KR20230124843A - Breeding method for brown rice using KASP marker-assisted backcrossing and rice having thin seed coat and aleurone layer produced by the method - Google Patents

Abstract

The present invention relates to a method for growing rice for brown rice using backcrossing using KASP markers, and rice with thin seed coat and altruistic layers grown by the method. It was developed for brown rice with a reduced thickness, and can be used as a material for cultivating rice varieties. As it is a functional crop, it is expected to contribute to increasing the income of rice farmers.

Description

Breeding method for brown rice using KASP marker-assisted backcrossing and rice having thin seed coat and aleurone layer produced by the method }

The present invention relates to a method for growing rice for brown rice using backcrossing using KASP (kompetitive allele specific PCR) markers, and rice with thin seed coat and aleurone layer grown by the method.

The quantity of rice is determined by various environmental and cultivation factors in the process from sowing to harvest, but the taste of rice is governed by various factors such as harvest management, polishing, and cooking until it reaches the table. Recently, as rice food has been upgraded and diversified, seolgaeng and large eyes are being cultivated and supplied as brown rice varieties with excellent taste. Compared to rice, brown rice is rich in nutrients such as protein, dietary fiber, and vitamins, so consumers prefer it as a diet and health functional food. However, brown rice has a problem in that the texture is somewhat rough even after cooking because the rice bran layer is thick and moisture absorption is difficult due to differences in structural characteristics. In addition, existing varieties for brown rice are manufactured and distributed mainly in glutinous and medium-irritant varieties in consideration of cooking characteristics and texture, but there is inconvenience for consumers who need dietary therapy for the purpose of blood sugar control.

Studies on the traits related to the taste of rice, starting with amylose content, gelatinization temperature and gel consistency, have revealed the functions of enzymes and genes related to taste based on genetic studies. are losing Starch is composed mainly of amylose and amylopectin. Amylose is mainly composed of α-1,4-linked glucose molecules and a few α-1,6-linked long linear chains, and amylopectin consists of short α-1,4-linked glucose molecules and more frequent α-1,6 branches. These two types of molecules combine to form semi-crystalline starch granules, which contain lipids. Phosphate and phosphorus are combined, and the ratio of these varies depending on the species, and the ratio can influence the style. Amylopectin is synthesized by the coordinated action of ADP-Glc pyrophosphorylase (AGPase), soluble starch synthase (SS), starch-branching enzyme (SBE), starch-debranching enzyme, and granule-bound starch synthase (GBSS). SS genes are known to exist and are expressed in the endosperm .

Molecular breeding techniques used to identify genes related to major agricultural traits can be roughly divided into QTL (Quantitative Trait Locus) analysis and GWAS (Genome-wide association study) analysis. First, the QTL analysis method is a technology that analyzes genes involved in the expression of traits by using the genetic separation of a cross group between two breeds, such as F2 or RIL (recombinant inbred line), but GWAS technology deciphers the genome of each breed and compares them. It has recently been in the limelight as a study that can easily isolate genes related to specific traits by analysis. SNP (single nucleotide polymorphism) molecular markers can distinguish only one base sequence difference, so the frequency of markers that can be developed in the genome is high, so it is possible to distinguish between genetically very close lineages, and automated analysis is possible It can be used as a molecular marker to distinguish breeding lines in

In order to increase breeding efficiency, shortening the breeding period is essential, and therefore, extraction of useful genetic resources combined with genomic information and development of molecular marker technology are emerging as core competencies. Until now, the development of trait-related molecular markers has been developed centering on traits regulated by a single gene, but genome-wide SNP selection available for each mating combination for marker-assisted backcrossing (MAB) selection for generation reduction need this In addition, it is necessary to produce and provide practical information for breeding, such as development of molecular markers that can identify linkage dragging to be removed during the breeding process, trait-related markers for gene pyramiding, and prediction of offspring using crossover rates. do.

On the other hand, Korean Patent Publication No. 2015-0014347 discloses 'Low Amylose Rice Plant Truth No. 2', which was selected by artificially crossing the low-amylose strain of Dongjinchal/Milky Queen hybridization as a parent, with Junambyeo, which is a multiplicity of naedobok, as a model. ' is disclosed, and in Korean Patent No. 1555256, the four-way hybridization lineage of Junambyeo and Chucheongbyeo//Yumetsukushi/ traditional flavor varieties is used as the mother, and the low-amylose lineage following the hybridization of Yumetsukushi/Milky Queen variety is used as the parent. Although a 'new flavor with low amylose content' selected by artificial crossing is disclosed, 'a method for growing rice for brown rice using backcrossing using a KASP marker and rice with a thin seed coat and alkaloid layer grown by the method' of the present invention are disclosed. nothing is listed

The present invention was derived from the above needs, and the present inventors used seolgaeng, known as a high-quality brown rice variety among domestic breeding varieties, as a donor parent to foster a brown rice strain with improved taste and processing aptitude of Samkwang variety, BC1F1 and in the BC2F1 generation, genes related to the high quality of brown rice in Seolgaeng were selected in the foreground through marker-assisted backcrossing, and then four individuals with a high genome recovery rate of 98.65% of Samgwang, a recurrent parent, were selected in the background. After that, when the seed coat and aleurone layer thickness of the seeds harvested from the selected individuals were measured, the present invention was completed by cultivating lines showing a thickness similar to seolgaeng that was thinner than Samgwang in BC2F2.

In order to solve the above problems, the present invention is obtained by artificially crossing Samgwang rice as a mother and seolgaeng rice as a mother, and the seed coat and aleurone layer are thinner than the mother Samkwang rice, and the secondary Provides seeds of rice SS50-26 (accession number: KACC 98129P), which has a higher number of tillering than that of Seolgangbyeo.

In addition, the present invention is derived from the seeds of the rice SS50-26, characterized in that the seed coat and alder layer are thinner than the mother Samkwang rice, and the rice SS50-26 plant has a higher number of tillers than the parent rice, Seolgaengbyeo. to provide.

In addition, the present invention provides seeds of monohybrid rice plants produced by crossing rice SS50-26 plants with other rice varieties.

In addition, the present invention provides a rice transgenic plant obtained by transforming a rice SS50-26 plant and a transformed seed thereof.

In addition, the present invention provides a processed rice food prepared using the seeds of rice SS50-26.

In addition, the present invention has thin seed coats and alyosome layers, including the step of selecting using molecular markers for the BC _n F1 (n is a positive integer of 3 or less) generation with Samgwang rice as a recurrent parent. A method for growing rice is provided.

The rice 'SS50-26' according to the present invention was developed for brown rice by lowering the thickness of the seed coat and aleurone layer in Samgwang, a high-quality rice, and the rice strain of the present invention can be used as a material for cultivating rice varieties, and since it is a functional crop, rice It is expected to contribute to increasing the income of growers.

Figure 1A shows the positions of target SNPs and primer sets in the SSIIa gene, and Figure 1B shows primer sets and binding temperatures for nested PCR.
Figure 2 shows the location on the rice chromosome of 96 KASP markers for background selection.
Figure 3 shows the results of genome recovery rate analysis using 96 KASP markers for Samgwang/Seolgaeng BC1F1 individuals obtained through Foreground selection.
Figure 4 shows the distribution of the genome recovery rate of the recurrent parent in the Samgwang/Seolgaeng BC1F1 population.
Figure 5 shows the phenotypes of the top 6 individuals with recurrent parent genome recovery among the Samgwang/Seolgaeng BC2F1 individuals obtained through Foreground selection.
6 shows the results of histochemical staining of the seed coat and aleurone layer of Samgwang, Seolgaeng, and Samgwang/Seolgaeng BC2F1 individuals.
Figure 7 shows the thickness of the seed coat and aleurone layer of Samgwang, Seolgaeng and Samgwang/Seolgaeng BC2F1 individuals.

In order to achieve the object of the present invention, the present invention is obtained by artificially crossing Samgwang rice as the mother and Seolgaeng rice as the mother, and the seed coat and aleurone layer are thinner than the mother Samkwang rice, Provided are seeds of rice SS50-26 (accession number: KACC 98129P), which have a higher number of tillering than rice, and plants of rice SS50-26, characterized in that they are derived from the seeds.

In the present invention, the "Samkwang Rice" is a breed selected by the National Institute of Food Science, Rural Development Administration, in the summer of 1989, by artificially crossing Suwon No. 361 as a mother and Miryang No. 101 as a parent, and breeding and selection by the systematic breeding method, in June 2006 On the 16th, it is a variety registered in Korea for variety protection as No. 1595. In addition, for the purpose of cultivating starch material, the seolgaengbyeo is group selected by mutating high-quality, high-quality, excellent rice at the crop test site, and selected for breeding by the systematic breeding method from M4 onwards. This is a cultivar selected and nurtured for medium-hardening Ilpum 10-2-GH1-3-1-3 lines, which are intermediate between rice and glutinous rice, and registered for variety protection as No. 406 in Korea on May 16, 2003

In the present invention, the term "alaurin layer" refers to a layer surrounding endosperm as a tissue of Poaceae plant seeds. The endosperm (endosperm) mainly stores starch, but the aleurone layer mainly stores proteins and fats. In rice, maize, wheat, and oats, the aleurone layer is one layer, whereas in barley it is multiple layers.

In the present invention, the thicknesses of the seed coat and alye layer of Samgwang rice and Seolgaeng rice used as parent/mother rice are 30.91 μm and 11.83 μm, respectively, and the seed coat and alye layer thickness of rice SS50-26 are 15.42 μm.

The present inventors named a representative sample (seed) of rice SS50-26, which has a thinner aleurone layer of seed coat than Samgwang rice, as " Oryza sativa L. SS50-26", and as of February 21, 2022, the National Academy of Agricultural Sciences (KACC) (accession number: KACC 98129P).

The rice SS50-26 'plant' of the present invention includes all of the whole plant or parts of the plant. The 'part body' of the plant according to the present invention is not limited thereto, but may include inflorescences, leaves, roots, stems, etc. of rice SS50-26.

The present invention also provides seeds of monohybrid rice plants produced by crossing rice SS50-26 plants with other rice varieties. The crossing may be carried out according to a method known to those skilled in the art related to plant breeding, and since the rice SS50-26 according to the present invention is characterized by thin seed coat and aleurone layer, the SS50-26 plant is rice It can be used as a parent/supplement material for breeding new varieties.

The present invention also provides a rice transgenic plant obtained by transforming a rice SS50-26 plant and a transformed seed thereof. The transformation method can be achieved through various techniques known in the art, and the transgenic rice plants according to the present invention include all transgenic plants having a genetic background of rice plants derived from SS50-26 seeds. .

The present invention also provides a processed rice food prepared using the seeds of rice SS50-26 (accession number: KACC 98129P). The rice processed food according to the present invention may be retort rice, alpha rice, frozen rice, noodles, porridge, rice cakes, confectionery, beverages, alcoholic beverages, red pepper paste, soybean paste, vinegar or rice bran, but is not limited thereto.

The present invention also relates to the BC _n F1 (n is a positive integer of 3 or less) generation with Samkwang rice as a recurrent parent, using molecular markers to select seed coats and calluses with thin layers. A method for growing rice is provided.

In the present invention, the term "backcross parent" refers to the parent of the hybrid in the case of recrossing or repeated mating with any one parent of the hybrid and its parents. In the present specification, the "recurrent parent" is used interchangeably with the "recurrent parent".

The method for growing rice with a thin seed coat and aleurone layer according to the present invention is specifically,

(a) sowing the seeds of Samgwangbyeo, which is the parent, and Seolgaengbyeo, which is the parent, respectively;

(b) artificially crossing Samgwangbyeo, the parent, and Seolgaengbyeo, the parent, during flowering;

(c) backcrossing the F1 obtained from the crossing in step (b) with Samgwang rice, which is the parent;

(d) primary selection of individuals having a soluble starch synthase IIa ( SSIIa ) genotype of seolgaengbyeo using molecular markers in the BC1F1 generation obtained from the mating in step (c);

(e) performing secondary selection (background selection) of individuals exhibiting a genome recovery rate of 80% or more by using a kompetitive allele specific PCR (KASP) molecular marker in the first selected BC1F1 generation individuals; and

(f) repeating steps (d) and (e) after generationally advancing the secondly selected BC1F1 generation individual to BC2F1; may include, but is not limited thereto.

In one embodiment of the present invention, the molecular marker in step (d) may be composed of oligonucleotide primer sets of SEQ ID NOs: 1 and 2 and oligonucleotide primer sets of SEQ ID NOs: 3 and 4, but is not limited thereto. The molecular marker is based on the SNP located in the SSIIa gene of Samgwangbyeo and Seolgaengbyeo. As a result of confirming the genotype of the SSIIa gene using the molecular marker, if it is confirmed as A / A, it is confirmed as the genotype of Samkwangbyeo, A / G. It can be identified by the genotype of seolgaengbyeo.

Further, in one embodiment of the present invention, the KASP molecular markers in step (e) may be those listed in Table 3, but are not limited thereto. The KASP molecular markers shown in Table 3 are marker combinations selected to be evenly distributed over 12 rice chromosomes at intervals of about 5 Mb per chromosome.

The term "KASP (kompetitive allele specific PCR)" of the present invention is one of PCR-based analysis methods, and is a homogenous and fluorescence-based genotyping technology. KASP is a technology based on fluorescence resonance energy transfer for allele-specific oligo extension and signal generation.

The rice cultivation method of the present invention is "Marker-assisted backcrossing (MAB)", and MAB is a selection marker that can test the genetic similarity between a marker (foreground) for selecting superior traits and an elite line ( Background) is used to speed up the time-consuming backcrossing process in the breeding process through markers.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Example 1. Brown rice excellent line development system

In order to foster excellent brown rice varieties, Samgwang and Seolgaeng varieties were sown in the greenhouse of Chungbuk National University in 2018 and 2019, and hybridization was carried out in the greenhouse. F1 of Samgwang (♀)/Seolgaeng (♂) combination was cultivated. 29 F1 seeds were harvested, and BC1F1 seeds were obtained using Samgwangbyeo as a recurrent parent, and BC1F1 and BC2F1 rice lines were cultivated in the greenhouse of Chungbuk National University in the winter of 2018 and 2019. From 2019 to 2020, foreground and background selection was performed in the BC1F1 and BC2F1 generations, and the offspring of the Samgwang/Seolgaeng mating combination were nurtured using the finally selected individuals.

Example 2. Development of excellent strains for brown rice using molecular markers: foreground selection in BC1F1 generation

Amylose content, which affects the taste, is influenced by SS (Starch soluble synthase) gene. Through NGS analysis, SNPs were found in the SSIIa gene region between Samgwang and Seolgaeng cultivars used as mating parents (Fig. 1). Therefore, an analysis was performed to select lines with the SSIIa genotype (A/G) of Seolgaeng in the BC1F1 population of Samgwang and Seolgaeng.

First, PCR was performed by synthesizing a ^1st primer set (SEQ ID NOs: 1 and 2) having a size of about 1 Kb centered on the region showing the SNP in the SSIIa gene, and then using ^{the 1st} PCR product at the target SNP site. PCR was performed by synthesizing 2 ^nd primer sets (SEQ ID NOs: 3 and 4) having an expected product size of about 300 bp.

Molecular markers for foreground selection Primer
name Sequence (5'→3') Product
size (bp) Tm
(℃) SSⅡa-1st Fw GCAGAAAGGTGTGGACATCA (SEQ ID NO: 1) 782 59 Rv GCTAATTTGCGCACCTCAA (SEQ ID NO: 2) SSⅡa-2nd Fw ACACTCTTTCCCTACACGACGCTCTTCCGATCT GTGGGGTTCTCGGTGAAG (SEQ ID NO: 3) 276 58 Rv GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CTCCTTGTACTTGCGGTACG (SEQ ID NO: 4)

As a result of PCR confirmation, among a total of 210 BC1F1 individuals, 100 individuals had the SNP type of SSIIa as heteromorphic (A/G) such as seolgaeng, and the remaining 110 were identified as Samgwang genotype (A/A), which is the BC1F1 generation showed a separation ratio of 1:1 (Table 2).

Example 3. Development of excellent strains for brown rice using molecular markers: background selection in the BC1F1 generation

773 developed KASP markers (Cheon, KS et al. Plant Breed. Biotech. 2018, 6(4):391-403; Cheon, KS et al. Plant Breed. Biotech. 2019, 7(3):208-219) was used to analyze marker effectiveness for Samgwang and Seolgaeng.

As a result of marker validity analysis of Samgwang and Seolgang, 368 KASP markers that differentiated the genotypes of Samgwang and Seolgang, excluding hetero genotypes, were selected for background selection analysis. The selected markers were arranged at about 5 Mb intervals per chromosome so as to be equally distributed over 12 rice chromosomes, and finally 96 KASP markers were selected (FIG. 2 and Table 3).

Using the selected 96 KASP markers, the genome recovery rate of repeated repetitions was analyzed for 93 BC1F1 individuals obtained through foreground selection (FIG. 3). As a result of examining the recovery rate, most of the objects showed a range of 60% or more to less than 65%, and 9 objects showed a degree of recovery of 75% or more (FIG. 4). As a result of examining the agricultural traits of individuals (SS001, SS017, SS018, SS045, SS083, SS100, SS102) with a recurrent parent genome recovery rate of 75% or higher, the SS007, SS018, SS045, and SS083 strains had a phenotype with Samgwang. As they appeared to be the most similar (Table 4), they were used to grow BC2F1 seeds.

Agricultural character analysis results of Samgwang, Seolgaeng and BC1F1 strains Population Line Plant height(cm) Culm length(cm) Panicle length(cm) No. of tillers Parent Samgwang 95.2 ± 4.6 64.8 ± 6.0 19.7±1.5 9 ± 1 Seolgaeng 82.0±5.8 51.0 ± 3.3 19.6 ± 1.2 7 ± 2 BC1F1 SS007 94.2 70.8 19.2 13 SS017 102.0 79.4 18.8 8 SS018 94.2 73.8 18.8 8 SS045 99.4 72.0 22.6 6 SS083 95.6 63.0 20.0 6 SS100 109.0 73.6 20.8 6 SS102 100.2 70.0 21.0 9

Example 4. Foreground and background selection in BC2F1 generation

In the BC2F1 generation of Samgwang and Seolgaeng, foreground and background selection was performed in the same manner as in Examples 2 and 3 above.

As a result of SSIIa genotype analysis by performing 1 ^st PCR and 2 ^nd PCR of BC2F1 rice, 55 individuals were identified as seolgaeng genotypes (A/G) from a total of 96 BC2F1 individuals, and Samgwang genotypes (A/A). There were 41 identified entities (Table 5). Therefore, BC2F2 seeds were harvested from these BC2F1 lineage plants.

For the 41 BC2F1 individuals, the recurrent genome recovery rate was analyzed using the KASP markers in Table 3, and SS50-25, SS50-26, SS50-27, SS50-28, SS29- 6 and SS29-12 were investigated for agricultural traits (grass length, soy sauce, soybean length, number of tillers), and seed coat and aleurone layer thickness were investigated for SS50-25, SS50-26, SS50-27 and SS50-28. The selected SS50 lines are lines grown with BC2F1 seeds using SS007 (BC1F1 repeat parent genome recovery rate: 83.46%). Carlo and Marco's method (Histochemistry of Single Molecules: Methods and Protocols, Methods in Molecular Biology; Humana Press: Totowa, NJ , USA, 2017; p. 1560.), and histochemical analysis was performed.

As can be seen in Table 6, agricultural traits were similar to Samkwang rice, the parent variety, except for plant height and tillering number of SS29-12 line and number of tillering of SS50-25 line. It was judged that rice traits were well recovered. In addition, as a result of histochemical analysis, the SS50-25, SS50-26, SS50-27, and SS50-28 lines were found to have seed coat and aleurone layer thickness similar to that of seolgaeng, which has high-quality rice/processability brown rice breed characteristics (FIG. 6 and Figure 7).

Agricultural character analysis results of Samgwang, Seolgaeng and BC2F1 strains Population Line plant height
(cm) Culm length
(cm) Panicle length
(cm) No. of tillers Parent Samgwang 112.3 ± 4.4 85.6 ± 2.1 21.9 ± 7.5 10.3±2 Seolgaeng 116.2 ± 8.5 83.1 ± 3.4 19.1 ± 3.7 10.3±3 BC2F1 SS50-25 118.0 95.2 16.0 24 SS50-26 116.8 92.8 15.4 14 SS50-27 118.3 86.7 17.4 10 SS50-28 117.5 97.7 15.6 14 SS29-6 111.5 89.7 19.1 10 SS29-12 129.3 100.2 19.5 20

Therefore, among the BC2F1 individuals in the present invention, SS50-25, SS50-26, SS50-27, and SS50-28, which have a high genome recovery rate of Samgwang and have a thickness of seed coat and aleurone layer similar to seolgaeng, were excellent strains with improved taste and processing aptitude. . The BC2F3 lines harvested through the development of the descendants of the BC2F1 line so far were judged to be able to be used as breeding materials for cultivating new high-quality brown rice rice varieties.

Rural Development Administration National Academy of Agricultural Sciences Microorganism Bank (KACC) KACC98129P 20220221

Claims (10)

It is obtained by artificially crossing Samkwang rice as the model and Seolgaeng rice as the parent, and the seed coat and aleurone layer are thinner than the parent Samkwang rice, and the number of tillers is higher than that of the main Seolgaeng rice. Eggplant seeds of rice SS50-26 (accession number: KACC 98129P). Rice SS50, which is derived from the seeds of rice SS50-26 of claim 1 (accession number: KACC 98129P), characterized in that the seed coat and alder layer are thinner than that of the parent Samgwang rice, and the number of tillers is higher than that of the male seolgaengbyeo. -26 plants. A seed of a one-hybrid rice plant produced by crossing the rice SS50-26 plant of claim 2 with another rice variety. A rice transgenic plant obtained by transforming the rice SS50-26 plant of claim 2. Transformed seeds of rice transgenic plants according to claim 4. A processed rice food prepared using the seeds of the rice SS50-26 of claim 1 (accession number: KACC 98129P). Rice with thin seed coat and aleurone layer, including the step of selecting using molecular markers for BC _n F1 (n is a positive integer of 3 or less) generations with Samkwang rice as a recurrent parent nurturing method. The method of claim 7, wherein the growing method
(a) sowing the seeds of Samgwangbyeo, which is the parent, and Seolgaengbyeo, which is the parent, respectively;
(b) artificially crossing Samgwangbyeo, the parent, and Seolgaengbyeo, the parent, during flowering;
(c) backcrossing the F1 obtained from the crossing in step (b) with Samgwang rice, which is the parent;
(d) foreground selection of individuals having a soluble starch synthase IIa ( SSIIa ) genotype of seolgaengbyeo using molecular markers in the BC1F1 generation obtained from the crossing in step (c);
(e) performing secondary selection (background selection) of individuals exhibiting a genome recovery rate of 80% or more by using a kompetitive allele specific PCR (KASP) molecular marker in the first selected BC1F1 generation individuals; and
(f) repeating steps (d) and (e) after generationally advancing the secondly selected BC1F1 generation individuals to BC2F1; The method of claim 8, wherein the molecular markers in step (d) are composed of oligonucleotide primer sets of SEQ ID NOs: 1 and 2 and oligonucleotide primer sets of SEQ ID NOs: 3 and 4, characterized in that the rice seed coat and aleurone layer are thin. upbringing method. The method of claim 8, wherein the KASP molecular markers in step (e) are those listed in Table 3.