CN111197034B - Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding - Google Patents

Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding Download PDF

Info

Publication number
CN111197034B
CN111197034B CN202010021140.2A CN202010021140A CN111197034B CN 111197034 B CN111197034 B CN 111197034B CN 202010021140 A CN202010021140 A CN 202010021140A CN 111197034 B CN111197034 B CN 111197034B
Authority
CN
China
Prior art keywords
gene
rice
plant
target
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010021140.2A
Other languages
Chinese (zh)
Other versions
CN111197034A (en
Inventor
杨杰
高彩霞
许扬
王芳权
张瑞
陈智慧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Genetics and Developmental Biology of CAS
Jiangsu Academy of Agricultural Sciences
Original Assignee
Institute of Genetics and Developmental Biology of CAS
Jiangsu Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Genetics and Developmental Biology of CAS, Jiangsu Academy of Agricultural Sciences filed Critical Institute of Genetics and Developmental Biology of CAS
Priority to CN202210501884.3A priority Critical patent/CN114891759A/en
Priority to CN202010021140.2A priority patent/CN111197034B/en
Publication of CN111197034A publication Critical patent/CN111197034A/en
Application granted granted Critical
Publication of CN111197034B publication Critical patent/CN111197034B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01021—Starch synthase (2.4.1.21)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a rice Wx mutant protein, a mutant gene and application thereof, and also discloses a breeding method for creating quality-improved rice with transparent appearance and properly reduced amylose content by using gene editing. The invention utilizes gene editing technology for the first timeWxEditing gene with single base, screening the progeny, and determining the presence of T 2 The new material which eliminates T-DNA, has transparent appearance, properly reduces amylose content, improves quality and can be stably inherited can be obtained. Compared with breeding such as chemical mutagenesis, cross breeding and the like, the gene editing directional improvement molecular breeding technology has the advantages of rapidness, accuracy, high efficiency and the like, combines gene function marker genotype selection, or directly utilizes other mature rice varieties as background materials to carry out transformation and obtain corresponding materials, can greatly improve the breeding efficiency and greatly accelerate the breeding process.

Description

Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding
Technical Field
The invention belongs to the field of crop genetic breeding, new resource innovation of crop quality improvement and good taste crop breeding, and particularly relates to Wx mutant protein based on a gene editing technology and application of genes thereof in plant breeding.
Background
Rice (Oryza sativa L.) is an important grain crop in China and even in the world, and plays a significant role in guaranteeing grain safety.
The rice quality refers to the essential characteristics of rice in commodity circulation, including four main aspects of grinding quality, appearance quality, cooking and taste quality, nutrition quality and the like, wherein the appearance quality, the cooking and taste quality are particularly important. The seed endosperm is the main edible part of rice, and the main component of the endosperm is starch which generally accounts for 90% or more of the dry weight of the endosperm by chemical composition analysis, so that the cooking taste quality of rice depends on the physicochemical properties of starch to a great extent, and genes participating in the synthesis and regulation of the starch in the rice endosperm play an extremely important role in the formation of the rice quality. Through a great amount of research by researchers, people have deeply understood the genetic basis of rice cooking and taste quality characters, and the way of synthesizing rice endosperm starch, and involved genes or enzymes have been clarified in detail. Wherein, the enzymes participating in starch synthesis mainly comprise ADP-glucose pyrophosphorylase, granule-bound starch synthase, soluble starch synthase, starch branching enzyme, starch debranching enzyme and the like.
There are two main types of starch constituting rice, i.e., amylose (amylose) and amylopectin (amylopectin). Amylose is a glucose polymer linked by alpha-1, 4-glucosidic bonds, which is a linear macromolecule with no or few branches. Amylose Content (AC) is generally considered to be a determining factor in rice cooking, processing, and eating quality. The rice Wx gene encodes granular starch synthase (GBSS), which is a major gene controlling amylose synthesis and directly affects the amylose content in rice endosperm and pollen. The gene was cloned in 1990 and located in the short arm of chromosome 6, and in general japonica varieties, the gene consists of 14 exons and 13 introns and encodes a protein consisting of 609 amino acids. The different allelic variations of this gene determine the amylose content of rice, and up to now there are at least 8 published Wx alleles. In glutinous rice, Wx causes premature transcription termination due to deletion of 23bp of exon 2. In non-waxy varieties, Wx differentiates primarily into two allelic types, Wx-a and Wx-b. Wherein the amylose content of the rice carrying Wx-a is more than 25 percent, and the rice belongs to a high amylose type. Wx-b is mainly distributed in japonica rice varieties, the amylose content of the rice carrying the gene is moderate to low (15% -18%), compared with Wx-a, the variation of Wx-b is caused by the variation of G-T at the splicing site of the first intron, and the mutation reduces the splicing efficiency of precursor mRNA so as to reduce the amylose content of the rice. In addition, researchers have cloned Wx-in alleles, demonstrating that A-C variation at exon 6 results in a moderate level (18% -22%) of amylose content. In addition, 3 "soft rice genes" Wx-mq, Wx-mp and Wx-op were cloned sequentially (so-called soft rice, i.e., rice with AC between 8% and 12%, bright surface, soft texture, high elasticity, no hardness in cold rice, and excellent taste quality), and Wx-mq had 2 mutations in exons 4 (arginine at position 158 of the amino acid sequence was mutated to histidine) and 5 (amino acid at position 191 of the amino acid sequence was mutated to histidine) compared to Wx-b, resulting in a decrease in amylose content to around 10%. The other allele Wx-mp has mutation in the 4 th exon (arginine at the 158 th position of the amino acid sequence is mutated into histidine), the position is the same as that of Wx-mq, the 5 th exon has no mutation, the amylose content of rice carrying the allele is about 10 percent, the other soft rice gene is caused by A-G mutation of the 4 th exon (aspartic acid at the 165 th position of the amino acid sequence is mutated into glycine) of Wx-hp and Wx-hp derived from Yunnan millifart, the former uses agrobacterium tumefaciens glycogen synthase as a model to draw a three-dimensional structure diagram of Wx-hp, and the mutation is supposed to be positioned in an amylase catalytic domain of starch synthase to cause starch synthesis capacity reduction. In summary, we believe that artificially mutating (e.g., using gene editing techniques) individual amino acids of the core catalytic domain of starch synthase encoded by the Wx gene, particularly the related amino acids adjacent to amino acid residues 33-36 (Lys-Ser-Gly) in the 3-D model (the positions of the amino acid residues 33-36 are reported to be binding sites for ADP-glucose in starch and glycogen synthesis), may create new mutation types and provide material support for meeting the higher requirements of the current market for rice quality.
At present, soft rice japonica rice varieties in Jiangsu, Yunnan, Shanghai and other places, such as Nanjing 46, Nanjing 9108, Chujing 39, Shanghai soft 1212 and the like, have outstanding taste and quality, and are popular with consumers and widely planted. Many varieties obtain the national quality rice variety taste quality appraisal golden prize. However, although the soft rice japonica rice is popular and touted in the market in terms of taste, two major defects still exist:
1. the method can utilize the shortage of soft rice resources and the single genotype, and has low improvement efficiency by utilizing conventional breeding. Taking soft rice variety bred in Yangtze triangle as an example, the allelomorphic mutant gene Wx-mp of Kanto 194 from Japan, about AC 9 percent, is mainly used at present. The germplasm resource is used for cultivating soft rice varieties, and target genes are introduced into excellent variety backgrounds, mainly through hybridization, backcross, multiple cross, ladder hybridization and the like. For quality, backcross transformation is a common method, backcross is generally needed for 4-6 generations, at least 3-5 generations are needed for selfing homozygosis and the like, single characters need to be improved and can play a role in production, at least 6-8 years are needed, the breeding period is long, and the urgent requirements of markets and common people on high-quality soft fragrant rice varieties are difficult to meet. If a new soft rice gene resource is to be mined, the method mainly depends on a chemical mutagenesis method at present, as is well known, the chemical mutation frequency is low, the early investment is large, 2-3 years can be needed for obtaining a stable material by screening, meanwhile, the chemical mutagenesis can cause multiple gene mutations of a wild material, and the application of the wild material in production also needs to eliminate bad gene mutations by hybridization improvement.
2. Most of soft rice and japonica rice varieties have poor appearance quality. When the water content of the rice is about 15%, most rice is cloudy and has poor transparency, is commonly called semi-glutinous rice or stiff rice and seriously influences the marketability of the rice. Rice processing plants can increase the clarity of rice by increasing the moisture content above 17%, but often cause the rice to be intolerant to storage and even mildew. Therefore, the excavation and utilization of new soft rice gene resources and the change of the current situation that the appearance of the existing soft rice does not reach the standard become urgent needs for high-quality breeding.
The genome editing technology is a technology for carrying out site-directed modification, single-base editing, targeted knockout or target gene insertion on a genome and a transcription product thereof by using a special nuclease. At present, the CRISPR/Cas9(CRISPR-associated protein 9) mediated genome editing technology is one of the mature, rapidly developed and widely applied in crop genetic improvement. Compared with traditional breeding and aiming at the defects in soft rice breeding, gene editing breeding has the following advantages:
1. high efficiency and short period. As the agrobacterium-mediated genetic transformation efficiency of japonica rice varieties is higher, the previous experimental results show that 10T are 0 Generation transformants can generally be selected by selecting transformants in which 3-5 homozygous target alleles are edited simultaneously, i.e.at T 0 The generation can observe the phenotypes, such as the characters of flavor, dark endosperm caused by extremely low amylose content, heading stage advance and the like. Since rice is a strict self-pollinating plant, exogenous DNA fragments can be removed by selfing separation at T 0 T obtained by selfing of generation individual plant 1 In the generation, about 5 individuals of the 100 individuals can be screened for foreign DNA represented by hygromycin, Cas9 gene, SgRNA + vector skeleton. 5 seedlings are bred, generally, each seedling can collect 500 seeds, 400 seedlings can be bred by one seedling, and about 20 jin of conventional japonica rice seeds can be bred. That is, within three generations (-1.5 years), enough seeds are available for quality analysis (even in various trials such as trials, demonstrations, etc.). Compared with conventional breeding, the breeding period is greatly shortened. Furthermore, even at T 0 When clone variation occurs in the generation tissue culture process, the poor variation can be eliminated by hybridizing the genome edited material with the wild type, or enough T can be generated 0 In the case of transformants, the clonally variant plants can even be discarded.
2. The expected target gene can be accurately, directionally and massively created. In conventional breeding, only resources with target genes can be screened from variety resources, then the existing varieties are improved by means of hybridization backcross and the like, generally speaking, the variety resources have poor agronomic characteristics, so the genetic improvement period is longer, while the genome editing technology can directly utilize rice varieties which have good agronomic characteristics and are popularized in large areas in production as background materials to edit the target genes, the target is clear, and the screening is efficient; in addition, in view of the current high-efficiency genetic transformation technology of rice, a specific phenotype (e.g. transparent appearance) in the variation of a specific target gene (e.g. Wx gene) can be screened in the background material in an infinite manner, so that compared with the search for natural variation material or chemical mutation material meeting the phenotype condition, the strategy is more feasible and has obvious advantages. By taking the multi-gene editing system of the related genes of the heading stage constructed by the agricultural science college of Jiangsu province at present as an example, Wuyujing 24 and Nanjing 9108 which are popularized by Jiangsu in large area are used as genetic transformation background materials, and new materials for removing exogenous marker genes of heading stages of more than 60 days, more than 70 days and more than 80 days are obtained from the background materials.
3. The single-base editing system of the gene based on CRISPR/Cas9 can further realize single-base editing. In the breeding and production of crops, many important agronomic traits are caused by single nucleotide polymorphism or dominant gain-of-function point mutation, so that the application of a simple gene knockout strategy is very limited, the technical problem can be well solved by the appearance of a single base editing system, and the strategy can avoid extreme variation phenotype caused by the loss of biological functions of mutant proteins caused by gene knockout, even rice plants can not grow normally and finally can not be applied to breeding. The 'weak mutation' (individual amino acid substitution rather than premature translation termination) generated by single base editing does not cause complete loss of biological functions of the encoded protein, thereby causing no significant change of important agronomic characters of background materials and being more beneficial to generating variation types which can be used for breeding and production.
In conclusion, by using the gene editing technology, the target site for designing and editing the exons 3 and 4 (located in the core catalytic domain of the encoded starch synthase) of the Wx gene is subjected to single base editing, a series of new materials which are transparent in appearance, low in amylose content and gradient in distribution can be efficiently created and screened, and the specific genotypes of the new materials can be further applied to breeding by using the materials and determining the specific genotypes of the new materials. Corresponding gene function markers can be developed, genotype selection is carried out in the hybrid combined offspring prepared by the materials by means of molecular marker assisted selection, and the target trait gene heterozygosis and homozygous genotypes are screened, so that the target gene homozygous process is accelerated. In addition, the rice variety with excellent agronomic characters and large-area popularization in production can be directly used as a background material to edit the target gene, and the needed gene type material can be efficiently screened in a large scale. Aiming at single base mutation, enzyme cutting target point markers can be designed, but the process is relatively complicated, allele specific PCR is developed, and genotypes with high and low amylose contents can be distinguished through two times of PCR.
At present, technologists want to obtain new soft rice materials or new genes with the AC reduced to 8-12% and transparent appearance, and need to perform chemical or radiation mutagenesis and the like, so that the workload is large and the effect is not ideal. Meanwhile, conventional chemical mutagenesis and conventional transformation breeding are adopted, the breeding age is at least 6-8 years, the breeding period is long, and the urgent requirements of the market and the common people on high-quality soft fragrant rice varieties are difficult to meet.
Meanwhile, no relevant report is provided for the relevant research of creating a new soft rice allele by carrying out site-specific mutagenesis on the Wx gene of the rice variety by using a gene editing technology.
Disclosure of Invention
The purpose of the invention is as follows: the technical problem to be solved by the invention is to provide a rice Wx mutant protein and nucleic acid or gene thereof.
The technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector or a cell.
The technical problem to be solved by the present invention is to provide a primer pair for identifying said gene or nucleic acid.
The technical problem to be solved by the invention is to provide the application of the rice Wx mutant protein, nucleic acid or gene, primer pair, the expression cassette, recombinant vector or cell in the aspects of plant quality improvement, strain/variety identification, strain/variety creation and/or breeding.
The technical problem to be solved by the invention is to provide a breeding method for creating quality-improved rice with transparent appearance and properly reduced amylose content by using gene editing. The invention firstly utilizes the gene editing technology to edit the Wx gene of the rice variety, creates a new soft rice allele and rejects a T-DNA exogenous sequence to obtain a new material which has a transparent appearance, properly reduces the amylose content, improves the quality and can be stably inherited, generally only about 2 years are needed, and compared with chemical mutagenesis and conventional transformation breeding, the breeding period is at least shortened by 2-6 years. Therefore, the gene editing molecular breeding has the advantages of accuracy, high efficiency and the like which are not possessed by conventional breeding, and has wide application prospect.
The technical problem to be solved by the present invention is to provide a method for identifying plants obtained by said method.
The technical scheme is as follows: in order to solve the technical problems, the technical scheme adopted by the invention is as follows: a rice Wx mutant protein, wherein the amino acid sequence of the Wx mutant protein comprises the following mutations: which corresponds to the amino acid sequence of rice Wx, is mutated at amino acid 159 and/or at amino acid 178.
Specifically, the 159 th amino acid is mutated from glycine to lysine for the first time, and the 159 th amino acid has the quality improvement characteristics of transparent appearance, proper reduction of amylose content and the like. The 159 th amino acid mutation of the present invention may include 19 types of mutations such as glutamic acid, aspartic acid, tryptophan, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, serine, threonine, cysteine, methionine, asparagine, glutamine, arginine, histidine, and a stop codon. Whether other variations or premature termination of the amino acids described above affect granular starch synthase activity, physiological function, and quality improvement properties has yet to be confirmed by further studies.
Specifically, the invention reports for the first time that the 178-bit amino acid is mutated from threonine to isoleucine, and has the quality improvement characteristics of transparent appearance, proper reduction of amylose content and the like. The mutation at amino acid 178 of the present invention may further include 19 types of mutations such as glycine, lysine, glutamic acid, aspartic acid, tryptophan, alanine, valine, leucine, proline, phenylalanine, tyrosine, serine, cysteine, methionine, asparagine, glutamine, arginine, histidine, and a stop codon. Whether other variations or premature termination of the amino acids described above affect granular starch synthase activity, physiological function, and quality improvement properties has yet to be confirmed by further studies.
The rice Wx mutant protein comprises the following components:
(a) the amino acid sequence is shown as SEQ ID NO: 2 or SEQ ID NO: 4 is shown in the specification; or
(b) And (b) the protein which is derived from the protein (a) and has granular starch synthetase activity, wherein the amino acid sequence in the protein (a) is substituted and/or deleted and/or added with one or more amino acids.
The present disclosure also includes nucleic acids or genes encoding the mutant proteins.
Wherein the nucleic acid or gene comprises:
(a) encoding said mutant protein; or
(b) A nucleotide sequence which hybridizes with the nucleotide sequence defined in (a) under stringent conditions and encodes a protein having granular starch synthase activity; or
(c) The nucleotide sequence is shown as SEQ ID NO: 1 or SEQ ID NO: 3, respectively.
The invention also comprises a primer pair for identifying the gene or the nucleic acid, wherein the primer pair is Wx1 and/or Wx2 and/or Wx9 and/or Wx10, and the sequence of the primer pair Wx1 is shown as SEQ ID NO: 19 and SEQ ID NO: 20, the sequence of the primer pair Wx2 is shown as SEQ ID NO: 20 and SEQ ID NO: 21, the sequence of the primer pair Wx9 is shown as SEQ ID NO: 20 and SEQ ID NO: 28, the sequence of the primer pair Wx10 is shown as SEQ ID NO: 20 and SEQ ID NO: as shown at 29.
The present disclosure also includes expression cassettes, recombinant vectors or cells containing the nucleic acids or genes.
The invention also comprises the rice Wx mutant protein, nucleic acid or gene, and the application of the primer pair, the expression cassette, the recombinant vector or the cell in the aspects of plant quality improvement, strain/variety identification, strain variety creation and/or breeding.
The present invention also comprises a method for obtaining a quality-improved plant with a transparent appearance and a suitably reduced amylose content, comprising the following steps:
1) allowing the plant to comprise said nucleic acid or gene; or
2) Allowing the plant to express the rice Wx mutant protein.
The invention also provides a breeding method for creating the quality-improved rice with transparent appearance and properly reduced amylose content by using gene editing, which comprises the following steps:
1) wx gene cloning and target site design for gene editing
2) Constructing a single-base editing vector containing a target fragment;
3) the rice having the Wx mutant protein, or the nucleic acid or the gene has a transparent appearance and a suitably reduced amylose content.
4) Mutation of target Gene into T 0 T obtained by selfing transgenic plants 1 Foreign DNA (T-DNA) fragment elimination of the generation plant;
5) T-DNA-knocked-out T 1 And identifying the genotype of the generation plant and obtaining the target gene homozygous mutant plant.
Wherein, the construction method of the single-base editing vector containing the target fragment in the step 2) comprises the following steps:
A) preparing a target joint fragment: is connected withddH for primer 2 Dissolving O into mother liquor, mixing and diluting the complementary paired joint primers, performing high-temperature denaturation, transferring to room temperature, cooling, and finishing annealing to obtain a target joint fragment;
B) target adaptor fragment ligation to intermediate vector: carrying out enzyme digestion by using a pHUE411 intermediate vector and a restriction enzyme BsaI to obtain a BsaI single-enzyme digestion pHUE411 vector; adopting BsaI single enzyme-digested pHUE411 vector, the target joint fragment and T4 ligase to carry out ligation reaction, carrying out escherichia coli transformation, and sequencing to obtain an intermediate vector plasmid containing the target joint fragment.
C) Constructing a final vector: carrying out double enzyme digestion by adopting a pH-nCas9-PBE binary expression vector, restriction enzymes PmeI and AyrII to obtain a double enzyme digested pH-nCas9-PBE vector; carrying out double enzyme digestion on an intermediate vector containing a target joint fragment, PmeI and AvrII to obtain an sgRNA expression cassette containing the target joint fragment and a corresponding promoter; performing ligation reaction by using a double-enzyme-digested pH-nCas9-PBE vector, a sgRNA expression cassette and T4 ligase, performing escherichia coli transformation, and sequencing to obtain a single-base editing vector finally containing a target fragment.
Wherein, the quality-improved rice with transparent appearance and properly reduced amylose content in the step 3) is obtained by the following steps: transferring the single base editing vector containing the target segment obtained in the step 2) into agrobacterium EHA105 and carrying out genetic transformation to obtain T 0 Generation of transgenic plants, T obtained with primer pairs Wxb-PCR-F and Wxb-PCR-R 0 And (3) carrying out amplification and sequencing on the transgenic plant to identify the genotype so as to obtain the plant with the mutant protein, the nucleic acid or the gene.
Wherein the T-DNA fragment of the step 4) comprises hygromycin phosphotransferase gene HPT and nuclease gene nCas9, and the T-DNA fragment is deleted by mutating the target gene 0 T obtained by inbreeding transgenic plants 1 The HPT gene and nCas9 gene of the generation plant are simultaneously detected and repeated for many times, and T not carrying the two genes is obtained by screening 1 The generation single plant is the target plant.
Wherein the HPT gene detection method comprises mutating T with target gene 0 T obtained by selfing transgenic plants 1 The genome DNA of the generation plant is taken as a template, hyg283-F and hyg283-R are taken as primers to carry out PCR amplification, and meanwhile, the nCas9 gene detection method is realized by the T with the mutation of a target gene 0 T obtained by selfing transgenic plants 1 And (3) carrying out PCR amplification by taking the genome DNA of the generation plant as a template and nCas9-F and nCas9-R as primers, wherein the HPT gene and the nCas9 gene are not detected simultaneously, which indicates that the T-DNA is successfully eliminated.
Wherein, the step 5) of obtaining the target gene homozygous mutant plant is to remove the T-DNA obtained in the step 4) 1 And (3) taking genome DNA of the generation plant as a template, taking Wxb-PCR-F and Wxb-PCR-R as primers to carry out PCR amplification and sequencing, and screening and obtaining the plant homozygous for the mutant protein and the nucleic acid or the gene.
The present disclosure also includes a method of identifying a plant obtained by said method, comprising the steps of:
1) determining whether the amylose content of the plant is reduced; and/or
2) Determining whether the RVA spectrum viscosity index disintegration value of the plant rice is increased or not; and/or
3) Determining whether the RVA spectrum viscosity index recovery value of the plant rice is reduced or not; and/or
4) Determining whether the RVA spectrum viscosity index peak time of the plant rice is reduced or not; and/or
5) Determining whether the appearance of the plant polished rice is transparent.
Has the advantages that: compared with the prior art, the invention has the following advantages:
1) the invention firstly utilizes the single base editing technology to edit the coding region of the Wx gene, and the coding region is screened at T through the offspring 2 The new material which eliminates T-DNA, has transparent appearance, properly reduces amylose content, improves quality and can be stably inherited can be obtained. Compared with breeding such as chemical mutagenesis, cross transformation and the like, the gene editing and directionally improving molecular breeding technology has the advantages of rapidness, accuracy, high efficiency and the like, utilizes gene function markers to select genotypes, or directly utilizes other mature rice varietiesThe method converts the background material and obtains the corresponding material, thereby greatly improving the breeding efficiency and greatly accelerating the breeding process.
2) The content of the amylose of the rice material obtained by the breeding of the gene editing technology is distributed between 9.8 +/-0.2-12.9 +/-0.1 percent, and is reduced by 1.5-4.6 percent compared with 14.4 +/-0.2 percent of the wild type, the reduction value of the content of the amylose is appropriate, the trend is obvious, the effect is obvious, and the palatability and the taste quality can be effectively improved.
3) The rice disintegration value (BDV) of the rice material obtained by breeding through the gene editing technology is distributed between 943cP and 1327cP, compared with 862cP of a wild type, the BDV is increased by a proper value and has an obvious trend; the rice recovery value (CSV) of the rice material obtained by the breeding of the gene editing technology is distributed between 1010cP and 1070cP, compared with 1250cP of a wild type, the CSV has a proper value reduction value and an obvious trend; the rice peak time (PeT) of the rice material obtained by the breeding of the gene editing technology is distributed between 5.87min and 6.13min, and compared with the wild type 6.2min, the PeT is reduced by a proper value and has an obvious trend. The rice RVA spectrum viscosity characteristic optimization effect represented by the 3 indexes is remarkable, and the quality of the cooking taste can be effectively improved.
4) The rice material obtained by breeding by the gene editing technology has good appearance transparency, and the polished rice shows a better transparent state as the wild type when the water content is 10.1%; the soft rice compared with Nanjing 9108 has a cloudy appearance and poor transparency.
5) The invention develops the specific distinction between the wild type (GG at 475- m6 AA at base positions 475-476) of the gene, Wx1 and Wx 2; based on the base variation of the wild type and the mutant at the 533-534 th site of the Wx gene, the method has been developed to specifically distinguish the wild type (the 533-534 th base of the Wx gene is CC) from the mutant (Wx) m10 Base 533-534 was TT) as molecular markers Wx9 and Wx 10. The molecular marker can be used for molecular marker-assisted selective breeding.
Drawings
FIG. 1 is a schematic diagram of the gene structure and target site.
FIG. 2T against Su reclamation 118 0 Identifying the target site sequence of the generation plant (part); a: wxb #9 target site; b: wxb #24 target site.
FIG. 3T against Su reclamation 118 1 Identifying the target site sequence of the T-DNA knockout plant; a: wxb #9 target site; b: wxb #24 target site.
FIG. 4T 2 Detecting results of HPT gene and Cas9 gene of the generation plant; a: an HPT gene; b: cas9 gene. M: DNA marker 2000 with the sizes of 2000, 1000, 750, 500, 250 and 100 from top to bottom; lane 1 is 118-1-1 strain and has been marked with a red arrow; lane 2 is 118-3-2 strain and has been marked with a red arrow; lane 3 is 118-5-1 strain and has been marked with a red arrow; lane 11 is 118-9-15 line and has been marked with a red arrow; other lanes are other numbered strains of sovern 118 background; labeled P is a plasmid positive control; the control labeled E is water.
FIG. 5 determination of Amylose Content (AC).
FIG. 6 analysis of the correlation between the overall variation of each characteristic value of RVA and the disintegration value (BDV), the recovery value (CSV), the peak time (PeT) and AC respectively.
Figure 7 polished rice appearance observation.
FIG. 8 wild-type Wx and Wx m6 、Wx m10 Detecting the activity of the mutant protease and analyzing the correlation between the mutant protease and AC; a: enzyme activity detection; b: and (5) carrying out correlation analysis.
Fig. 9 three-dimensional structure prediction. A: a wild-type Wx protein; b: mutant Wx m6 A protein; c: a wild-type Wx protein; d: mutant Wx m10 A protein.
FIG. 10 development of functional markers; the DNA templates used for each lane are indicated in the figure. Lane M is DNA marker 2000 with bands of 2000, 1000, 750, 500, 250, and 100, respectively, from top to bottom; the primers used in the PCR for each lane are as follows: lanes 1 and 7 are Wx-1, lanes 2 and 8 are Wx-2, lanes 3 and 9 are Wx-3, lanes 4 and 10 are Wx-4, lanes 5 and 11 are Wx-5, lanes 6 and 12 are Wx-6, lanes 13 and 19 are Wx-7, lanes 14 and 20 are Wx-8, lanes 15 and 21 are Wx-9, lanes 16 and 22 are Wx-10, lanes 17 and 23 are Wx-11, and lanes 18 and 24 are Wx-12.
FIG. 11Wx1+ Wx2 and Wx9+ Wx10 functional marker test varieties; a: primers used for PCR were Wx 1; b: primers used for PCR were Wx 2; c: primers used for PCR were Wx 9; d: the primer used for PCR was Wx 10. Lane M is DNA marker 2000 with bands of 2000, 1000, 750, 500, 250, and 100, respectively, from top to bottom; the swimming channels 1-19 respectively represent Su-reclamation 118, 118-1-1 mutants, 118-3-2 mutants, 118-5-1 mutants, 118-9-15 mutants, Nipponbare, Nanjing 9108, Huanghuazhan, 9311, Huai rice No. 5, Channong No. 8, Nanjing No. 51, Neijing No. 7, Suxiu No. 867, Wuyun No. 27, Wuyun No. 29, Xudao No. 8, Xudao No. 9 and Yandao No. 16.
FIG. 12 Jinjing 818 background T 2 Identifying the genotype and phenotype of the generation plant; a: wxb #9 target site genotype identification; b: wxb #24 target site genotype identification; c, determining Amylose Content (AC); d, BDV determination; e, CSV determination; f, PeT determination; g, observing the appearance of polished rice; h, detecting the protease activity.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not indicated, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
The background material selected by the invention is Su-Ming 118 (purchased from Jiangsu Su-Ming variety Limited company), which is a new late-maturing Zhongjing variety bred by grain crop research institute of agricultural academy of sciences of Jiangsu province, has a total growth period of about 155 days, is suitable for planting in Suzhong and Ningyangyang hilly areas of Jiangsu province, has excellent comprehensive agronomic characters, has been popularized and applied in large area in production, and is deeply popular in the market. The Su-cultivated 118 plants are compact in type, strong in tillering force, light green in leaves, good in group uniformity, good in lodging resistance, good in color change in the mature period, about 14% in amylose content, and transparent in rice appearance. The invention carries out fixed-point single base editing on the Wx gene of Su-Ke-Gu 118 by a single base gene editing technology based on CRISPR/Cas9, obtains a plurality of mutants which have transparent appearance, properly reduced amylose content, gradient distribution (soft rice) appearance and the like and improved cooking and taste quality, and meets the urgent needs of the market and the common people on high-quality soft fragrant rice varieties.
Example 1: obtaining genetically transformed plants
1. Su-reclamation 118Wx gene cloning and target site design
With reference to the CTAB method of Murray et al, genomic DNA of Sookland 118 was extracted (Murray M G, et al, Nucleic Acids Research, 1980, 8 (19): 4321-4326). With primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5), Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6) was subjected to PCR amplification of the genomic DNA, and the amplification product was sent to Yinzi Weiji (Shanghai) trade laboratory Co., Ltd for sequencing. Sequencing results Blast comparison analysis is carried out in NCBI (https:// blast.ncbi.nlm.nih.gov/blast.cgi) database, and the Wx gene coding region sequence of Sutom 118 is found to be the same as that of the reference genome rice Nipponbare.
According to the Wx gene sequence of Suzhou 118, a target site wxb #9 was designed on exon 4 predicted by the CRISPR-GE website (http:// skl.scau.edu.cn/targettdign /): CGACTCCACGCTTGTAGCAA (SEQ ID NO: 7), design a target site wxb # 24: AAGACCGGTGAGAAGATCTA (SEQ ID NO: 8), the positions of the two target sites on the gene are shown schematically in FIG. 1. According to previous studies, it was shown (Liu LL, et a1., Plant Mol Biol, 2009, 71: 609-626), that the two target sites are both located in the core catalytic domain of the starch synthase encoding the protein, and that single base variation within the respective editing windows is expected to form new effective mutations, and rice mutants with transparent appearance and reduced amylose content in different degrees are obtained.
2. CRISPR/Cas9 gene editing vector construction
The gene editing vector construction is carried out according to the following steps by referring to the report method of Zong et al (Zong Y, et al, nat. Biotechnol, 2017, 35, 438-440):
(1) target joint preparation
According to the designed target site wxb #9 and wxb #24 sequences and respective reverse complementary sequences, after adding a linker sequence at the 5' end, 4 primers are synthesized by Nanjing Ongzhike Biotechnology Co., Ltd, and the specific sequences are as follows:
wxb#9-F：5’-ggcgCGACTCCACGCTTGTAGCAA-3’(SEQ ID NO：9)：
wxb#9-R：5’-aaacTTGCTACAAGCGTGGAGTCG-3’(SEQ ID NO：10)；
wxb#24-F：5’-ggcgAAGACCGGTGAGAAGATCTA-3’(SEQ ID NO：11)；
wxb#24-R：5’-aaacTAGATCTTCTCACCGGTCTT-3’(SEQ ID NO：12)；
adapter primers wxb #9-F and wxb #9-R were applied as ddH 2 Dissolving O into 100. mu.M mother liquor, adding 1. mu.l of each mother liquor into 98. mu.l of ddH 2 And mixing and diluting the O to 1 mu M, performing high-temperature denaturation, transferring to room temperature, and cooling to finish annealing to obtain the double-stranded target joint fragment wxb # 9-F/R.
Adapter primers wxb #24-F and wxb #24-R were applied as ddH 2 Dissolving O into 100. mu.M mother liquor, adding 1. mu.l of each mother liquor into 98. mu.l of ddH 2 And mixing and diluting the O to 1 mu M, performing high-temperature denaturation, transferring to room temperature, and cooling to finish annealing to obtain the double-stranded target joint fragment wxb # 24-F/R.
(2) Target point adaptor fragment connecting intermediate carrier
First, the intermediate vector pHUE411(Xing HL et a1., BMC Plant Biol, 2014, 14, 327) was digested with the restriction enzyme BsaI purchased from ThermoFisher in the following manner:
Figure BDA0002359579440000121
After 1h of digestion at 37 ℃, agarose gel electrophoresis and gel tapping are carried out, and the BsaI single enzyme digestion vector is recovered for standby by using an OMEGA DNA recovery kit.
And secondly, connecting the target joint fragment prepared by natural annealing in the previous step into the BsaI single-enzyme digested pHUE411 vector by adopting T4 ligase. T4 ligase was purchased from Takara, Japan, and the reaction system (10. mu.L) was as follows:
Figure BDA0002359579440000122
after brief centrifugation, the mixed system was subjected to a water bath at 16 ℃ for 4 hours. The ligation products were transformed into E.coli DH5a competent cells (Beijing Tiangen) by heat shock. The transformed cells of 1/20 were spread evenly on LB solid medium containing 100mg/L ampicillin. After culturing for 16h at 37 ℃, picking out the strain, and sending the strain to Nanjing Kingsrei Biotech company for sequencing. The correctly inserted and sequenced plasmids were obtained and named pHUE411-wxb #9-F/R and pHUE411-wxb #24-F/R, respectively.
(3) Final vector construction
The final vector pH-nCas9-PBE is a plant binary expression vector, which is developed by the Highenxia researchers team of the institute of genetics and developmental biology of the Chinese academy of sciences (Zong Y, et al, nat. Biotechnol, 2017, 35, 438-440), firstly, the vector is subjected to double enzyme digestion by restriction enzymes PmeI and AvrII, the restriction enzymes used are purchased from ThermoFisher, and the enzyme digestion system is as follows:
Figure BDA0002359579440000131
After 1h of cleavage at 37 ℃, agarose gel electrophoresis and gel cutting were carried out, and the vector after double cleavage of PmeI and AvrII was recovered and used by using an OMEGA DNA recovery kit.
Secondly, the pHUE411-wxb #9-F/R and pHUE411-wxb #24-F/R vectors obtained in the previous step are subjected to double digestion by restriction enzymes PmeI and AvrII respectively, the restriction enzymes used are purchased from ThermoFisher, and the digestion system is as follows:
Figure BDA0002359579440000132
after 1h of enzyme digestion at 37 ℃, agarose gel electrophoresis and gel tapping are carried out, and the sgRNA expression cassettes of original fragments of OsU3-wxb #9-F/R or OsU3-wxb #24-F/R are obtained by carrying out double enzyme digestion on PmeI and AvrII by using an OMEGA DNA recovery kit and are respectively recovered and reserved.
Finally, the above recovered original fragment was ligated into pH-nCas9-PBE after PmeI and AvrII double digestion by T4 ligase, T4 ligase was purchased from Takara, Japan, and the reaction system (10. mu.L) was as follows:
Figure BDA0002359579440000133
Figure BDA0002359579440000141
after a short centrifugation, the mixed system is bathed in water at 16 ℃ for 4 h. The ligation product was transformed into E.coli DH 5. alpha. competent cells (Beijing Tiangen) by heat shock. All the transformed cells were spread evenly on LB solid medium containing 50mg/L kanamycin. After culturing at 37 ℃ for 16h, colonies were picked and sequenced by Nanjing Kingsry Biotech, using sequencing common primer M13-F. The obtained correctly sequenced plasmids were named pH-nCas9-PBE-wxb #9 and pH-nCas9-PBE-wxb #24, respectively.
3. Acquisition of genetically transformed plants and genotyping
The 2 plasmids were transformed into Agrobacterium EHA105, respectively. Rice reclamation 118 (purchased from Jiangsu Su reclamation cultivars, Ltd.) was transformed by a conventional Agrobacterium-mediated method. Obtaining positive T transferred into pH-nCas9-PBE-wxb #9 0 Generating 8 plants to obtain positive T transferred into pH-nCas9-PBE-wxb #24 0 6 plants are generated. To identify the base variation of the editing target site, T obtained as described above was extracted 0 Generating transgenic line leaf genome DNA, and performing PCR by using a primer Wxb-PCR-F: CAAGCAGCAGCGGTCGG (SEQ ID NO: 13) and Wxb-PCR-R: TTGAAGTATGGGTTGTTGTTGAGG (SEQ ID NO: 14), and the amplification product was sent to Weiji (Shanghai) trade Co., Ltd for sequencing.
The sequencing result shows that: positive T of transfer pH-nCas9-PBE-wxb #9 0 The identification of the corresponding target sites of the generation plants (parts) is shown in FIG. 2A, and the strain number B1-68 is 4The GG mutation from 75 to 476 is homozygous mutation of AA; the strain with the number of B2-42 is a double allelic mutation in which 475-; the strain numbered B6-29 was homozygous for mutation of 475-476 GG to AA.
Positive T of pH-nCas9-PBE-wxb #24 0 The identification condition of the corresponding target sites of the generation plants (parts) is shown in FIG. 2B, the strain numbered B2-21 is a double allelic mutation of which the 533-534 site CC mutation in one allelic gene is TT and the 533-534 site CC mutation in the other allelic gene is GT.
Example 2: mutant exogenous DNA (T-DNA) knockout, genotype re-identification and screening of homozygous plants
The pH-nCas9-PBE-wxb #9 and pH-nCas9-PBE-wxb #24 vectors of the directionally-precise single-base editing Wx gene constructed by the invention are binary T-DNA vectors, the T-DNA related by the invention mainly comprises a hygromycin phosphotransferase HPT gene and an nCas9 nuclease gene, and for a rice genome, exogenous DNA represented by the two genes needs to be removed for the following reasons: 1) the hygromycin phosphotransferase HPT gene mainly serves as a screening marker in the genetic transformation process, and the correspondingly coded hygromycin protein is a type of antibiotic; 2) the nCas9 gene has the main function of completing the site-specific cutting of a target gene target site, and secondary editing possibly caused by continuously remaining in a plant; 3) random insertion of T-DNA may also cause unexpected gene mutation, which is not favorable for stable character; 4) the social sensitivity of the transgene problem is high, and the public acceptance degree of T-DNA knockout materials is high.
In the process of agrobacterium-mediated transformation of Sutom 118, the T-DNA sequence can be randomly inserted into chromosome in a single copy or multiple copy form, and because rice is a relatively strict self-pollinated homologous diploid plant, and the T-DNA insertion site is generally not linked with the target site thereof, on the technical level, a plant not carrying T-DNA can be obtained by separation and identification in the later generation generated by transgenic plant selfing, and even if linkage, a material not carrying T-DNA can be screened by genetic exchange recombination. In order to obtain such plants which do not carry T-DNA, the present inventionA total of 4 strains of T were obtained by comparing B1-68, B2-42, B6-29 and B2-21 identified in example 1 1 Carrying out PCR detection on HPT gene and nCas9 gene of generation plant at the same time, repeating for 3 times, and screening T not carrying the two genes, namely T which is regarded as rejecting T-DNA 1 Generation individual, in which the primer hyg 283-F: TCCGGAAGTGCTTGACATT (SEQ ID NO: 15) and hyg 283-R: GTCGTCCATCACAGTTTGC (SEQ ID NO: 16) by PCR amplification of the HPT gene; with primer nCas 9-F: CGGCTACGCTGGGTACATC (SEQ ID NO: 17) and nCas 9-R: TTCTCGTTGGGCAGGTTCTT (SEQ ID NO: 18) was used to PCR amplify the nCas9 gene. Furthermore, during the addition process in the presence of the above-mentioned nCas9 protein (e.g. T in the present invention) 0 -T 1 Generations), the possible case of alteration of the type of mutation by secondary editing, requires a further genotype identification in the single strain or progeny of the T-DNA knockout (using methods and primers as described in example 1) to confirm that the mutant genotype has not been secondarily edited and is stably inherited. Each individual was specifically implemented as follows:
the B1-68 strain identified in example 1 was grown in an incubator and selfed to obtain T 1 And (5) seed generation. 107 seeds (T) were selected 1 Generation) to break dormancy, soak seeds, sowing in seedling trays and placing in a culture room, when the seedlings grow to have two leaves and one core, taking leaves to extract DNA, carrying out PCR detection by using the Hpt gene coding hygromycin and the nCas9 gene coding nCas9 nuclease (the method and the used primers are shown above in the embodiment), repeating the experiment for three times, and carrying out co-screening to obtain 10 single plants which can not be amplified to a target fragment, namely the single plants are regarded as T-DNA knockout single plants, wherein the proportion is 9.35%, and the T-DNA is supposed to be inserted into the rice genome in a multi-copy mode. Selecting one strain and naming it as 118-1-1, tracking the editing situation of the single target site (the genotype identification method and primers are shown in example 1), the result is shown in FIG. 3A, 118-1-1 is 475- 0 ) Consistent, indicating no secondary editing occurred. The single plant is planted in an incubator and selfed to obtain T 2 Generation of seed, still continuing the 118-9-15 nomenclature, wait for T 2 After breaking the dormancy of the seeds, soaking the seeds, sowing and planting the seeds in an incubator to verify the carrying condition of the T-DNAThe experiment is repeated three times, and the same previous generation is found, which shows that the strain T 1 -T 2 The generation did have knocked out T-DNA (FIG. 4); furthermore, the single plant was followed for target site editing and the same generation was found, indicating that the expression was determined from T o -T 2 The generation mutation genotype is stably inherited, namely GG at 475-476 th site of the Wx gene is mutated into AA, so that 159 th site amino acid is mutated into lysine from glycine. The nucleotide sequence of the Wx gene of the 118-1-1 mutant is shown as SEQ ID NO.1, the amino acid sequence of the encoded Wx protein is shown as SEQ ID NO.2, and the new allele obtained by cloning is named as Wx m6 。
The same method and steps are used for carrying out generation addition, deletion T-DNA and genotype re-identification to obtain T of B2-42 2 T of generation-stable, homozygous mutant line 118-3-2, B6-29 2 The generation-stable and homozygous mutant line 118-5-1. 118-3-2 and 118-5-1 are both T-DNA knockout lines (FIG. 4), the mutation types of target sites are 475- m6 The genes are the same, the nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence of the encoded Wx protein is shown as SEQ ID NO. 2. Furthermore, T of B2-21 was obtained 2 The generation-stable homozygous mutant line 118-9-15 is also a T-DNA knockout line (FIG. 4), and the mutation type of the target site mutation is 533-534 base CC to TT homozygous mutation, which results in the mutation of amino acid 178 from threonine to isoleucine. The nucleotide sequence of Wx gene of 118-9-15 mutant is shown as SEQ ID NO.3, the amino acid sequence of Wx protein coded by the mutant is shown as SEQ ID NO.4, and the cloned new allele is named as Wx m10 。
Wx identified by the invention m6 The 475-476 site GG of the gene is mutated into AA, and the 159 site amino acid is mutated into the lysine mutation from glycine, Wx m10 The mutation of the 533-534 th base CC to TT and the resulting mutation of the 178 th amino acid from threonine to isoleucine are reported for the first time.
Meanwhile, the invention firstly utilizes the gene editing technology to carry out the Wx gene editing on the rice varietyDue to single base editing, a new material which is stable in heredity and can remove T-DNA can be obtained within 2 years, and the new material specifically comprises the following components: construction of Wx Gene Single-base editing vector and genetic transformation of conventional japonica Rice (Su-reclaimed 118 in this example) for 4 months, T 0 Genotype identification of generation plant, 5 months of plant growth and fruiting, T 1 The generation plant eliminates T-DNA, the homozygous genotype is screened, and the plant grows and fruit for 5 months, T 2 The generation plant T-DNA detection, the homozygous genotype identification, the plant growth and the plant fruit are carried out for 5 months, and only about 19 months are needed in total, so that the new material (namely the T-DNA in the embodiment) which has the target genotype, is stable in heredity, eliminates the T-DNA and is propagated by adding generations can be finally obtained 3 Generations 118-1-1, 118-3-2, 118-5-1, and 118-9-15). Therefore, compared with chemical mutagenesis and conventional transformation breeding, the technology can accurately and efficiently create new soft rice alleles, and the breeding period of obtaining a new homozygous material is at least shortened by 4-6 years.
Example 3 phenotypic analysis of mutants
The Cooking and Cooking Quality (ECQ) is a direct factor influencing the selection of consumers, and is the most important evaluation index in the rice Quality constitution. Although China has gone out of the national standard of sensory evaluation method for rice cooking edible quality (GB/T15682-2008), the rice quality cannot be accurately identified by a manual tasting mode because the influence of subjective factors cannot be completely eliminated. Since starch is a major component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. This example utilizes the 4T's obtained in example 2 2 Seed (T) from homozygous mutants 118-1-1, 118-3-2, 118-5-1 and 118-9-15 with a knockout generation of T-DNA 3 Generation) were performed to determine some physicochemical indices of starch, and thus rice ECQ was objectively evaluated.
1. Determination of amylose content
The previous researches show that AC is an important character for determining the quality of the cooked taste of rice, is not only related to the viscosity and the softness of the rice, but also is closely related to a plurality of starch physicochemical parameters such as viscosity, gelatinization and retrogradation. The AC assay was carried out with reference to the Ministry of agriculture release standard NY147-88, 4 reference standard samples (AC: 1.5%, 10.6%, 16.4% and 25.6%) purchased from the Rice research institute of China. As shown in FIG. 5, the results are 12.9. + -. 0.1% for 118-1-1, 11.9. + -. 0.1% for 118-3-2, 11.9. + -. 0.1% for 118-5-1 and 9.8. + -. 0.2% for 118-9-15. Compared with 14.4 +/-0.2% of the wild type, the AC of 118-1-1, 118-3-2 and 118-5-1 with the same genotype is reduced by 1.5-2.5%, and the AC of 118-9-15 is reduced by 4.6%.
2. Rice RVA spectrum viscosity determination
There is a close relationship between the RVA profile characteristic of rice and the quality of cooked flavour of rice, measured using a rapid viscosity analyzer (RVA Super 4, NEWPORT SCIENTIFIC, Australia) with parameter settings according to the American Association of cereals AACC61-01 and 61-02 protocols. Previous studies have shown that rice with good taste quality tends to have a large disintegration value (BDV), rice with relatively non-retrogradation of the chills tends to have a small recovery value (CSV), and in addition, peak time PeT refers to the time taken for the sample to reach peak viscosity, generally the smaller the PeT, the better the expansion and breakage of the starch. Results Table 1 shows that BDV of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 are 943cP, 946cP, 1128cP and 1324cP, respectively, which are all significantly larger than 862cP of wild type; the CSV of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 are 1070cP, 1049cP, 1067cP and 1010cP, respectively, all significantly less than 1250cP of wild type; PeT of 118-1-1, 118-3-2, 118-5-1 and 118-9-15 is respectively 6.13min, 6.07min, 6min and 5.87min, which are all obviously smaller than 6.2min of the wild type. This data shows that the 4 mutants have better taste quality compared to the wild type, the cold meal is relatively non-retrograded, and the starch granules have better bulking and breakage during cooking. The overall variation of the characteristic values of the RVA is shown in figure 6A.
The data were analyzed for correlation in a step-by-step manner, and it was shown that BDV and AC showed very significant negative correlation, CSV and AC showed very significant positive correlation, and PeT and AC showed very significant positive correlation in each sample (fig. 6B).
TABLE 1 RVA spectral characteristics
Figure BDA0002359579440000181
3. Thermodynamic characteristics
The rice gelatinization and the quality of the cooked food flavor have a close relationship, the rice gelatinization with high gelatinization temperature needs higher cooking temperature, and thermodynamic parameters measured by a DSC instrument can accurately reflect the gelatinization characteristics of the rice. The thermodynamic properties of the starch granules were analyzed using a differential heating value scanner DSC (Q2000, TAInstructions, USA). As shown in Table 2, the temperatures To, Tp at each gelatinization stage were maximum values in wild-type WT, Tc was maximum value in 118-1-1, and To, Tp and Tc were minimum values in 118-3-2, but the overall difference was not large; the enthalpy of gelatinization Δ Hgel is greatest in 118-9-15 and smallest in WT, with no major difference remaining. The above results indicate that the gelatinization characteristics are random among the tested samples, and the gelatinization temperature of 118-1-1 is the largest and consistent with PaT measured by RVA instrument.
TABLE 2 thermodynamic Properties
Figure BDA0002359579440000182
4. Polished rice transparency observation
The transparency is one of the main indexes for measuring the appearance quality of rice, and the invention utilizes the wild type threo reclamation 118 (non-soft rice, transparent) and the Nanjing 9108 (Wx) mp Genotype soft rice, cloud) polished rice was used as a control, and the appearance of the polished rice was observed. Rice is hulled by a huller (SY88-TH, Korean Bilong) to obtain coarse rice, refined by a small-sized refined rice machine (BLH-3120, Burley constant, Taizhou) to obtain refined rice, and water content of the refined rice is measured by a water analyzer (Mettler, Switzerland) to ensure consistent water content of the tested sample. As a result, as shown in fig. 7, the rice of sovereign 118 showed transparency even at a water content of 10.1%, but the southern japonica 9108 showed cloudiness and poor transparency; the 4 mutants showed the same behavior as those of the reclamation of Suzhou 118 and still showed a transparent state. Indicating that the gene contains two new alleles (Wx) m6 ，Wx m10 ) Although the amylose content of the 4 mutants is reduced to different degrees, particularly the amylose content of the mutant 118-9-15AC is reduced to 9.8 percent, the mutants still have appearanceBut can maintain better transparency.
Example 4 Co-separation and preliminary functional analysis
1. Coseparation analysis
To verify that the AC reduction phenotype in the mutant is due to a mutation in the gene of interest, a co-segregation analysis was performed genetically. Using T obtained in example 2 2 Homozygous mutant 118-5-1(118-1-1, 118-3-2 and 118-5-1 with the same genotype and 118-5-1 as representative) and 118-9-15 plants with generation T-DNA knockout are respectively hybridized with high-generation stable breeding material 93042(AC 15.6 +/-0.2 percent), F 1 After selfing, 112 and 131F were obtained, respectively 2 Individuals were screened for genotype, the methods and primers used for genotype identification were as described in example 1, and then wild-type and homozygous mutant genotype individuals were selected for phenotypic analysis (with AC as a representative index), and the AC test method was as described in example 3.
The results showed that 118F were created in 118-5-1 and 93042 crosses 2 In the individual plants, 35 individual plants of wild type genotypes are obtained, and all ACs are more than 14%; obtaining homozygous Wx m6 23 individuals with mutant genotypes, all ACs<12% indicating Wx m6 And the AC-reduced phenotype.
131F created by hybridization between 118-9-15 and 93042 2 31 individuals of wild-type genotypes are obtained from the individual plants, and all ACs are more than 14%; obtaining homozygous Wx 10 24 individuals with mutant genotypes, all ACs<12% indicating Wx m10 And the AC-reduced phenotype.
The above results confirm that the AC reduction phenotype in the mutant is indeed due to mutation of the gene of interest.
2. Wild type Wx and Wx m6 、Wx m10 Detection of mutein Activity and correlation analysis with AC
As described above, the rice Wx gene is the major gene controlling amylose synthesis and encodes granular starch synthase. Generally, Wx enzyme activity is positively correlated with AC, and a material with reduced AC will have a corresponding decrease in enzyme activity. To verify this hypothesis, the enzymatic activity was carried out according to the method of the predecessor Detection (Liu DR et al, Plant Sci, 2013, 210, 141-150). As shown in FIG. 8A, the wild type Wx protease activity was the highest, 1011.3. + -. 80.3nmol/min/g, and the enzymatic activity of the mutant proteins was significantly reduced, among which Wx in 118-1-1, 118-3-2 and 118-5-1 m6 The activity of the compounds is 712.1 + -54.1, 688.3 + -40.0 and 913.3 + -63.0 nmol/min/g, respectively, Wx in 118-9-15 m10 The activity of (A) was shown to be the lowest, 439.4. + -. 30.1 nmol/min/g.
A step correlation analysis of the data indicated that Wx enzyme activity and AC appeared to be very significantly positively correlated in each sample (fig. 8B).
3. Three-dimensional structure prediction
Wild type, Wx, were paired using an online website (http:// www.sbg.bio.ic.ac.uk/phyre2/) m6 And Wx m10 The three-dimensional structure of the mutein is predicted. Wx compared to wild-type protein m6 Mutation of glycine to lysine at position 159 in the mutein did not alter the beta turn conformation at this site (FIGS. 9A-B); wx compared to wild-type protein m10 The mutation of threonine 178 to isoleucine in the mutein did not change the random coil conformation at this site (FIGS. 9C-D). The above results indicate that the phenotype of reduced mutant AC, reduced mutant protease activity is not due to conformational changes in the secondary structure of the protein caused by single amino acid variation. Presumably, the cause of the phenotype is: 1)159 and 178 amino acids are positioned in the core catalytic domain of the starch synthetase from 84 to 345, and the mutation affects the catalytic capability of the protein; 2) the 159 th and 178 th amino acids are close to the 33-36 th (Lys-Ser-Gly-Gly) amino acid residue, and the site is considered as a binding site of the ADP-glucose during the synthesis of starch and glycogen, and the mutation can cause the reduction of the binding capacity of the binding site; 3) the 159 and 178 amino acids may be phosphorylation sites, and the mutation causes a decrease in phosphorylation ability, resulting in a decrease in enzyme activity.
Example 5: application of Wx mutant protein and gene thereof in rice breeding
1、Wx m6 And Wx m10 Functional marker development and application
Molecular marker assisted selection is advantageously providedAnd (5) the breeding process is fast. Wx of the invention m6 And Wx m10 The gene is continuous two base mutations, enzyme digestion target point markers can be designed in a targeted manner, but the process is relatively complicated, allele specific PCR is developed, genotypes with high/low amylose content can be distinguished through two PCR, and the operation is simple, convenient and quick. The invention aims at the wild type and the mutant in Wx m6 Base variation at the 475-476 th site of the gene, wild type and mutant in Wx m10 The base variation of the 533-fold 534 locus of the gene utilizes the allele specific PCR principle to design 6 groups of primers (Table 3): against wild type and Wx m6 Wx 1-Wx 6 of genes against wild type and Wx m10 Wx 7-Wx 12 of the gene. Wherein Wx 1-Wx 12 share a downstream primer Wx-1R, and the upstream primers are respectively Wx-1F-Wx-12F. In order to further improve the specificity of the primer, base mismatch is introduced at the 3' end of the partial primer: the third last base at the 3' end of the Wx-3F and Wx-4F primers is mismatched into G from T; the third last base at the 3' end of the primers Wx-5F and Wx-6F is mismatched into C by T; the penultimate base at the 3' end of the primers Wx-13F and Wx-14F is mismatched into G from A; the penultimate base at the 3' end of the primers Wx-15F and Wx-16F is mismatched from A to C.
Through multiple rounds of screening and optimization of PCR reaction conditions, as shown in FIG. 10, it is found that the primer pairs Wx1 and Wx2 both have good amplification efficiency and specificity, and can be used for distinguishing wild type Wx from mutant Wx m6 Primer pairs for genotypes and heterozygous genotypes; the primer pair Wx9 and Wx10 both have good amplification efficiency and specificity, and can be used for distinguishing wild type Wx from mutant Wx m10 Genotype and heterozygous genotype primer pairs. The optimal reaction system for PCR is: 1 μ L of wild type or mutant DNA template, 7.5 μ L of 2 XPCR Taq enzyme mix, 0.75 μ L of upstream primer (2pM), 0.75 μ L of downstream primer (2pM), ddH 2 O5. mu.L. The PCR reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 30s at 56 ℃, 30s at 72 ℃ and 33 cycles; 5min at 72 ℃; storing at 4 ℃.
TABLE 3 molecular markers for detection of mutant genes
Figure BDA0002359579440000211
Note: the bases indicated by lower case letters are mismatched bases.
The rice variety is detected by using Wx1+ Wx2 and Wx9+ Wx10 markers. As shown in FIGS. 11A-B, it was found that 118-1-1, 118-3-2 and 118-5-1 were not band-amplified by Wx1 but band-amplified by Wx2 in the test sample, and wild type Sokoku 118, 118-9-15 and the remaining japonica or indica varieties (Nippon, Nanjing 9108, Huanghuazhan, 9311, Huai rice No. 5, Henong Jing No. 8, Nanjing 51, Neizu No. 7, Suxiu 867, Wu Yu Jing No. 27, Wu Yu Jing No. 29, Xu Rice No. 8, Xu Rice No. 9, and Yan Rice No. 16) were band-amplified by Wx1 but not band-amplified by Wx2, indicating that Wx1+ Wx2 were band-specific for detecting Wx m6 The variation of GG to AA at the 475-476 bases of the gene can be used for molecular marker-assisted selection breeding.
Furthermore, as shown in FIGS. 11C-D, 118-9-15 could not be band-amplified by Wx9 but could be band-amplified by Wx10, and wild type Suzhou reclamation 118, 118-1-1, 118-3-2, 118-5-1 and the rest of japonica or indica varieties could be band-amplified by Wx9 but could not be band-amplified by Wx 10. It shows that Wx9+ Wx10 can specifically detect Wx m10 Mutation of the 533-534 bases of the gene from CC to TT can be used for molecular marker-assisted selective breeding.
To validate the application of Wx1+ Wx2, Wx9+ Wx10 in sub-marker assisted selection breeding, 112 Fs created by 118-5-1 and 93042 crosses obtained in example 4 using Wx1+ Wx2 2 The results of the tests carried out on the individuals showed that the genotype detected and resolved by the marker was completely matched with the genotype detected by the sequencing method (see example 1) (including 35 wild-type individuals, 60 heterozygous individuals and 23 homozygous Wx) m6 Mutant individuals). Furthermore, 131F s created by hybridization of 18-9-15 and 93042 obtained in example 4 using Wx9+ Wx10 2 The detection was carried out in individuals and the results showed that the genotype detected and resolved using this marker was completely matched to the genotype detected using the sequencing method (see example 1) (31 wild-type individuals, 76 heterozygous individuals and 24 homozygous Wx) m10 Mutant individuals). The above results show thatThe markers Wx1+ Wx2 and Wx9+ Wx10 developed by the invention can be used for precise breeding of quality improvement breeding, and F is 2 The generation screening is carried out on homozygous genotypes with transparent appearance, reduced AC and improved taste quality, and further early generation selection can be carried out.
2. Directly uses the rice variety with excellent agronomic characters as background material to carry out transformation
Jinjing 818 is a conventional japonica rice variety bred by the rice institute in Tianjin, and is planted in Jingjin Tang japonica rice area. The variety is a non-soft rice variety with about 16% of AC, and the AC of the variety can be reduced by using the gene editing method described by the invention, and the taste quality can be improved on the premise of not influencing the appearance quality. The actual Jinjing 818 is from the germplasm resource platform of agricultural science institute of Jiangsu province.
1) The vector, transformation method and genotype identification method used are described in example 1. Finally, positive T transferred into pH-nCas9-PBE-wxb #9 is obtained 0 Generating 9 plants to obtain positive T transferred into pH-nCas9-PBE-wxb #24 0 6 plants are generated.
2) Mutant T-DNA knock-out, homozygous addition and re-genotype identification methods are described in example 2. As shown in FIGS. 12A-B, screening to obtain homozygous Wx m6 Mutant type, T-DNA knockout T 2 The generation lines are 5: 818-4-13, 818-5-8, 818-6-8, 818-10-2 and 818-4-15; obtaining homozygous Wx m10 Mutant type, T-DNA knockout T 2 1 generation line: 818-9-7.
3) And (4) performing phenotype identification on the mutant. AC. RVA viscosity measurements and polished rice transparency observations are given in example 3. As in fig. 12C, wild type AC was 14.1 ± 0.3% maximum, and each mutant was significantly reduced, with 818-9-7 being 7.6 ± 0.1% minimum. As in fig. 12D, the wild-type BDV had a minimum of 975cP, with each mutant significantly elevated, with 818-9-7 up to 1540 cP. As in FIG. 12E, the wild type CSV was at maximum 1295cP, and each mutant was significantly reduced, with 818-9-7 at minimum 912 cP. As in fig. 12F, wild-type PeT was 6.27min maximum, and each mutant was significantly reduced, with 818-9-7 min minimum of 5.6 min. As shown in fig. 12G, when the water content is 13.5%, the Jing 818 polished rice still appears transparent, but the Nanjing 9108 appears cloudy and has poor transparency; the 6 mutants showed the same appearance as jin-jing 818 and still showed a transparent state.
4) The enzyme activity was measured as described in example 4. The results are shown in FIG. 12H, where the activity of wild-type Wx protease is highest, 788.92 + -16.53 nmol/min/g, and the enzymatic activity of the mutant protein is significantly reduced, among which Wx in 818-9-7 m10 The activity of (D) was minimal, being 407. + -. 30.01 nmol/min/g.
The results show that Wx is directly created in the Jinjing 818 background m6 And Wx m10 The mutant can reproduce target excellent characters and quickly obtain related plant materials.
The above embodiments show that the Wx gene is single base edited by gene editing technique, and then screened in T 2 The generation can obtain a new material which eliminates T-DNA, reduces AC and improves the taste quality without influencing the appearance quality and has stable heredity. Compared with breeding means such as chemical mutagenesis, hybridization and matching and the like, the method for directionally improving the molecular breeding technology by gene editing has the advantages of rapidness, accuracy, high efficiency and the like, and by combining gene function marker genotype selection or directly using other mature rice varieties as background materials for transformation and obtaining corresponding materials, the breeding efficiency can be greatly improved, and the breeding process is greatly accelerated (Table 4).
TABLE 4 comparison of Gene editing Breeding methods with conventional breeding methods
Figure BDA0002359579440000231
Sequence listing
<110> institute of genetics and developmental biology, academy of agricultural sciences, academy of Chinese sciences, Jiangsu province
<120> Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding
<160> 31
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1830
<212> DNA
<213> Wx-m1 mutant Gene (grain-bound mutant synthase)
<400> 1
atgtcggctc tcaccacgtc ccagctcgcc acctcggcca ccggcttcgg catcgccgac 60
aggtcggcgc cgtcgtcgct gctccgccac gggttccagg gcctcaagcc ccgcagcccc 120
gccggcggcg acgcgacgtc gctcagcgtg acgaccagcg cgcgcgcgac gcccaagcag 180
cagcggtcgg tgcagcgtgg cagccggagg ttcccctccg tcgtcgtgta cgccaccggc 240
gccggcatga acgtcgtgtt cgtcggcgcc gagatggccc cctggagcaa gaccggcggc 300
ctcggtgacg tcctcggtgg cctcccccct gccatggctg cgaatggcca cagggtcatg 360
gtgatctctc ctcggtacga ccagtacaag gacgcttggg ataccagcgt tgtggctgag 420
atcaaggttg cagacaggta cgagagggtg aggtttttcc attgctacaa gcgtaaagtc 480
gaccgtgtgt tcatcgacca tccgtcattc ctggagaagg tttggggaaa gaccggtgag 540
aagatctacg gacctgacac tggagttgat tacaaagaca accagatgcg tttcagcctt 600
ctttgccagg cagcactcga ggctcctagg atcctaaacc tcaacaacaa cccatacttc 660
aaaggaactt atggtgagga tgttgtgttc gtctgcaacg actggcacac tggcccactg 720
gcgagctacc tgaagaacaa ctaccagccc aatggcatct acaggaatgc aaaggttgct 780
ttctgcatcc acaacatctc ctaccagggc cgtttcgctt tcgaggatta ccctgagctg 840
aacctctccg agaggttcag gtcatccttc gatttcatcg acgggtatga cacgccggtg 900
gagggcagga agatcaactg gatgaaggcc ggaatcctgg aagccgacag ggtgctcacc 960
gtgagcccgt actacgccga ggagctcatc tccggcatcg ccaggggatg cgagctcgac 1020
aacatcatgc ggctcaccgg catcaccggc atcgtcaacg gcatggacgt cagcgagtgg 1080
gatcctagca aggacaagta catcaccgcc aagtacgacg caaccacggc aatcgaggcg 1140
aaggcgctga acaaggaggc gttgcaggcg gaggcgggtc ttccggtcga caggaaaatc 1200
ccactgatcg cgttcatcgg caggctggag gaacagaagg gccctgacgt catggccgcc 1260
gccatcccgg agctcatgca ggaggacgtc cagatcgttc ttctgggtac tggaaagaag 1320
aagttcgaga agctgctcaa gagcatggag gagaagtatc cgggcaaggt gagggccgtg 1380
gtgaagttca acgcgccgct tgctcatctc atcatggccg gagccgacgt gctcgccgtc 1440
cccagccgct tcgagccctg tggactcatc cagctgcagg ggatgagata cggaacgccc 1500
tgtgcttgcg cgtccaccgg tgggctcgtg gacacggtca tcgaaggcaa gactggtttc 1560
cacatgggcc gtctcagcgt cgactgcaag gtggtggagc caagcgacgt gaagaaggtg 1620
gcggccaccc tgaagcgcgc catcaaggtc gtcggcacgc cggcgtacga ggagatggtc 1680
aggaactgca tgaaccagga cctctcctgg aaggggcctg cgaagaactg ggagaatgtg 1740
ctcctgggcc tgggcgtcgc cggcagcgcg ccggggatcg aaggcgacga gatcgcgccg 1800
ctcgccaagg agaacgtggc tgctccttga 1830
<210> 2
<211> 609
<212> PRT
<213> Wx-m1 mutant protein (grain-bound stage synthsase)
<400> 2
Met Ser Ala Leu Thr Thr Ser Gln Leu Ala Thr Ser Ala Thr Gly Phe
1 5 10 15
Gly Ile Ala Asp Arg Ser Ala Pro Ser Ser Leu Leu Arg His Gly Phe
20 25 30
Gln Gly Leu Lys Pro Arg Ser Pro Ala Gly Gly Asp Ala Thr Ser Leu
35 40 45
Ser Val Thr Thr Ser Ala Arg Ala Thr Pro Lys Gln Gln Arg Ser Val
50 55 60
Gln Arg Gly Ser Arg Arg Phe Pro Ser Val Val Val Tyr Ala Thr Gly
65 70 75 80
Ala Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser
85 90 95
Lys Thr Gly Gly Leu Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met
100 105 110
Ala Ala Asn Gly His Arg Val Met Val Ile Ser Pro Arg Tyr Asp Gln
115 120 125
Tyr Lys Asp Ala Trp Asp Thr Ser Val Val Ala Glu Ile Lys Val Ala
130 135 140
Asp Arg Tyr Glu Arg Val Arg Phe Phe His Cys Tyr Lys Arg Lys Val
145 150 155 160
Asp Arg Val Phe Ile Asp His Pro Ser Phe Leu Glu Lys Val Trp Gly
165 170 175
Lys Thr Gly Glu Lys Ile Tyr Gly Pro Asp Thr Gly Val Asp Tyr Lys
180 185 190
Asp Asn Gln Met Arg Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala
195 200 205
Pro Arg Ile Leu Asn Leu Asn Asn Asn Pro Tyr Phe Lys Gly Thr Tyr
210 215 220
Gly Glu Asp Val Val Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu
225 230 235 240
Ala Ser Tyr Leu Lys Asn Asn Tyr Gln Pro Asn Gly Ile Tyr Arg Asn
245 250 255
Ala Lys Val Ala Phe Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe
260 265 270
Ala Phe Glu Asp Tyr Pro Glu Leu Asn Leu Ser Glu Arg Phe Arg Ser
275 280 285
Ser Phe Asp Phe Ile Asp Gly Tyr Asp Thr Pro Val Glu Gly Arg Lys
290 295 300
Ile Asn Trp Met Lys Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr
305 310 315 320
Val Ser Pro Tyr Tyr Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly
325 330 335
Cys Glu Leu Asp Asn Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val
340 345 350
Asn Gly Met Asp Val Ser Glu Trp Asp Pro Ser Lys Asp Lys Tyr Ile
355 360 365
Thr Ala Lys Tyr Asp Ala Thr Thr Ala Ile Glu Ala Lys Ala Leu Asn
370 375 380
Lys Glu Ala Leu Gln Ala Glu Ala Gly Leu Pro Val Asp Arg Lys Ile
385 390 395 400
Pro Leu Ile Ala Phe Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp
405 410 415
Val Met Ala Ala Ala Ile Pro Glu Leu Met Gln Glu Asp Val Gln Ile
420 425 430
Val Leu Leu Gly Thr Gly Lys Lys Lys Phe Glu Lys Leu Leu Lys Ser
435 440 445
Met Glu Glu Lys Tyr Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn
450 455 460
Ala Pro Leu Ala His Leu Ile Met Ala Gly Ala Asp Val Leu Ala Val
465 470 475 480
Pro Ser Arg Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg
485 490 495
Tyr Gly Thr Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr
500 505 510
Val Ile Glu Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp
515 520 525
Cys Lys Val Val Glu Pro Ser Asp Val Lys Lys Val Ala Ala Thr Leu
530 535 540
Lys Arg Ala Ile Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val
545 550 555 560
Arg Asn Cys Met Asn Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn
565 570 575
Trp Glu Asn Val Leu Leu Gly Leu Gly Val Ala Gly Ser Ala Pro Gly
580 585 590
Ile Glu Gly Asp Glu Ile Ala Pro Leu Ala Lys Glu Asn Val Ala Ala
595 600 605
Pro
<210> 3
<211> 1830
<212> DNA
<213> Wx-m2 mutant Gene (grain-bound mutant synthase)
<400> 3
atgtcggctc tcaccacgtc ccagctcgcc acctcggcca ccggcttcgg catcgccgac 60
aggtcggcgc cgtcgtcgct gctccgccac gggttccagg gcctcaagcc ccgcagcccc 120
gccggcggcg acgcgacgtc gctcagcgtg acgaccagcg cgcgcgcgac gcccaagcag 180
cagcggtcgg tgcagcgtgg cagccggagg ttcccctccg tcgtcgtgta cgccaccggc 240
gccggcatga acgtcgtgtt cgtcggcgcc gagatggccc cctggagcaa gaccggcggc 300
ctcggtgacg tcctcggtgg cctcccccct gccatggctg cgaatggcca cagggtcatg 360
gtgatctctc ctcggtacga ccagtacaag gacgcttggg ataccagcgt tgtggctgag 420
atcaaggttg cagacaggta cgagagggtg aggtttttcc attgctacaa gcgtggagtc 480
gaccgtgtgt tcatcgacca tccgtcattc ctggagaagg tttggggaaa gattggtgag 540
aagatctacg gacctgacac tggagttgat tacaaagaca accagatgcg tttcagcctt 600
ctttgccagg cagcactcga ggctcctagg atcctaaacc tcaacaacaa cccatacttc 660
aaaggaactt atggtgagga tgttgtgttc gtctgcaacg actggcacac tggcccactg 720
gcgagctacc tgaagaacaa ctaccagccc aatggcatct acaggaatgc aaaggttgct 780
ttctgcatcc acaacatctc ctaccagggc cgtttcgctt tcgaggatta ccctgagctg 840
aacctctccg agaggttcag gtcatccttc gatttcatcg acgggtatga cacgccggtg 900
gagggcagga agatcaactg gatgaaggcc ggaatcctgg aagccgacag ggtgctcacc 960
gtgagcccgt actacgccga ggagctcatc tccggcatcg ccaggggatg cgagctcgac 1020
aacatcatgc ggctcaccgg catcaccggc atcgtcaacg gcatggacgt cagcgagtgg 1080
gatcctagca aggacaagta catcaccgcc aagtacgacg caaccacggc aatcgaggcg 1140
aaggcgctga acaaggaggc gttgcaggcg gaggcgggtc ttccggtcga caggaaaatc 1200
ccactgatcg cgttcatcgg caggctggag gaacagaagg gccctgacgt catggccgcc 1260
gccatcccgg agctcatgca ggaggacgtc cagatcgttc ttctgggtac tggaaagaag 1320
aagttcgaga agctgctcaa gagcatggag gagaagtatc cgggcaaggt gagggccgtg 1380
gtgaagttca acgcgccgct tgctcatctc atcatggccg gagccgacgt gctcgccgtc 1440
cccagccgct tcgagccctg tggactcatc cagctgcagg ggatgagata cggaacgccc 1500
tgtgcttgcg cgtccaccgg tgggctcgtg gacacggtca tcgaaggcaa gactggtttc 1560
cacatgggcc gtctcagcgt cgactgcaag gtggtggagc caagcgacgt gaagaaggtg 1620
gcggccaccc tgaagcgcgc catcaaggtc gtcggcacgc cggcgtacga ggagatggtc 1680
aggaactgca tgaaccagga cctctcctgg aaggggcctg cgaagaactg ggagaatgtg 1740
ctcctgggcc tgggcgtcgc cggcagcgcg ccggggatcg aaggcgacga gatcgcgccg 1800
ctcgccaagg agaacgtggc tgctccttga 1830
<210> 4
<211> 609
<212> PRT
<213> Wx-m2 mutant protein (grain-bound stage synthsase)
<400> 4
Met Ser Ala Leu Thr Thr Ser Gln Leu Ala Thr Ser Ala Thr Gly Phe
1 5 10 15
Gly Ile Ala Asp Arg Ser Ala Pro Ser Ser Leu Leu Arg His Gly Phe
20 25 30
Gln Gly Leu Lys Pro Arg Ser Pro Ala Gly Gly Asp Ala Thr Ser Leu
35 40 45
Ser Val Thr Thr Ser Ala Arg Ala Thr Pro Lys Gln Gln Arg Ser Val
50 55 60
Gln Arg Gly Ser Arg Arg Phe Pro Ser Val Val Val Tyr Ala Thr Gly
65 70 75 80
Ala Gly Met Asn Val Val Phe Val Gly Ala Glu Met Ala Pro Trp Ser
85 90 95
Lys Thr Gly Gly Leu Gly Asp Val Leu Gly Gly Leu Pro Pro Ala Met
100 105 110
Ala Ala Asn Gly His Arg Val Met Val Ile Ser Pro Arg Tyr Asp Gln
115 120 125
Tyr Lys Asp Ala Trp Asp Thr Ser Val Val Ala Glu Ile Lys Val Ala
130 135 140
Asp Arg Tyr Glu Arg Val Arg Phe Phe His Cys Tyr Lys Arg Gly Val
145 150 155 160
Asp Arg Val Phe Ile Asp His Pro Ser Phe Leu Glu Lys Val Trp Gly
165 170 175
Lys Ile Gly Glu Lys Ile Tyr Gly Pro Asp Thr Gly Val Asp Tyr Lys
180 185 190
Asp Asn Gln Met Arg Phe Ser Leu Leu Cys Gln Ala Ala Leu Glu Ala
195 200 205
Pro Arg Ile Leu Asn Leu Asn Asn Asn Pro Tyr Phe Lys Gly Thr Tyr
210 215 220
Gly Glu Asp Val Val Phe Val Cys Asn Asp Trp His Thr Gly Pro Leu
225 230 235 240
Ala Ser Tyr Leu Lys Asn Asn Tyr Gln Pro Asn Gly Ile Tyr Arg Asn
245 250 255
Ala Lys Val Ala Phe Cys Ile His Asn Ile Ser Tyr Gln Gly Arg Phe
260 265 270
Ala Phe Glu Asp Tyr Pro Glu Leu Asn Leu Ser Glu Arg Phe Arg Ser
275 280 285
Ser Phe Asp Phe Ile Asp Gly Tyr Asp Thr Pro Val Glu Gly Arg Lys
290 295 300
Ile Asn Trp Met Lys Ala Gly Ile Leu Glu Ala Asp Arg Val Leu Thr
305 310 315 320
Val Ser Pro Tyr Tyr Ala Glu Glu Leu Ile Ser Gly Ile Ala Arg Gly
325 330 335
Cys Glu Leu Asp Asn Ile Met Arg Leu Thr Gly Ile Thr Gly Ile Val
340 345 350
Asn Gly Met Asp Val Ser Glu Trp Asp Pro Ser Lys Asp Lys Tyr Ile
355 360 365
Thr Ala Lys Tyr Asp Ala Thr Thr Ala Ile Glu Ala Lys Ala Leu Asn
370 375 380
Lys Glu Ala Leu Gln Ala Glu Ala Gly Leu Pro Val Asp Arg Lys Ile
385 390 395 400
Pro Leu Ile Ala Phe Ile Gly Arg Leu Glu Glu Gln Lys Gly Pro Asp
405 410 415
Val Met Ala Ala Ala Ile Pro Glu Leu Met Gln Glu Asp Val Gln Ile
420 425 430
Val Leu Leu Gly Thr Gly Lys Lys Lys Phe Glu Lys Leu Leu Lys Ser
435 440 445
Met Glu Glu Lys Tyr Pro Gly Lys Val Arg Ala Val Val Lys Phe Asn
450 455 460
Ala Pro Leu Ala His Leu Ile Met Ala Gly Ala Asp Val Leu Ala Val
465 470 475 480
Pro Ser Arg Phe Glu Pro Cys Gly Leu Ile Gln Leu Gln Gly Met Arg
485 490 495
Tyr Gly Thr Pro Cys Ala Cys Ala Ser Thr Gly Gly Leu Val Asp Thr
500 505 510
Val Ile Glu Gly Lys Thr Gly Phe His Met Gly Arg Leu Ser Val Asp
515 520 525
Cys Lys Val Val Glu Pro Ser Asp Val Lys Lys Val Ala Ala Thr Leu
530 535 540
Lys Arg Ala Ile Lys Val Val Gly Thr Pro Ala Tyr Glu Glu Met Val
545 550 555 560
Arg Asn Cys Met Asn Gln Asp Leu Ser Trp Lys Gly Pro Ala Lys Asn
565 570 575
Trp Glu Asn Val Leu Leu Gly Leu Gly Val Ala Gly Ser Ala Pro Gly
580 585 590
Ile Glu Gly Asp Glu Ile Ala Pro Leu Ala Lys Glu Asn Val Ala Ala
595 600 605
Pro
<210> 5
<211> 18
<212> DNA
<213> Wx-F(Artificial Sequence)
<400> 5
ccctagccac ccaagaaa 18
<210> 6
<211> 22
<212> DNA
<213> Wx-F(Artificial Sequence)
<400> 6
cacccagaag agtacaacat ca 22
<210> 7
<211> 20
<212> DNA
<213> wxb#9(Artificial Sequence)
<400> 7
cgactccacg cttgtagcaa 20
<210> 8
<211> 20
<212> DNA
<213> wxb#24(Artificial Sequence)
<400> 8
aagaccggtg agaagatcta 20
<210> 9
<211> 24
<212> DNA
<213> wxb#9-F(Artificial Sequence)
<400> 9
ggcgcgactc cacgcttgta gcaa 24
<210> 10
<211> 24
<212> DNA
<213> wxb#9-R(Artificial Sequence)
<400> 10
aaacttgcta caagcgtgga gtcg 24
<210> 11
<211> 24
<212> DNA
<213> wxb#24-F(Artificial Sequence)
<400> 11
ggcgaagacc ggtgagaaga tcta 24
<210> 12
<211> 24
<212> DNA
<213> wxb#24-R(Artificial Sequence)
<400> 12
aaactagatc ttctcaccgg tctt 24
<210> 13
<211> 17
<212> DNA
<213> Wxb-PCR-F(Artificial Sequence)
<400> 13
caagcagcag cggtcgg 17
<210> 14
<211> 24
<212> DNA
<213> Wxb-PCR-R(Artificial Sequence)
<400> 14
ttgaagtatg ggttgttgtt gagg 24
<210> 15
<211> 19
<212> DNA
<213> hyg283-F(Artificial Sequence)
<400> 15
tccggaagtg cttgacatt 19
<210> 16
<211> 19
<212> DNA
<213> hyg283-R(Artificial Sequence)
<400> 16
gtcgtccatc acagtttgc 19
<210> 17
<211> 19
<212> DNA
<213> nCas9-F(Artificial Sequence)
<400> 17
cggctacgct gggtacatc 19
<210> 18
<211> 20
<212> DNA
<213> nCas9-R(Artificial Sequence)
<400> 18
ttctcgttgg gcaggttctt 20
<210> 19
<211> 20
<212> DNA
<213> Wx-1F(Artificial Sequence)
<400> 19
ttccattgct acaagcgtgg 20
<210> 20
<211> 21
<212> DNA
<213> Wx-1R(Artificial Sequence)
<400> 20
tcatcatgga ttccttcgaa g 21
<210> 21
<211> 20
<212> DNA
<213> Wx-2F(Artificial Sequence)
<400> 21
ttccattgct acaagcgtaa 20
<210> 22
<211> 20
<212> DNA
<213> Wx-3F(Artificial Sequence)
<400> 22
ttccattgct acaagcgggg 20
<210> 23
<211> 20
<212> DNA
<213> Wx-4F(Artificial Sequence)
<400> 23
ttccattgct acaagcggaa 20
<210> 24
<211> 20
<212> DNA
<213> Wx-5F(Artificial Sequence)
<400> 24
ttccattgct acaagcgcgg 20
<210> 25
<211> 20
<212> DNA
<213> Wx-6F(Artificial Sequence)
<400> 25
ttccattgct acaagcgcaa 20
<210> 26
<211> 22
<212> DNA
<213> Wx-7F(Artificial Sequence)
<400> 26
atttcaggtt tggggaaaga cc 22
<210> 27
<211> 22
<212> DNA
<213> Wx-8F(Artificial Sequence)
<400> 27
atttcaggtt tggggaaaga tt 22
<210> 28
<211> 22
<212> DNA
<213> Wx-9F(Artificial Sequence)
<400> 28
atttcaggtt tggggaaagg cc 22
<210> 29
<211> 22
<212> DNA
<213> Wx-10F(Artificial Sequence)
<400> 29
atttcaggtt tggggaaagg tt 22
<210> 30
<211> 22
<212> DNA
<213> Wx-11F(Artificial Sequence)
<400> 30
atttcaggtt tggggaaagc cc 22
<210> 31
<211> 22
<212> DNA
<213> Wx-12F(Artificial Sequence)
<400> 31
atttcaggtt tggggaaagc tt 22

Claims (15)

1. A rice Wx mutant protein, wherein the amino acid sequence of the Wx mutant protein comprises the following mutations: the 159 th amino acid of the amino acid sequence of the rice Wx is mutated, and the amino acid sequence is shown as SEQ ID NO. 2.
2. A nucleic acid or gene encoding the mutant protein of claim 1.
3. The nucleic acid or gene of claim 2, having a nucleotide sequence as set forth in SEQ ID NO 1.
4. A primer pair for identifying the nucleic acid or the gene as claimed in claim 2 or 3, wherein the primer pair is Wx1 and/or Wx2, the sequences of the primer pair Wx1 are shown as SEQ ID NO. 19 and SEQ ID NO. 20, and the sequences of the primer pair Wx2 are shown as SEQ ID NO. 20 and SEQ ID NO. 21.
5. An expression cassette or recombinant vector comprising the nucleic acid or gene of claim 2 or 3.
6. Use of the rice Wx mutant protein of claim 1, the nucleic acid or gene of claim 2 or 3, the primer pair of claim 4, the expression cassette or recombinant vector of claim 5 for obtaining transparent appearance, improved quality of rice with reduced amylose content, transparent appearance, identification of rice line/variety with reduced amylose content, transparent appearance, creation and/or breeding of rice line variety with reduced amylose content.
7. Method for obtaining a quality-improved plant with a transparent appearance and a suitably reduced amylose content, characterized in that it comprises the following steps:
1) allowing a plant to comprise the nucleic acid or gene of claim 2 or 3; or
2) Expressing in a plant the rice Wx mutant protein of claim 1; the plant is rice.
8. A breeding method for creating quality-improved rice with a transparent appearance and a properly reduced amylose content by using gene editing, characterized by comprising the steps of:
1）Wxcloning of genes and designing target sites for gene editing; the nucleotide sequence of the target site edited by the gene is shown as SEQ ID NO. 7;
2) constructing a single-base editing vector containing a target fragment;
3) a rice having improved rice quality, which comprises the mutein of claim 1, the nucleic acid or gene of claim 2 or 3, has a transparent appearance and an appropriately reduced amylose content 0 Obtaining a plant generation;
4) mutation of target Gene into T 0 T obtained by selfing transgenic plants 1 Removing T-DNA fragments of the generation plants;
5) T-DNA-knocked-out T 1 And identifying the genotype of the generation plant and obtaining the target gene homozygous mutant plant.
9. A breeding method according to claim 8, characterized in that the method for constructing the single-nucleotide editing vector containing the target fragment in step 2) is as follows:
A) Preparing a target joint fragment: ddH for adaptor primer 2 Dissolving O into mother liquor, mixing and diluting the complementary paired joint primers, performing high-temperature denaturation, transferring to room temperature, cooling, and finishing annealing to obtain a target joint fragment;
B) target adaptor fragment ligation to intermediate vector: carrying out enzyme digestion by using a pHUE411 intermediate vector and a restriction enzyme BsaI to obtain a BsaI single-enzyme digestion pHUE411 vector; performing a ligation reaction by using a BsaI single-enzyme-digested pHUE411 vector, a target joint fragment and T4 ligase, performing escherichia coli transformation, and sequencing to obtain an intermediate vector plasmid containing the target joint fragment;
C) constructing a final vector: carrying out double enzyme digestion on a pH-nCas9-PBE binary expression vector, restriction enzymes PmeI and AvrII to obtain a double enzyme digested pH-nCas9-PBE vector; carrying out double enzyme digestion on an intermediate vector plasmid containing a target joint fragment, PmeI and AvrII to obtain an sgRNA expression cassette containing the target joint fragment and a corresponding promoter; performing ligation reaction by using a double-enzyme-digested pH-nCas9-PBE vector, a sgRNA expression cassette and T4 ligase, performing escherichia coli transformation, and sequencing to obtain a single-base editing vector finally containing a target fragment.
10. A breeding method according to claim 8, characterized in that the method of obtaining in step 3) is as follows: transferring the single base editing vector containing the target segment obtained in the step 2) into agrobacterium EHA105 and carrying out genetic transformation to obtain T 0 Generating transgenic plants, and obtaining T by using primers Wxb-PCR-F and Wxb-PCR-R 0 And (3) amplifying and sequencing the transgenic plant to identify the genotype, and obtaining the plant with the mutant protein of claim 1 and the nucleic acid or the gene of claim 2 or 3, wherein the Wxb-PCR-F sequence is shown as SEQ ID NO. 13, and the Wxb-PCR-R sequence is shown as SEQ ID NO. 14.
11. A method as claimed in claim 8, whereinThe T-DNA fragment of the step 4) comprises a hygromycin phosphotransferase geneHPTAnd nuclease genenCas9。
12. A breeding method as claimed in claim 8, characterized in that the T-DNA fragments of step 4) are knocked out by mutating T of the target gene 0 T obtained by selfing transgenic plants 1 For plantsHPTGenes andnCas9the genes are simultaneously detected and repeated for many times, and T which does not carry the two genes is obtained by screening 1 The generation single plant is the target plant.
13. A method as claimed in claim 12, wherein the method is as set forth in claim 12HPTGene detection method by mutating T with target gene 0 T obtained by selfing transgenic plants 1 Taking genome DNA of the generation plant as a template, and taking hyg283-F and hyg283-R as primers to carry out PCR amplification, and meanwhile, carrying out PCR amplification on the genome DNA of the generation plant nCas9Gene detection method by mutating T with target gene 0 T obtained by selfing transgenic plants 1 Genome DNA of the generation plant is taken as a template, nCas9-F and nCas9-R are taken as primers for PCR amplification, and when none of the primers is detected at the same timeHPTGenes andnCas9genes show that T-DNA is successfully eliminated; the sequence of hyg283-F is shown as SEQ ID NO. 15, the sequence of hyg283-R is shown as SEQ ID NO. 16, the sequence of nCas9-F is shown as SEQ ID NO. 17, and the sequence of nCas9-R is shown as SEQ ID NO. 18.
14. A breeding method according to claim 8, characterized in that the homozygous mutant plant for the target gene obtained in step 5) is obtained by knocking out T-DNA obtained in step 4) 1 Using genome DNA of a generation plant as a template, using Wxb-PCR-F and Wxb-PCR-R as primers to carry out PCR amplification and sequencing, and screening and obtaining a homozygous plant which has the mutant protein of claim 1 and the nucleic acid or the gene of claim 2 or 3, wherein the Wxb-PCR-F sequence is shown as SEQ ID NO. 13, and the Wxb-PCR-R sequence is shown as SEQ ID NO. 14.
15. Method for identifying plants obtained by the method according to claim 7, characterized in that it comprises the following steps:
1) determining whether the amylose content of the plant is reduced; and/or
2) Determining whether the RVA spectrum viscosity index disintegration value of the plant rice is increased or not; and/or
3) Determining whether the RVA spectrum viscosity index recovery value of the plant rice is reduced or not; and/or
4) Determining whether the RVA spectrum viscosity index peak time of the plant rice is reduced or not; and/or
5) Determining whether the appearance of the plant polished rice is transparent; the plant is rice.
CN202010021140.2A 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding Active CN111197034B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202210501884.3A CN114891759A (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding
CN202010021140.2A CN111197034B (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010021140.2A CN111197034B (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202210501884.3A Division CN114891759A (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding

Publications (2)

Publication Number Publication Date
CN111197034A CN111197034A (en) 2020-05-26
CN111197034B true CN111197034B (en) 2022-07-29

Family

ID=70744656

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202010021140.2A Active CN111197034B (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding
CN202210501884.3A Pending CN114891759A (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202210501884.3A Pending CN114891759A (en) 2020-01-08 2020-01-08 Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding

Country Status (1)

Country Link
CN (2) CN111197034B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111424036B (en) * 2020-03-16 2021-11-02 华中农业大学 New rice Wx allele and application thereof in breeding
WO2021254268A1 (en) * 2020-06-15 2021-12-23 山东舜丰生物科技有限公司 Polypeptide and nucleic acid capable of changing content of amylose in plants and use thereof
CN113462702B (en) * 2020-06-22 2023-06-27 山东舜丰生物科技有限公司 Mutant wall gene and application thereof
CN114763555B (en) * 2020-12-30 2024-03-01 中国科学院分子植物科学卓越创新中心 Method and reagent for realizing high-yield and high-quality breeding by utilizing gene editing
CN112760304A (en) * 2021-03-04 2021-05-07 上海师范大学 GBSSI mutant protein based on gene editing technology and application thereof in plant breeding
CN114058639B (en) * 2021-10-29 2023-11-07 中国种子集团有限公司 Method for improving amylose content of rice by mutating OsWaxy gene by single base gene editing technology
CN114438101A (en) * 2022-03-10 2022-05-06 江苏省农业科学院 Allele with transparent rice appearance and low amylose content and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108841838B (en) * 2018-07-09 2021-08-17 江苏省农业科学院 Novel allele for controlling low amylose content of rice and application thereof
CN108531645B (en) * 2018-07-09 2021-07-27 江苏省农业科学院 Functional marker of low amylose content gene wx-C39 and application thereof
CN108949753B (en) * 2018-07-26 2022-03-08 扬州大学 Gene expression vector WxbConstruction of-10T, preparation of transgenic rice and primer
CN109097346B (en) * 2018-09-06 2021-07-13 江苏省农业科学院 ALS mutant protein based on gene editing technology and application of ALS mutant protein gene in plant breeding
WO2021147134A1 (en) * 2020-01-21 2021-07-29 扬州大学 Method for cultivating and screening rice on basis of amylose content and use of novel wx promoters created thereby
CN111849970A (en) * 2020-01-21 2020-10-30 扬州大学 Rice cultivation and screening method based on amylose content
CN112760304A (en) * 2021-03-04 2021-05-07 上海师范大学 GBSSI mutant protein based on gene editing technology and application thereof in plant breeding

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
小麦Wx基因突变体的建立及其淀粉特性的研究;翟红梅;《作物学报》;20070903;第1059-1066页 *

Also Published As

Publication number Publication date
CN114891759A (en) 2022-08-12
CN111197034A (en) 2020-05-26

Similar Documents

Publication Publication Date Title
CN111197034B (en) Wx mutant protein based on gene editing technology and application of gene thereof in plant breeding
Zhang et al. Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties
CN106191107B (en) Molecular improvement method for reducing rice grain falling property
CN112961231B (en) Male sterile gene ZmbHLH122 and application thereof in creating maize male sterile line
CN107475210B (en) Rice bacterial leaf blight resistance related gene OsABA2 and application thereof
CN110684796B (en) Method for specifically knocking out soybean lipoxygenase gene by CRISPR-Cas9 and application thereof
CN109234288B (en) Application of rape BnA9-2 gene in improving pod shatter resistance of rape
CN110964743B (en) Method for editing and creating rice amylose content variation by using promoter
JP5050189B2 (en) Processed food varieties judgment method
CN109750062A (en) A kind of rice breeding method
CN112680459B (en) Male sterile gene ZmTGA10 and application thereof in creating male sterile line of corn
JP2011120597A (en) Method for selecting genomic dna fragment
CN113862265A (en) Method for improving rice grain shape and appearance quality
CN112011547B (en) Major gene for controlling rape leaf shape and application thereof
CN113455378A (en) Breeding method of corn haploid induction line and application thereof
CN116218876A (en) Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof
CN112680460B (en) Male sterile gene ZmTGA9 and application thereof in creating male sterile line of corn
AU2009214643A1 (en) Dominant earliness mutation and gene in sunflower (helianthus annuus)
WO2021147134A1 (en) Method for cultivating and screening rice on basis of amylose content and use of novel wx promoters created thereby
CN113365494A (en) Solanaceae plant capable of causing seed abortion type fruit formation
CN104293808A (en) Liriodendron hybrids LhMKK2 gene and expression protein and application thereof
CN113215187A (en) Method for rapidly obtaining fragrant rice material by using CRISPR/Cas9 technology
CN112175969B (en) Preparation and application of corn ZmFKF1 gene and gene editing mutant thereof
CN117305326B (en) Broccoli BoCENH3 gene and application thereof in haploid induction
CN113403336B (en) Method for cultivating giant embryo japonica rice variety by editing rice giant embryo gene GE

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20200526

Assignee: Shanghai Blue Cross Medical Science Research Institute

Assignor: INSTITUTE OF GENETICS AND DEVELOPMENTAL BIOLOGY, CHINESE ACADEMY OF SCIENCES

Contract record no.: X2022990000347

Denomination of invention: Wx mutant protein based on gene editing technology and its gene application in plant breeding

License type: Common License

Record date: 20220705

EE01 Entry into force of recordation of patent licensing contract
GR01 Patent grant
GR01 Patent grant
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20200526

Assignee: Suzhou Qihe Biotechnology Co.,Ltd.

Assignor: Shanghai Blue Cross Medical Science Research Institute

Contract record no.: X2023990000162

Denomination of invention: Wx mutant protein and its gene application in plant breeding based on gene editing technology

Granted publication date: 20220729

License type: Common License

Record date: 20230117

EE01 Entry into force of recordation of patent licensing contract