea) was pulverized and placed in an ultrasonic water bath containing 80% ethanol. This was heated at 60 to 70°C for 2 hours and then ultrasonic extracted for 1 hour. At this time, the extraction water ratio was set to 49:1 (980 ml of 80% ethanol: 20 g of dried rose buds). After extraction, the extract was cooled and filtered at room temperature and rotary concentrated to 50 brix using a vacuum evaporator (rotary vacuum evaporator N-N series, Eyela, Japan) to obtain a rubbershy rose bud extract.

실시예 2. 러블리스칼렛 장미 꽃봉오리 추출물의 제조Example 2. Preparation of Lovely Scarlet Rose Bud Extract

러버샤이 대신, 러블리스칼렛(Lovely Scarlet, 출원2007-507)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 러블리스칼렛 장미 꽃봉오리 추출물을 제조하였다.Lovely Scarlet rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Lovely Scarlet, flower buds of Lovely Scarlet (application 2007-507) were used.

실시예 3. 러빙하트 장미 꽃봉오리 추출물의 제조Example 3. Preparation of Loving Heart Rose Bud Extract

러버샤이 대신, 러빙하트(Loving Heart, 출원2007-508)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 러빙하트 장미 꽃봉오리 추출물을 제조하였다.Loving Heart rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Lovershy, flower buds of Loving Heart (Application 2007-508) were used.

실시예 4. 레드퍼퓸 장미 꽃봉오리 추출물의 제조Example 4. Preparation of red perfume rose bud extract

러버샤이 대신, 레드퍼퓸(Red Perfume, 출원2015-215)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 레드퍼퓸 장미 꽃봉오리 추출물을 제조하였다.Red Perfume rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Red Perfume (Application 2015-215) were used.

실시예 5. 루미너스 장미 꽃봉오리 추출물의 제조Example 5. Preparation of luminous rose bud extract

러버샤이 대신, 루미너스(Luminus, 출원2014-198)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 루미너스 장미 꽃봉오리 추출물을 제조하였다.Luminus rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Luminus (application 2014-198) were used.

실시예 6. 미리내골드 장미 꽃봉오리 추출물의 제조Example 6. Preparation of Mirinaegold rose bud extract

러버샤이 대신, 미리내골드(Mirinae Gold, 출원2007-509)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 미리내골드 장미 꽃봉오리 추출물을 제조하였다.Mirinae Gold rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Mirinae Gold (application 2007-509) were used.

실시예 7. 베티 장미 꽃봉오리 추출물의 제조Example 7. Preparation of Betty Rose Bud Extract

러버샤이 대신, 베티(Betty, 출원2012-205)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 베티 장미 꽃봉오리 추출물을 제조하였다.Betty rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Betty (Applied 2012-205) were used.

실시예 8. 비치나 장미 꽃봉오리 추출물의 제조Example 8. Preparation of Vichina rose bud extract

러버샤이 대신, 비치나(Bichina, 출원2003-64)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 비치나 장미 꽃봉오리 추출물을 제조하였다.Bichina rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Bichina (application 2003-64) were used.

실시예 9. 에일린 장미 꽃봉오리 추출물의 제조Example 9. Preparation of Eileen Rose Bud Extract

러버샤이 대신, 에일린(Aileen, 출원2011-219)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 에일린 장미 꽃봉오리 추출물을 제조하였다.Aileen rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, Aileen (Aileen, application 2011-219) flower buds were used.

실시예 10. 온누리 장미 꽃봉오리 추출물의 제조Example 10. Preparation of Onnuri rose bud extract

러버샤이 대신, 온누리(Onnuri, 출원2002-3)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 온누리 장미 꽃봉오리 추출물을 제조하였다.Onnuri rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Onnuri (Applied 2002-3) were used.

실시예 11. 유니나 장미 꽃봉오리 추출물의 제조Example 11. Preparation of Yunina rose bud extract

러버샤이 대신, 유니나(Yunina, 출원2002-2)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 유니나 장미 꽃봉오리 추출물을 제조하였다.Yunina rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, Yunina (application 2002-2) flower buds were used.

실시예 12. 재미나레드 장미 꽃봉오리 추출물의 제조Example 12. Preparation of Jaminared rose bud extract

러버샤이 대신, 재미나레드(Jaemina Red, 출원2006-406)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 재미나레드 장미 꽃봉오리 추출물을 제조하였다.Jaemina Red rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, Jaemina Red (application 2006-406) flower buds were used.

실시예 13. 진선미 장미 꽃봉오리 추출물의 제조Example 13. Preparation of Jinseonmi rose bud extract

러버샤이 대신, 진선미(Jinseonmi, 출원2002-4)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 진선미 장미 꽃봉오리 추출물을 제조하였다.Jinseonmi rose bud extract was prepared under the same conditions and methods as in Example 1, except that Jinseonmi (application 2002-4) flower buds were used instead of Rubbershy.

실시예 14. 칠백리 장미 꽃봉오리 추출물의 제조Example 14. Preparation of Chilbaekli rose bud extract

러버샤이 대신, 칠백리(Chilbaegri, 출원2003-66)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 칠백리 장미 꽃봉오리 추출물을 제조하였다.An extract of Chilbaegri rose buds was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Chilbaegri (Chilbaegri, application 2003-66) were used.

실시예 15. 타미나 장미 꽃봉오리 추출물의 제조Example 15. Preparation of Tamina rose bud extract

러버샤이 대신, 타미나(Tamina, 출원2003-453)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 타미나 장미 꽃봉오리 추출물을 제조하였다.Tamina rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Tamina (Application 2003-453) were used.

실시예 16. 탐나리 장미 꽃봉오리 추출물의 제조Example 16. Preparation of Tamnari rose bud extract

러버샤이 대신, 탐나리(Tamnari, 출원2005-531)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 탐나리 장미 꽃봉오리 추출물을 제조하였다.Tamnari rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Tamnari (application 2005-531) were used.

실시예 17. 프리티벨벳 장미 꽃봉오리 추출물의 제조Example 17. Preparation of pretty velvet rose bud extract

러버샤이 대신, 프리티벨벳(Pretty Velvet, 출원2008-483)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 프리티벨벳 장미 꽃봉오리 추출물을 제조하였다.A Pretty Velvet rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubber Shy, pretty Velvet (application 2008-483) flower buds were used.

실시예 18. 피치그레이스 장미 꽃봉오리 추출물의 제조Example 18. Preparation of Peach Grace rose bud extract

러버샤이 대신, 피치그레이스(Peach Grace, 출원2011-136)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 피치그레이스 장미 꽃봉오리 추출물을 제조하였다.Peach Grace rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Peach Grace (application 2011-136) were used.

실시예 19. 핑크러브 장미 꽃봉오리 추출물의 제조Example 19. Preparation of pink love rose bud extract

러버샤이 대신, 핑크러브(Pink Love, 출원2014-195)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 핑크러브 장미 꽃봉오리 추출물을 제조하였다.Pink Love rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Loveshy, flower buds of Pink Love (Pink Love, application 2014-195) were used.

실시예 20. 핑크퍼퓸 장미 꽃봉오리 추출물의 제조Example 20. Preparation of pink perfume rose bud extract

러버샤이 대신, 핑크퍼퓸(Pink Perfume, 출원2015-249)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 핑크퍼퓸 장미 꽃봉오리 추출물을 제조하였다.Pink perfume rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Pink Perfume (Pink Perfume, application 2015-249) were used.

실시예 21. 하나로 장미 꽃봉오리 추출물의 제조Example 21. Preparation of Hanaro rose bud extract

러버샤이 대신, 하나로(Hanaro, 출원2005-530)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 하나로 장미 꽃봉오리 추출물을 제조하였다.Hanaro rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Hanaro (Hanaro, application 2005-530) were used.

실시예 22. 한아람 장미 꽃봉오리 추출물의 제조Example 22. Preparation of Han Aram rose bud extract

러버샤이 대신, 한아람(Hanaram, 출원2005-532)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 한아람 장미 꽃봉오리 추출물을 제조하였다.An extract of Hanaram rose buds was prepared under the same conditions and methods as in Example 1, except that instead of rubbershy, flower buds of Hanaram (Hanaram, application 2005-532) were used.

실시예 23. 향기나 장미 꽃봉오리 추출물의 제조Example 23. Preparation of fragrant rose bud extract

러버샤이 대신, 향기나(Hanggina, 출원2002-1)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 향기나 장미 꽃봉오리 추출물을 제조하였다.An extract of Hanggina rose buds was prepared under the same conditions and methods as in Example 1, except that flower buds of Hanggina (Applied 2002-1) were used instead of Rubbershy.

실시예 24. 아이스윙 장미 꽃봉오리 추출물의 제조Example 24. Preparation of Icewing rose bud extract

러버샤이 대신, 아이스윙(Ice Wing, 출원2013-73)의 꽃봉오리를 이용한 것을 제외하고는, 실시예 1과 동일한 조건 및 방법으로 아이스윙 장미 꽃봉오리 추출물을 제조하였다.Ice Wing rose bud extract was prepared under the same conditions and methods as in Example 1, except that instead of Rubbershy, flower buds of Ice Wing (Application 2013-73) were used.

실험예 1. 총 폴리페놀 함량Experimental Example 1. Total polyphenol content

상기에서 제조된 24종류의 장미 꽃봉오리 추출물에 포함된 총 폴리페놀의 함량을 폴린-시오칼투 페놀 시약(Folin-Ciocalteu's phenol reagent)을 이용하여 측정하였다.The total polyphenol content contained in the 24 types of rose bud extracts prepared above was measured using Folin-Ciocalteu's phenol reagent.

먼저, 실시예 1 내지 24의 장미 꽃봉오리 추출물의 농도를 1 ㎎/㎖로 맞추고, 100 ㎕의 장미 꽃봉오리 추출물에 2 ㎖의 2% Na2CO3를 첨가하였다. 이를 3분 동안 반응시킨 후, 100 ㎕의 폴린-시오칼투 페놀 시약을 첨가하고, 30분 동안 더 방치하였다. 이후, 750 ㎚의 파장에서 반응액의 흡광도를 측정하였다. 이때, 표준물질로서 10, 20, 30, 40 또는 50배로 희석한 갈릭산(gallic acid, Sigma-Aldrich, 미국)을 사용하여 표준검량선을 작성하였다. 상기 측정된 흡광도 값을 이용하여 폴리페놀의 함량을 추출물 1 g 중, ㎎ 갈릭산의 양으로 계산하여 도 1에 나타내었다.First, the concentration of the rose bud extract of Examples 1 to 24 was set to 1 mg/ml, and 2 ml of 2% Na 2 CO 3 was added to 100 ㎕ of the rose bud extract. After reacting for 3 minutes, 100 ㎕ of Folin-Ciocaltu phenol reagent was added and left for another 30 minutes. Afterwards, the absorbance of the reaction solution was measured at a wavelength of 750 nm. At this time, a standard calibration curve was prepared using gallic acid (Sigma-Aldrich, USA) diluted 10, 20, 30, 40, or 50 times as a standard material. Using the measured absorbance value, the polyphenol content was calculated as the amount of mg gallic acid in 1 g of extract and is shown in Figure 1.

도 1에 나타난 바와 같이, 24종류의 장미 꽃봉오리 추출물물 중에서, 실시예 1, 4, 10, 12, 17, 23 및 24의 추출물에서 총 폴리페놀 함량이 유의적으로 높았다. 특히, 총 폴리페놀의 함량이 가장 높은 실시예 1은 실시예 14보다 약 3.5배 높은 총 폴리페놀 함량을 나타내었다.As shown in Figure 1, among 24 types of rose bud extracts, the total polyphenol content was significantly high in the extracts of Examples 1, 4, 10, 12, 17, 23, and 24. In particular, Example 1, which had the highest total polyphenol content, showed a total polyphenol content about 3.5 times higher than that of Example 14.

실험예 2. 항산화 활성Experimental Example 2. Antioxidant activity

상기에서 제조된 24종류의 장미 꽃봉오리 추출물의 항산화 활성을 ABTS (2,2-azino-bis(3-ethylbenzothiazoline 6-sulfonic acid) 및 DPPH (1,1-diphenyl-2-picrylhydrazyl) 소거능 측정 방법으로 확인하였다.The antioxidant activity of the 24 types of rose bud extracts prepared above was measured using the ABTS (2,2-azino-bis(3-ethylbenzothiazoline 6-sulfonic acid) and DPPH (1,1-diphenyl-2-picrylhydrazyl) scavenging ability measurement method. Confirmed.

2-1. ABTS 소거능 측정2-1. ABTS erasing ability measurement

먼저, ABTS 라디칼 양이온 용액(7 mM)을 2.45 mM의 칼륨과 황산염 용액에 첨가하고, 실온의 어두운 곳에서 12 내지 16시간 동안 잘 교반하였다. 이를 증류수로 희석하여 735 ㎚의 파장에서 1.4 내지 1.5의 흡광도가 되도록 하였다. 상기 1 ㎖의 희석된 ABTS 라디칼 양이온 용액에 0.5 ㎎/㎖ 농도의 실시예 1 내지 24 추출물을 50 ㎕ 첨가하였고, 이때 대조군으로서 증류수를 사용하였다. 1시간 후, 상기 혼합액을 분광광도계를 이용하여 753 ㎚의 파장에서 흡광도를 측정하였다. 측정된 흡광도 값을 이용하여 대조군과 시험군 사이의 흡광도 차이를 추출물 1 g 중, ㎎ 아스코르브산(AA)의 양으로 계산하여 도 2에 나타내었다.First, ABTS radical cation solution (7mM) was added to 2.45mM potassium and sulfate solution and stirred well for 12 to 16 hours in the dark at room temperature. This was diluted with distilled water to obtain an absorbance of 1.4 to 1.5 at a wavelength of 735 nm. 50 μl of the extracts of Examples 1 to 24 at a concentration of 0.5 mg/ml were added to 1 ml of the diluted ABTS radical cation solution, and distilled water was used as a control. After 1 hour, the absorbance of the mixed solution was measured at a wavelength of 753 nm using a spectrophotometer. Using the measured absorbance value, the difference in absorbance between the control group and the test group was calculated as the amount of mg ascorbic acid (AA) in 1 g of extract and is shown in Figure 2.

도 2에 나타난 바와 같이, 24종류의 장미 꽃봉오리 추출물물 중에서, 실시예 1, 4, 10, 12, 17, 23 및 24의 추출물이 유의적으로 더욱 우수한 ABTS 소거능을 나타내었다.As shown in Figure 2, among 24 types of rose bud extracts, the extracts of Examples 1, 4, 10, 12, 17, 23, and 24 showed significantly better ABTS scavenging ability.

2-2. DPPH 소거능 측정2-2. DPPH scavenging ability measurement

먼저, 0.1 ㎎/㎖ 농도의 실시예 1 내지 24 추출물 0.2 ㎖에 0.8 ㎖의 0.2 mM DPPH 용액(Sigma-Aldrich, 미국)을 첨가하고 실온에서 30분 동안 반응시켰다. 이때 대조군으로서 증류수를 사용하였다. 이후, 520 ㎚의 파장에서 흡광도를 측정하였다. 측정된 흡광도 값을 이용하여 대조군과 시험군 사이의 흡광도 차이를 추출물 1 g 중, ㎎ 아스코르브산의 양으로 계산하여 도 3에 나타내었다.First, 0.8 ml of 0.2 mM DPPH solution (Sigma-Aldrich, USA) was added to 0.2 ml of the extracts of Examples 1 to 24 at a concentration of 0.1 mg/ml and reacted at room temperature for 30 minutes. At this time, distilled water was used as a control. Afterwards, the absorbance was measured at a wavelength of 520 nm. Using the measured absorbance value, the difference in absorbance between the control group and the test group was calculated as the amount of mg ascorbic acid in 1 g of extract and is shown in Figure 3.

도 3에 나타난 바와 같이, 24종류의 장미 꽃봉오리 추출물물 중에서, 실시예 1, 4, 10, 12, 17, 23 및 24의 추출물이 유의적으로 더욱 우수한 DPPH 소거능을 나타내었다.As shown in Figure 3, among 24 types of rose bud extracts, the extracts of Examples 1, 4, 10, 12, 17, 23, and 24 showed significantly better DPPH scavenging ability.

실험예 3. 항염증 활성-(1)Experimental Example 3. Anti-inflammatory activity-(1)

상기에서 제조된 24종류의 장미 꽃봉오리 추출물의 항염증 활성을 산화질소(NO) 생성 억제 효과를 통해 확인하였다.The anti-inflammatory activity of the 24 types of rose bud extracts prepared above was confirmed through the inhibitory effect on nitric oxide (NO) production.

먼저, RAW264.7 세포주(ATCC, 미국)를 웰당 5×105개가 되도록 96-웰 플레이트에 분주하고, 하룻밤동안 배양하였다. 배양된 세포에 1 ㎍/㎖의 LPS (lipopolysaccharide)를 첨가하고, 100 ㎍/㎖의 실시예 1 내지 24의 추출물을 처리하였다. 이를 24시간 동안 배양하고, 원심분리하여 100 ㎕의 상층액을 회수하여, 여기에 동량의 그리스 용액(Griess reagent, Promega, 미국)을 첨가하였다. 10분 후, 540 ㎚의 파장에서 흡광도를 측정하였다. 이때, 아질산 나트륨(sodium nitrite)로 표준검량선을 작성하고, 이를 이용하여 측정된 흡광도로부터 산화질소의 농도를 계산하였다. 그 결과, 산화질소의 농도를 도 4에 나타내었다.First, the RAW264.7 cell line (ATCC, USA) was dispensed into a 96-well plate at 5×10 5 cells per well and cultured overnight. 1 μg/ml of LPS (lipopolysaccharide) was added to the cultured cells, and 100 μg/ml of the extracts of Examples 1 to 24 were treated. This was cultured for 24 hours, centrifuged to recover 100 ㎕ of supernatant, and the same amount of Griess solution (Griess reagent, Promega, USA) was added thereto. After 10 minutes, absorbance was measured at a wavelength of 540 nm. At this time, a standard calibration curve was prepared using sodium nitrite, and the concentration of nitric oxide was calculated from the measured absorbance using this. As a result, the concentration of nitric oxide is shown in Figure 4.

도 4에 나타난 바와 같이, 24종류의 장미 꽃봉오리 추출물물 중에서, 실시예 1, 4, 10, 12, 17, 23 및 24의 추출물이 유의적으로 더욱 우수한 산화질소 억제 활성을 나타내었다.As shown in Figure 4, among 24 types of rose bud extracts, the extracts of Examples 1, 4, 10, 12, 17, 23, and 24 showed significantly better nitric oxide inhibitory activity.

실험예 4. 세포독성Experimental Example 4. Cytotoxicity

상기에서 가장 우수한 항산화 및 항염증 활성을 나타낸 실시예 17의 추출물을 사용하여 세포독성을 확인하였다.Cytotoxicity was confirmed using the extract of Example 17, which showed the best antioxidant and anti-inflammatory activity.

먼저, RAW264.7 세포주를 웰당 5×105개가 되도록 96-웰 플레이트에 분주하고, 하룻밤동안 배양하였다. 배양된 세포에 0.3, 1, 3, 10, 30 또는 100 ㎍/㎖의 실시예 17 추출물을 첨가하고, 24시간 동안 반응시켰다. 이후, 10%의 MTT (5 ㎎/㎖)가 포함된 DMEM을 100 ㎕ 첨가하고, 37℃ 및 5% CO2 조건하에서 1시간 동안 배양하였다. 배지를 제거하고, 100 ㎕의 DMSO를 첨가하여 540 ㎚의 파장에서 흡광도를 측정하였다. 그 결과, 측정된 흡광도 값으로부터 통상적인 방법으로 세포 생존율을 계산한 결과 그래프를 도 5에 나타내었다.First, the RAW264.7 cell line was distributed in a 96-well plate at 5×10 5 cells per well and cultured overnight. 0.3, 1, 3, 10, 30, or 100 μg/ml of the extract of Example 17 was added to the cultured cells, and reacted for 24 hours. Afterwards, 100 ㎕ of DMEM containing 10% MTT (5 mg/ml) was added, and cultured for 1 hour at 37°C and 5% CO 2 conditions. The medium was removed, 100 μl of DMSO was added, and the absorbance was measured at a wavelength of 540 nm. As a result, the cell viability was calculated using a conventional method from the measured absorbance value, and a graph showing the results is shown in Figure 5.

도 5에 나타난 바와 같이, 실시예 17의 장미 꽃봉오리 추출물은 세포독성을 나타내지 않았다.As shown in Figure 5, the rose bud extract of Example 17 did not show cytotoxicity.

실험예 5. 항염증 활성-(2)Experimental Example 5. Anti-inflammatory activity-(2)

실시예 17의 장미 꽃봉오리 추출물을 사용하여 iNOS (inducible nitric oxide synthase) 및 COX-2 (cyclooxygenase-2) 유전자의 발현 변화를 qPCR 방법으로 다음과 같이 확인하였다.Using the rose bud extract of Example 17, changes in the expression of iNOS (inducible nitric oxide synthase) and COX-2 (cyclooxygenase-2) genes were confirmed by qPCR as follows.

먼저, RAW264.7 세포주를 웰당 5×105개가 되도록 24-웰 플레이트에 분주하고, 37℃ 및 5% CO2 조건하에서 하룻밤동안 배양하였다. 배양된 세포에 1 ㎍/㎖의 LPS, 및 10, 30 또는 100 ㎍/㎖의 실시예 17 추출물을 첨가하고, 24시간 동안 배양하였다. 배양이 끝난 후, RNAiso PLUS (TaKaRa, 일본)를 사용하여 제조사의 프로토콜에 따라 전체 RNA를 추출하고, 추출된 RNA 1 ㎍을 주형으로 통상적인 방법으로 cDNA를 합성하였다. 실시간 qPCR을 위한 샘플은 프라임스크립트™ RT 리에이전트 키트(TaKaRa, 일본) 및 gDNA 이레이져(Eraser) (TaKaRa, 일본)를 사용하여 준비하였고, 이때 사용된 프라이머의 서열은 하기 표 1에 나타내었다. 실시간 qPCR은 AriaMx 실시간 PCR 시스템(Agilent Technologies, 미국)을 사용하여 2-스텝 프로토콜에 따라 수행되었다(95℃에서 30초 반응시킨 후, 60℃에서 30초 동안 반응을 40회 반복). 그 결과, iNOS 및 COX-2 유전자 발현 변화를 대조군인 GAPDH (glyceraldehyde 3-phosphate dehydrogenate)를 기준으로 상대적인 값으로 나타낸 결과를 도 6에 나타내었다.First, the RAW264.7 cell line was distributed in a 24-well plate at 5×10 5 cells per well and cultured overnight at 37°C and 5% CO 2 conditions. 1 μg/ml of LPS and 10, 30, or 100 μg/ml of Example 17 extract were added to the cultured cells, and cultured for 24 hours. After incubation, total RNA was extracted using RNAiso PLUS (TaKaRa, Japan) according to the manufacturer's protocol, and cDNA was synthesized by a conventional method using 1 μg of the extracted RNA as a template. Samples for real-time qPCR were prepared using PrimeScript™ RT Reagent Kit (TaKaRa, Japan) and gDNA Eraser (TaKaRa, Japan), and the sequences of primers used are shown in Table 1 below. Real-time qPCR was performed using the AriaMx real-time PCR system (Agilent Technologies, USA) according to a 2-step protocol (reaction at 95°C for 30 seconds, followed by 40 repetitions of the reaction at 60°C for 30 seconds). As a result, the results showing changes in iNOS and COX-2 gene expression as relative values based on GAPDH (glyceraldehyde 3-phosphate dehydrogenate), a control group, are shown in Figure 6.

프라이머primer 서열(5'→3')Sequence (5'→3') 서열번호sequence number iNOS_FiNOS_F CAGGATCCAGTGGTCCAACCCAGGATCCAGTGGTCCAACC 서열번호 1SEQ ID NO: 1 iNOS_RiNOS_R CGTACCGGATGAGCTGTGAACGTACCGGATGAGCTGTGAA 서열번호 2SEQ ID NO: 2 COX-2_FCOX-2_F GTACAAGCAGTGGCAAAGGCGTACAAGCAGTGGCAAAGGC 서열번호 3SEQ ID NO: 3 COX-2_RCOX-2_R ACGAGGTTTTTCCACCAGCAACGAGGTTTTTCCACCAGCA 서열번호 4SEQ ID NO: 4 GAPDH_FGAPDH_F GACCTCATGGCCTACATGGCGACCTCATGGCCTACATGGC 서열번호 5SEQ ID NO: 5 GAPDH_RGAPDH_R GCCCCTCCTGTTATTATGGGGGCCCCTCCTGTTATTATGGGG 서열번호 6SEQ ID NO: 6

도 6에 나타난 바와 같이, LPS 처리에 의해 현저히 증가한 iNOS 및 COX-2 유전자의 발현이 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 6, the expression of iNOS and COX-2 genes, which were significantly increased by LPS treatment, was significantly suppressed by the rose bud extract of Example 17, and this was dependent on the treatment concentration of the extract.

실험예 6. 염증 매개체 수준 변화Experimental Example 6. Changes in levels of inflammatory mediators

실시예 17의 장미 꽃봉오리 추출물을 사용하여 염증 매개체인 NO 및 PGE2의 수준 변화를 다음과 같은 방법으로 확인하였다.Changes in the levels of inflammatory mediators NO and PGE2 were confirmed using the rose bud extract of Example 17 in the following manner.

구체적으로, 상기 실험예 5와 동일한 방법 및 조건으로 실시예 17의 추출물을 처리한 RAW264.7 세포주의 배양액을 회수하여 그리스(Griess) 시약 및 ELISA 키트(R&D 시스템, 미국)를 각각 사용하여 통상적인 방법으로 NO 및 PEG2의 수준을 확인하고, 그 결과를 도 7에 나타내었다.Specifically, the culture medium of the RAW264.7 cell line treated with the extract of Example 17 was recovered using the same method and conditions as in Experimental Example 5, and the conventional assay was performed using Griess reagent and ELISA kit (R&D Systems, USA), respectively. The levels of NO and PEG2 were confirmed using this method, and the results are shown in Figure 7.

도 7에 나타난 바와 같이, LPS 처리에 의해 현저히 증가한 NO 및 PEG2의 수준이 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 7, the levels of NO and PEG2, which were significantly increased by LPS treatment, were significantly suppressed by the rose bud extract of Example 17, and this was dependent on the treatment concentration of the extract.

실험예 7. 공기주머니(air-pouch) 염증에 의한 삼출물(exudation) 변화Experimental Example 7. Changes in exudation due to air-pouch inflammation

염증에 의해 혈액의 혈관외 유출과 체액의 누출이 유발되는데, 실시예 17의 장미 꽃봉오리 추출물에 의해 이와 같은 삼출물의 누출 변화를 다음과 같이 확인하였다.Inflammation causes extravasation of blood and leakage of body fluids, and such changes in exudate leakage were confirmed by the rose bud extract of Example 17 as follows.

먼저, 랫드를 이소플루란(isoflurane)으로 마취시킨 후, 주사기를 사용하여 20 ㎖의 멸균된 공기를 랫드의 등 중앙에 피하주사하였다. 공기를 주입한지 5일 및 6일째에 동량의 멸균 공기를 재주입하여 공기주머니의 크기를 유지시켰다. 24시간 후, 상기 공기주머니에 1 ㎖의 λ-카라기난을 주입하여 염증을 유도하고, λ-카라기난을 주입하기 30분 전에 10, 30 또는 100 ㎍/㎖의 실시예 17 추출물 공기주머니에 투여하였다. 이때, 양성 대조군으로서 2 ㎎/㎏의 덱사메타손 또는 인도메타신을 사용하였다. 한편, λ-카라기난을 주입 6시간 후, 2 ㎖의 차가운 식염수(0.9% NaCl)를 공기주머니에 주입하고 이를 부드럽게 마사지하였다. 이후, 랫드를 희생시키고, 삼출물을 회수하였다. 회수된 삼출물의 부피를 계산하고 여기서 주입된 식염수의 부피를 제하여 순수 삼출물의 부피를 얻었으며, 계산된 결과를 도 8에 나타내었다.First, the rat was anesthetized with isoflurane, and then 20 ml of sterilized air was injected subcutaneously into the center of the rat's back using a syringe. On the 5th and 6th days after air injection, the same amount of sterile air was reinjected to maintain the size of the air sac. After 24 hours, 1 ml of λ-carrageenan was injected into the air sac to induce inflammation, and 10, 30, or 100 μg/ml of Example 17 extract was administered to the air sac 30 minutes before the injection of λ-carrageenan. At this time, 2 mg/kg of dexamethasone or indomethacin was used as a positive control. Meanwhile, 6 hours after injection of λ-carrageenan, 2 ml of cold saline solution (0.9% NaCl) was injected into the air sac and gently massaged. Thereafter, the rat was sacrificed and the exudate was recovered. The volume of the recovered exudate was calculated and the volume of the injected saline was subtracted to obtain the volume of pure exudate, and the calculated results are shown in Figure 8.

도 8에 나타난 바와 같이, λ-카라기난에 의해 유도된 공기주머니 염증에 의해 삼출물의 부피가 현저히 증가하였으나, 이는 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 8, the volume of exudate was significantly increased due to air sac inflammation induced by λ-carrageenan, but this was significantly suppressed by the rose bud extract of Example 17, which depended on the treatment concentration of the extract. It was dependent.

실험예 8. 삼출물 내 염증성 세포Experimental Example 8. Inflammatory cells in exudate

상기 수득된 삼출물 내 염증성 세포의 수준이 실시예 17의 장미 꽃봉오리 추출물에 의해 변하는지 다음과 같은 방법으로 확인하였다.It was confirmed by the following method whether the level of inflammatory cells in the obtained exudate was changed by the rose bud extract of Example 17.

구체적으로, 상기 실험예 7에서 수득된 삼출물을 사용하여 혈액 분석기(hematology analyzer, IDEXX Procyte, 미국)로 백혈구, 호중구, 단핵구 및 림프구를 분석하고, 그 결과를 도 9에 나타내었다.Specifically, the exudate obtained in Experimental Example 7 was used to analyze white blood cells, neutrophils, monocytes, and lymphocytes using a hematology analyzer (IDEXX Procyte, USA), and the results are shown in FIG. 9.

도 9에 나타난 바와 같이, λ-카라기난에 의해 유도된 공기주머니 염증에 의해 백혈구, 호중구, 단핵구 및 림프구와 같은 염증성 세포의 수가 현저히 증가하였으나, 이는 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 9, the number of inflammatory cells such as leukocytes, neutrophils, monocytes and lymphocytes increased significantly due to air sac inflammation induced by λ-carrageenan, but this was significantly reduced by the rose bud extract of Example 17. was inhibited, which was dependent on the treatment concentration of the extract.

실험예 9. 삼출물 내 염증성 사이토카인Experimental Example 9. Inflammatory cytokines in exudate

상기 수득된 삼출물 내 염증성 사이토카인의 수준이 실시예 17의 장미 꽃봉오리 추출물에 의해 변하는지 다음과 같은 방법으로 확인하였다.It was confirmed by the following method whether the level of inflammatory cytokines in the obtained exudate was changed by the rose bud extract of Example 17.

구체적으로, 상기 실험예 7에서 수득된 삼출물로부터 ELISA 키트(R&D 시스템, 미국)를 사용하여 제조사의 프로토콜에 따라 TNF-α 및 IL-1β의 수준을 측정하고, 그 결과를 도 10에 나타내었다.Specifically, the levels of TNF-α and IL-1β were measured from the exudate obtained in Experimental Example 7 using an ELISA kit (R&D Systems, USA) according to the manufacturer's protocol, and the results are shown in Figure 10.

도 10에 나타난 바와 같이, λ-카라기난에 의해 유도된 공기주머니 염증에 의해 TNF-α 및 IL-1β의 수준이 현저히 증가하였으나, 이는 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 10, the levels of TNF-α and IL-1β were significantly increased by air sac inflammation induced by λ-carrageenan, but this was significantly suppressed by the rose bud extract of Example 17, This was dependent on the treatment concentration of the extract.

실험예 10. 삼출물 내 염증 매개체Experimental Example 10. Inflammatory mediators in exudate

상기 수득된 삼출물 내 염증성 매개체의 수준이 실시예 17의 장미 꽃봉오리 추출물에 의해 변하는지 다음과 같은 방법으로 확인하였다. 실험은 상기 실험예 7에서 수득된 삼출물을 시료로서 사용한 것을 제외하고는, 실험예 6과 동일한 조건 및 방법으로 수행되었다. 그 결과, 측정된 NO 및 PEG2의 수준을 도 11에 나타내었다.It was confirmed by the following method whether the level of inflammatory mediators in the obtained exudate was changed by the rose bud extract of Example 17. The experiment was conducted under the same conditions and methods as Experiment 6, except that the exudate obtained in Experiment 7 was used as a sample. As a result, the measured levels of NO and PEG2 are shown in Figure 11.

도 11에 나타난 바와 같이, λ-카라기난에 의해 유도된 공기주머니 염증에 의해 NO 및 PEG2의 수준이 현저히 증가하였으나, 이는 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 11, the levels of NO and PEG2 were significantly increased by air sac inflammation induced by λ-carrageenan, but this was significantly inhibited by the rose bud extract of Example 17, which was significantly inhibited by treatment of the extract. It was concentration dependent.

실험예 11. 혈관 면적 변화Experimental Example 11. Change in blood vessel area

일반적으로 염증은 홍반 및 부종을 유발하는 혈관확장을 동반한다. 이에, 상기 실험예 7에서 희생된 랫드의 등 피부를 사용하여 혈관 면적을 관찰하였다.Inflammation is generally accompanied by vasodilatation that causes erythema and edema. Accordingly, the blood vessel area was observed using the back skin of the rat sacrificed in Experimental Example 7.

구체적으로, 랫드의 등 피부를 채취하여 10% 중성 포르말린으로 고정하고, 파라핀으로 포매하였다. 파라핀 블록을 4 ㎛의 두께로 절단하여 절편을 수득하고, 수득된 절편을 헤마톡실린과 에오신으로 염색한 후, 광학현미경(Nikon, 일본)을 사용하여 관찰하였다. 그 결과, 수득된 이미지로부터 혈관 면적은 이미지-J 소프트웨어(NIH, 미국)를 사용하여 계산하였고, 계산된 결과를 도 12에 나타내었다.Specifically, the back skin of a rat was collected, fixed with 10% neutral formalin, and embedded in paraffin. The paraffin block was cut to a thickness of 4 ㎛ to obtain sections, and the obtained sections were stained with hematoxylin and eosin and observed using an optical microscope (Nikon, Japan). As a result, the blood vessel area was calculated from the obtained image using Image-J software (NIH, USA), and the calculated results are shown in FIG. 12.

도 12에 나타난 바와 같이, λ-카라기난에 의해 유도된 공기주머니 염증에 의해 랫드의 혈관 면적이 현저히 증가하였으나, 이는 실시예 17의 장미 꽃봉오리 추출물에 의해 유의적으로 억제되었으며, 이는 추출물의 처리 농도에 의존적이었다.As shown in Figure 12, the blood vessel area of rats was significantly increased due to air sac inflammation induced by λ-carrageenan, but this was significantly suppressed by the rose bud extract of Example 17, which was determined by the treatment concentration of the extract. was dependent on

Claims (7)

장미 추출물을 유효성분으로 함유하는 항염증용 화장료 조성물로서,
상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 화장료 조성물.
An anti-inflammatory cosmetic composition containing rose extract as an active ingredient,
The anti-inflammatory cosmetic composition wherein the rose is one or more selected from the group consisting of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna, and Ice Wing varieties.
제1항에 있어서, 상기 장미는 장미의 꽃잎, 줄기, 잎, 꽃받침 및 꽃봉오리로 구성된 군으로부터 선택되는 어느 하나 이상인, 항염증용 화장료 조성물.
The anti-inflammatory cosmetic composition according to claim 1, wherein the rose is at least one selected from the group consisting of rose petals, stems, leaves, calyxes, and buds.
제1항에 있어서, 상기 추출물이 물, C1 내지 C2의 저급 알코올 또는 이의 혼합물로 추출된, 항염증용 화장료 조성물.
The anti-inflammatory cosmetic composition according to claim 1, wherein the extract is extracted with water, a C 1 to C 2 lower alcohol, or a mixture thereof.
제3항에 있어서, 상기 C1 내지 C2의 저급 알코올이 에탄올, 메탄올 또는 주정인, 항염증용 화장료 조성물.
The anti-inflammatory cosmetic composition according to claim 3, wherein the C 1 to C 2 lower alcohol is ethanol, methanol, or alcohol.
장미 추출물을 유효성분으로 함유하는 항염증용 약학적 조성물로서,
상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 약학적 조성물.
An anti-inflammatory pharmaceutical composition containing rose extract as an active ingredient,
An anti-inflammatory pharmaceutical composition wherein the rose is one or more selected from the group consisting of Lovershy, Red Perfume, Onnuri, Jaminared, Pretty Velvet, Hyangna, and Icewing varieties.
장미 추출물을 유효성분으로 함유하는 항염증용 피부외용제로서,
상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 피부외용제.
An anti-inflammatory external skin preparation containing rose extract as an active ingredient,
The rose is an anti-inflammatory skin external agent that is at least one selected from the group consisting of Rubber Shy, Red Perfume, Onnuri, Jaina Red, Pretty Velvet, Hyangna, and Ice Wing varieties.
장미 추출물을 유효성분으로 함유하는 항염증용 건강기능식품으로서,
상기 장미는 러버샤이, 레드퍼퓸, 온누리, 재미나레드, 프리티벨벳, 향기나 및 아이스윙 품종으로 구성된 군으로부터 선택되는 어느 하나 이상인 항염증용 건강기능식품.
As an anti-inflammatory health functional food containing rose extract as an active ingredient,
The rose is an anti-inflammatory health functional food that is at least one selected from the group consisting of Rubber Shy, Red Perfume, Onnuri, Jaminar Red, Pretty Velvet, Hyangna and Ice Wing varieties.
KR1020230053348A 2022-04-25 2023-04-24 Composition for antiinflammation comprising rose extract as an active ingredient KR20230151919A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220050765 2022-04-25
KR20220050765 2022-04-25

Publications (1)

Publication Number Publication Date
KR20230151919A true KR20230151919A (en) 2023-11-02

Family

ID=88747781

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020230053348A KR20230151919A (en) 2022-04-25 2023-04-24 Composition for antiinflammation comprising rose extract as an active ingredient

Country Status (1)

Country Link
KR (1) KR20230151919A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220163330A (en) 2020-06-05 2022-12-09 대한민국(농촌진흥청장) Composition for anti-inflammation comprising extract from Tartary buckwheat

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220163330A (en) 2020-06-05 2022-12-09 대한민국(농촌진흥청장) Composition for anti-inflammation comprising extract from Tartary buckwheat

Similar Documents

Publication Publication Date Title
KR102065185B1 (en) Composition for Improving Skin Conditions with Improved Anti-Bacterial, Anti-inflammatory, Anti-wrinkling, and Skin Whitening Property
KR102313646B1 (en) Cosmetic composition for skin whitening containing complex extracts of Swertia Japonica, Hypericum Perforatum and Trichosanthes Kirilowii prepared by a method based on natural deep eutectic solvents
KR101780939B1 (en) Method for Seperation of Compound Derived from Ginseng and Composition for anti-inflammatory Using the same
KR20230151919A (en) Composition for antiinflammation comprising rose extract as an active ingredient
KR101865142B1 (en) Pharmaceutical composition containing combination extract of Spiraea prunifolia, Pyrus pyrifolia and Geum japonicum for prevention and treatment of allergic diease
KR102612017B1 (en) Composition for skin improvement comprising multiple extract
KR102486633B1 (en) Lipid accumulation inhibitory or anti-obesity composition comprising ergosterol peroxide as an active ingredient
KR20220022427A (en) Composition for skin-protective comprising saponarin and Ganoderma lucidum extract
KR102644047B1 (en) A composition for preventing or improving skin wrinkles or skin thermal aging comprising rosa multiflora extracts
KR102443334B1 (en) Composition with Anti-Inflammation, Skin Moisturizing, Pruritis Improving, and Skin Regeneration Property Comprising Complex Extract of Hibiscus Syriacus as Active Ingredient
KR102270290B1 (en) Composition for Improving Skin Conditions Comprising Complex Extract of Pearl
KR102642293B1 (en) Composition for preventing or treating skin diseases comprising wikstroemia ganpi
KR102694743B1 (en) Anti-microbial composition comprising biorenovation extract of Lycium chinense sprout as effective component
KR102692062B1 (en) A cosmetic composition having anti-oxidant, anti-inflammatory, protection of skin cell induced by ultraviolet ray and skin whitening effects comrising camellia sinensis extract, rumex crispus extract and inula britannica extract
KR102703489B1 (en) Cosmetic composition for skin moisturizing, soothing and anti-inflammation containing the complex extracts of Artemisia Capillaris, Chamomilla Recutita(Matricaria), Amomum Xanthioides, Inula Britannica and Mallotus Japonicus
KR101464406B1 (en) Composition containing extracts or fractions of tilia taquetii schneid as an active ingredient and its use
KR102600557B1 (en) A composition having anti-inflammation activity comprising compounds isolated from the fraction of the Podocarpus macrophyllus extracts as an active ingredient
KR102014646B1 (en) Compound from Caragana sinica and composition for skin whitening comprising the same
KR102076746B1 (en) Mixed cosmetic composition comprising flower
KR102179531B1 (en) Composition for preventing or treating psoriasis comprising sesquiterpenoid compounds or sesquiterpenoids enriched fraction derived from Tussilago farfara
KR20180035575A (en) A composition comprising Hygrophila megalantha Merr. extracts having anti-inflammation activity
KR101864607B1 (en) Composition comprising pinocembrin for preventing or treating atopic dermatitis
KR101862750B1 (en) Composition for skin conditions improvement comprising fractions of honeybush extracts and compounds derived from the same
KR20230080033A (en) Pharmaceutical composition comprising green tea extract extracted with natural eutectic solvents as an active ingredient
KR20230101739A (en) Cosmetic composition for skin improvement comprising Elaeocarpus sylvestris var. ellipticus extract