KR20230103927A - Composition for the prevention or treatment of sarcopenia comprising Udo peanut sprout extract as an active ingredient - Google Patents

Abstract

An object of the present invention is to provide a composition for preventing or treating muscle diseases comprising Udo peanut extract as an active ingredient, wherein the Udo peanut extract treats lipid accumulation and muscle weakness induced by a high fat / high sucrose diet. When the extract was administered to a muscle-weakened mouse model, it improved the strength and hanging ability, and the muscle atrophy factor MuRF-1 (Muscle RING-finger protein-1) and muscle atrophy F-box (MAFbx/Atrogin-1) Inhibition of expression was confirmed. In addition, it increases the expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α), which is a marker for mitochondrial biogenesis and functional activity in skeletal muscle cells (C2C12) It can be usefully used in related projects by confirming that it improves skeletal muscle atrophy and activates mitochondrial function.

Description

Composition for the prevention or treatment of sarcopenia comprising Udo peanut sprout extract as an active ingredient

An object of the present invention is to provide a composition for improving, preventing or treating sarcopenia containing Udo peanut sprout extract as an active ingredient.

Muscle cells that form muscles are composed of myofilaments, which cause contraction by changing the size of the cells. When muscle tissue contracts, tension is generated, which is called muscle strength. Muscles are body organs that are responsible for the movement of objects, maintenance of posture, secretion of body fluids, and the like through these strengths.

Muscle atrophy or sarcopenia refers to loss of size and mass of muscle cells and muscle tissue that occurs under various catabolic conditions such as hormonal imbalance, severe injury, sepsis, cancer, and aging. . Muscular atrophy or sarcopenia causes muscle loss, resulting in muscle weakness and fatigue, and aggravating complications. Muscular atrophy or sarcopenia is diagnosed through creatine kinase (CK), electromyography, muscle biopsy, molecular biological genetic test, cytogenetic test, and the like. Currently, as a method for treating muscle atrophy or sarcopenia, physical therapy is generally performed, and occupational therapy, breathing therapy, and supportive therapy for preventing complications, deformities, and functional disorders are concurrently used, but these treatments In that it has limitations as symptomatic therapy, there is an urgent need to develop a therapeutic agent for muscular atrophy.

Other reported causes of muscle atrophy or sarcopenia are muscle cell damage caused by increased oxides, decreased muscle protein production and regeneration due to decreased expression of stress proteins, and promotion of muscle protein degradation due to proteasome-ubiquitin activation. there is. In addition, many studies have reported that the degradation of proteins related to muscle mass is promoted by the administration of dexamethasone (DEX), a synthetic glucocorticoid known as an anti-inflammatory agent.

There is exercise as one method for preventing, improving or treating sarcopenia, which has been reported to increase the protein synthesis ability of skeletal muscle in the short term and increase muscle strength or mobility in the elderly, but is inappropriate as a long-term treatment method. Another way to prevent, ameliorate or treat sarcopenia is to administer drugs such as testosterone or anabolic steroids, which induce masculinization in women and prostate symptoms in men. side effects such as Accordingly, there is a need for research on novel methods for preventing, improving or treating sarcopenia.

Dexamethasone is used to treat various diseases such as cancer, but it causes muscle atrophy or sarcopenia by decreasing the rate of protein synthesis in skeletal muscle and increasing the rate of protein breakdown through the ubiquitin-proteasome system. Two muscle ubiquitin ligases are related to Atrogin-1 and MuRF1, and dexamethasone lowers MyoD (myogenic differentiation antigen) through Atrogin-1, and muscle mass is reduced through this mechanism.

Accordingly, the present inventors completed the present invention by confirming that the Udo peanut sprout extract can inhibit sarcopenia while conducting research on the physiological activity of the peanut sprout extract.

An object of the present invention is to provide a composition for muscle regeneration comprising peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In addition, an object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle damage disease comprising peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In addition, an object of the present invention is to provide a composition for improving exercise capacity containing peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In addition, an object of the present invention is to provide a composition for increasing muscle mass containing peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

The present invention provides a composition for muscle regeneration comprising peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating muscle damage disease comprising an extract of peanut ( Arachis hypogaea L. ) sprout as an active ingredient.

In addition, the present invention provides a composition for improving exercise capacity containing peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In addition, the present invention provides a composition for increasing muscle mass containing peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

The Udo peanut extract of the present invention treats muscle weakness induced by lipid accumulation and high-fat/high-sucrose diet, and when administered to a muscle-weakened mouse model, the Udo peanut extract improved strength and hanging ability, and was a muscle atrophy factor. The inhibition of the expression of MuRF-1 (Muscle RING-finger protein-1) and muscle atrophy F-box (MAFbx/Atrogin-1) was confirmed. In addition, it increases the expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α), which is a marker for mitochondrial biogenesis and functional activity in skeletal muscle cells (C2C12) It can be usefully used in related projects by confirming that it improves skeletal muscle atrophy and activates mitochondrial function.

1 is a diagram showing the change in body weight after intraperitoneal injection of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group for 6 days.
(Control group: saline-fed mouse model, Dex group: mouse model injected only with dexamethasone, Dex+HFHS group: dexamethasone injection and HFHS: high-fat/high-sucrose diet) , Dex+HFHS+PSE group: dexamethasone injection and HFHS: high-fat/high-sucrose diet and Udo peanut sprout extracts (PSE) diet one mouse model)
Figure 2 is a diagram showing the glucose tolerance test (Glucose tolerance test) of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
3 is a diagram showing fasting blood glucose levels of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
4 is a diagram showing the plasma triglyceride content of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
5 is a diagram showing plasma total cholesterol in each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
6 is a diagram showing the forelimb grip strength against body weight in each of the Control group, the Dex group, the Dex+HFHS group, and the Dex+HFHS+PSE group.
7 is a diagram showing the degree of grip strength of the hind legs and front legs of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE groups.
8 is a diagram showing the maintenance of grip strength against body weight in each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
9 is a diagram showing hematoxylin and eosin (H&E) staining of the quadriceps muscles of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
10 is a diagram showing muscle fiber size of the quadriceps muscle using the MIPAR program of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
11 is a diagram showing the mRNA expression level of muscle atrophy factors MuRF-1, Atrogin-1, and Myogenin in the gastrocnemius muscles of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
12 is a diagram showing the protein expression of MuRF-1, Atrogin-1, and PGC1-α in the gastrocnemius muscles of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
(Control: GAPDH)
13 is a diagram showing the RNA expression levels of inflammatory markers TNF-α, IL-6, and IL-1β in each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
14 is a diagram showing the mRNA expression levels of MuRF-1, Atrogin-1, and Myogenin in the quadriceps muscles of each of the Control group, Dex group, Dex+HFHS group, and Dex+HFHS+PSE group.
15 is a diagram showing protein and mRNA expression of PGC1-α when each control, Dex+HFHS, and Dex+HFHS+PSE treatment was performed on skeletal muscle cells (C2C12).
16 is a diagram showing cell viability when skeletal muscle cells (C2C12) are treated with peanut extract (PSE).
17 is a diagram showing mRNA expression of MuRF-1, Atrogin-1, and PGC1-α when each of Control, Dex+HFHS, and Dex+HFHS+PSE treatment was performed on skeletal muscle cells (C2C12).

Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following implementation examples are presented as examples of the present invention, and if it is determined that a detailed description of a well-known technology or configuration may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , The present invention is not limited thereby, and the present invention is capable of various modifications and applications within the description of the claims described later and equivalent scopes interpreted therefrom.

In addition, the terms (terminology) used in this specification are terms used to appropriately express preferred embodiments of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Therefore, definitions of these terms will have to be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that it may further include other components without excluding other components unless otherwise stated.

All technical terms used in the present invention, unless defined otherwise, are used with the same meaning as commonly understood by one of ordinary skill in the art related to the present invention. Also, although preferred methods or feeds are described herein, those similar or equivalent thereto are also included in the scope of the present invention. The contents of all publications incorporated herein by reference are incorporated herein by reference.

The extract according to the present invention may be obtained by extraction and separation from nature using extraction and separation methods known in the art, and the "extract" defined in the present invention is extracted from creation using an appropriate solvent, For example, a crude extract, a polar solvent-soluble extract, or a non-polar solvent-soluble extract are all included. Any suitable solvent for extracting the extract from the creation may be used as long as it is a pharmaceutically acceptable organic solvent, and water or an organic solvent may be used, but is not limited thereto, for example, purified water, methanol ( Alcohols having 1 to 4 carbon atoms including methanol, ethanol, propanol, isopropanol, butanol, etc., acetone, ether, benzene, chloroform ( chloroform), ethyl acetate, methylene chloride, hexane and cyclohexane, etc. may be used alone or in combination.

As an extraction method, any one of methods such as hot water extraction, cold brew extraction, reflux cooling extraction, solvent extraction, steam distillation, ultrasonic extraction, elution, and compression may be selected and used. In addition, the desired extract may be additionally subjected to a conventional fractionation process or may be purified using a conventional purification method.

As used herein, the term "prevention" may refer to any action that suppresses or delays the onset of a muscle-damaging disease by administering the pharmaceutical composition for preventing or treating a muscle-damaging disease according to the present invention to a subject.

As used herein, the term "treatment" may refer to any action that improves or benefits the symptoms of a muscle-damaging disease by administering the composition of the present invention to a subject suspected of having a muscle-damaging disease.

As used herein, the term "improvement" may refer to any activity that at least reduces a parameter related to the condition being treated, for example, the severity of a symptom.

The present invention provides a composition for muscle regeneration comprising peanut ( Arachis hypogaea L. ) sprout extract as an active ingredient.

In one embodiment, the extract is extracted with any one solvent selected from the group consisting of water, C1 to C4 lower alcohol, or a mixed solvent thereof, but is not limited thereto.

In one embodiment, the composition maintains metabolic parameters, but is not limited thereto.

The metabolism may be body weight, glucose tolerance test, fasting blood glucose level, plasma triglyceride content, or total cholesterol.

In one embodiment, the composition increases muscle fibers, but is not limited thereto.

The muscle fibers are in the group consisting of quadriceps femoris, brachialis muscle, biceps brachii muscle, forearm muscle, rectus abdominis muscle, biceps femoris muscle, gracilis muscle, semitendinosus muscle, semimembranosus muscle, gastrocnemius muscle, vastus lateralis muscle, vastus medialis muscle, phalanx muscle, long head, medial muscle, etc. It may be 1 or more.

In one embodiment, the composition promotes the expression of factors involved in myogenesis and differentiation, but is not limited thereto.

The factor may be at least one selected from the group consisting of MuRF-1 (Muscle RING-finger protein-1), atrogin-1, and myogenin.

In one embodiment, the composition promotes the expression of factors involved in mitochondrial biogenesis and functional activity, but is not limited thereto.

The factor may be PGC1-α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha).

In one embodiment, the composition reduces the inflammatory factors TNF-α, IL-6 and IL-1β, but is not limited thereto.

In one embodiment, the composition increases grip strength and grip strength maintenance due to muscle regeneration, but is not limited thereto.

The present invention provides a pharmaceutical composition for preventing or treating muscle damage disease comprising peanut sprout extract as an active ingredient.

The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. As long as the adjuvant is known in the art, any one may be used without limitation, but, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase immunity.

The pharmaceutical composition according to the present invention may be prepared in the form of incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers usable in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories or sterile injection solutions according to conventional methods, respectively. .

When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations contain at least one or more excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin in addition to active ingredients. It can be prepared by mixing etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. can Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for suppositories, witepsol, tween 61, cacao paper, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition according to the present invention can be administered to a subject by various routes. All modes of administration are contemplated, eg oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The pharmaceutical composition may be formulated into various oral or parenteral dosage forms.

Formulations for oral administration include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, granules, etc. chlorose, mannitol, sorbitol, cellulose and/or glycine), lubricants such as silica, talc, stearic acid and magnesium or calcium salts thereof and/or polyethylene glycol. In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases starch, agar, alginic acid or a disintegrant or effervescent mixture, such as its sodium salt, and/or absorbents, colorants, flavors, and sweeteners. The formulation may be prepared by conventional mixing, granulating or coating methods.

In addition, a typical formulation for parenteral administration is an injection formulation, and water, Ringer's solution, isotonic physiological saline or suspension may be used as a solvent for the injection formulation. Sterile fixed oils of the above injectable preparations may be used as a solvent or suspension medium, and any bland fixed oil may be used for this purpose, including mono- and di-glycerides.

In addition, the formulation for injection may use a fatty acid such as oleic acid.

The disease consists of muscle strain, muscle rupture, muscle tearing, contusion, distortion, rotator cuff syndrome and myositis. It may be one or more muscle damage diseases selected from the group, but is not limited thereto.

The present invention provides a composition for improving exercise capacity containing peanut ( Arachis hypogaea L.) sprout extract as an active ingredient.

The present invention provides a composition for increasing muscle mass containing peanut ( Arachis hypogaea L.) sprout extract as an active ingredient.

In one embodiment, the emotional behavior disorder is attention deficit disorder, hyperactivity disorder, interpersonal disorder, depressive disorder, antisocial disorder, anxiety disorder, attention deficit hyperactivity disorder (ADHD) disorder, conduct disorder, autism, obsessive-compulsive disorder, schizophrenia , Tourette's syndrome, etc., but one or more selected from the group consisting of, but is not limited thereto.

In addition to containing the extract as an active ingredient, the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional Aa food compositions.

Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. The food composition of the present invention can be formulated in the same way as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is

In addition, the food composition, in addition to the active ingredient extract, various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, Alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like may be contained. In addition, the food composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages.

The functional food composition of the present invention can be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills and the like. In the present invention, 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionality for the human body according to Health Functional Food Act No. 6727, and the structure and function of the human body It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions. The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and General Test Methods approved by the Food and Drug Administration, unless otherwise specified. It is judged according to standards and standards. Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations. For example, a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or as described above. The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent and the like as needed. Among health functional foods in the form of capsules, hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling the mixture mixed with gelatin in a capsule base. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, a binder, a disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc. Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing the active ingredient of the present invention with excipients, binders, disintegrants, etc., and, if necessary, flavoring agents, flavoring agents, etc. can

Throughout this specification, '%' used to indicate the concentration of a particular substance is solid/solid (w/w) %, solid/liquid (w/v) %, and Liquid/liquid is (v/v) %.

Hereinafter, the present invention will be described in more detail through the following examples. However, the following examples are only examples for easily explaining the content and scope of the technical idea of the present invention, and thereby the technical scope of the present invention is not limited or changed. In addition, based on these examples, it can be easily determined by those skilled in the art that various modifications and changes are possible within the scope of the technical idea of the present invention.

Example 1. Experiment preparation

Example 1-1. Laboratory chemicals and sample preparation

All cell culture dishes and flasks were purchased from SPL (Seoul, Korea) unless otherwise specified. Dulbecco's Modified Eagle's Medium (DMEM), fetal bovine serum (FBS), horse serum (HS) and penicillin/streptomycin (P/S) were purchased from Gibco (Grand Island, NY, USA). All other chemicals and reagents were purchased from Sigma Chemical Co. (St. Louis, MO, USA) unless otherwise specified. Peanut sprouts (PS) germinated for 9 days were purchased from WooYoung E&T (Jeju, Korea), and after drying, freeze-dried peanut sprouts (PS) were powdered and stored in a -80 ° C freezer. 10 g of dried Udo peanut sprout (PS) powder was mixed with 100 ml of water obtained by Milli-Q, a 100 ml ultrapure water generator, using a pressurized hot water extraction method. The extracted samples were centrifuged at 3000 rpm for 3 minutes and filtered using Whatman® filter paper. The filtrate was lyophilized to obtain a powdered extract. Finally, the obtained samples were dissolved in dimethyl sulfoxide (DMSO, Sigma, St. Louis, MO, USA) at a concentration of 100 mg/mL, respectively, for cell and animal experiments.

The present inventors freshly diluted peanut sprout extracts (Peanut sprout extracts, PSE) stocks in phosphate buffered saline (PBS) before using them in animal experiments.

Example 1-2. animals and diet

Six-week-old male C57BL/6 mice were purchased from ORIENT BIO Animal Center (Seongnam-si, Korea) and maintained on a 12-hour dark/light cycle while consuming food and water freely. Prior to the experiments, mice were acclimatized for 1 week by oral gavage, and all animal experiments and experimental protocols were approved by the Jeju National University Animal Care Committee (IACUC) (2021-0026) and were performed in accordance with institutional guidelines. Eight-week-old male C57BL/6 mice were fed a low fat diet (LF) or high fat/high sugar diet with saline or Peanut sprout extracts (PSE) (10 mg/kg body weight (BW)) for 10 weeks. (high-fat/high-sucrose diet, HFHS). Dexamethasone (Dex, 10mg/kg BW) of the present invention was treated to aggravate muscle atrophy in rats by intraperitoneal injection for 6 days: (i) control, (ii) Dex (iii) Dex+HFHS and (iv) Experiments were conducted by administering Dex+HFHS+PSE to mouse animal models. After the experiment was completed, C57BL/6 mice were fasted for 12 hours and then sacrificed under carbon dioxide anesthesia. Blood, liver, epididymal fat, quadriceps and gastrocnemius muscles were collected from the sacrificed mice.

Low-fat diet (LF, 11% kcal fat) and high-fat diet (HF, 60% kcal fat) preparations were modified to Table 1 as the AIN-93G diet. High sucrose water (HS) was prepared by autoclaving 20% sucrose water at 115 °C for 15 minutes. Body weight and food intake were measured weekly.

Ingredients LF HF g/kg g/kg Casein 200 200 l-Cysteine 3 3 Sucrose 0 69 Corn starch 600 0 Maltodextrin 10 50 125 Lard 10 245 Cholesterol 0 2 Soybean oil 39 39 Cellulose 50 50 Mineral mix 35 35 Calcium phosphate 4 4 Vitamin mix 10 10 Choline bitartrate 2 2 Total 1003 784 kcal (%) kcal (%) Carbohydrates 67.8 19.8 Protein 20.9 19.3 Fat 11.3 60.8

Example 1-3. Glucose tolerance test, GTT) analysis

Experimental animals were subjected to a glucose tolerance test (GTT) at the 9th week of the experiment. After the mice were fasted for 12 hours, a 10% D-glucose solution (1 g/kg BW) was intraperitoneally injected. A blood glucose meter (Contour plus, BAYER) was used at 0, 15, 30, 60 and 120 minutes to measure blood glucose levels.

Example 1-4. Plasma biochemistry

Blood was collected from cardiac punctures of sacrificed mice to determine serum biochemistry after the experiment was completed. Plasma was obtained by adding heparin to the collected blood and centrifuging at 10,000 rpm for 10 minutes. Pharmaceutical Co., Ltd., Seoul, Korea) was used to measure the absorbance at OD 500 and 550 nm according to the manufacturing protocol.

Example 1-5. Hanging test and grip strength test

At the 10th week of the experiment, the grip strength of the rats was measured with a Grip Strength Meter (Ugo-Basile). The grip strength of the forelimb was measured three times and the largest value was used, and the same was applied when the forelimb and hindlimb were measured together.

In the hanging test, the duration of hanging on the wire mesh of the mouse was measured when the mouse was turned over after allowing the mouse to hold the wire mesh by itself. In this experiment, each mouse was measured at least three times, and the largest value was used.

Example 1-6. Hematoxylin and Eosin (H&E) staining and quantification of adipocyte, steatosis and muscle fiber size

At necropsy, epididymal fat, liver and quadriceps were isolated from mice and flash-fixed in 10% formalin buffer. Paraffin-embedded tissues were cut into 5-7 μm sections and stained with hematoxylin and eosin (H&E). Bright-field images were captured with an Invitrogen microscope (Invitrogen™ EVOS™ FL Digital Inverted Fluorescence Microscope, Invitrogen, CA, USA) at 10x and 20x magnification.

H&E staining of epididymal adipose tissue was quantified to measure adipocyte size. For quantitative analysis of adipocyte size, Image J and Adiposoft of National Institutes of Health (NIH) were used. MIPAR software (MIPARTM, Worthington, OH, USA) was used to quantify steatosis in H&E-stained liver tissue and muscle fibers in H&E-stained quadriceps.

Example 1-7. cell culture

Skeletal muscle cells, C2C12 myoblast cells (American Type Culture Collection (ATCC), Manassas, VA, USA) were cultured in a basal medium containing 10% FBS in DMEM containing 1% P/S. After C2C12 myoblasts reached 80-90% confluence (referred to as day 0), the growth medium was changed from DMEM with 1% P/S to differentiation medium containing 2% HS to differentiate the cells into myotubes. Thereafter, the cells were maintained for up to 4-6 days while changing the medium every other day.

Example 1-8. Cell viability assay

To investigate the cytotoxic effect of Peanut sprout extracts (PSE) on skeletal muscle cells (C2C12), it was measured using the EZ-cytox Cell Viability assay kit (Daeil Lab Service Co Ltd, Seoul, Korea), and the manufacturer protocol was followed.

Skeletal muscle cells (C2C12) were cultured in 96-well plates at a seeding density of approximately 20,000 cells/well in growth medium. Cells were incubated for 24 hours with DMSO or different concentrations of Udo peanut shoot extract (PSE). Then, the cells were replaced with fresh medium containing 10% EZ-cytox solution and incubated at 37°C. Plates were read at OD 450 nm using a microplate reader for 30 minutes to 4 hours.

Example 1-9. mRNA analysis by real-time polymerase chain reaction (real-time PCR)

Total RNA from muscle and cells was extracted with Trizol reagent (Invitrogen).

mRNA was treated with DNase (Mediatech) to remove potential genomic DNA contamination. RNA concentration was measured by Nanodrop (Nano-200 Micro-Spectrophotometer, Hangzhou City, China) before cDNA synthesis. cDNA was synthesized with the iScript cDNA synthesis kit (Biorad, Hercules, CA, USA). Gene expression was determined by real-time qPCR (CFX96™ Real-Time PCR Detection System, Bio-Rad, CA, USA). Hypoxanthine-guanine phosphoribosyltransferase (HPRT) and/or ribosomal protein lateral stem subunit P0 (RPLP0/36B4) were used to normalize relative gene expression.

Gene-specific primers for qPCR (Table 2) were purchased from Cosmo Genetech (Seoul, Korea).

Gene Forward Reverse mIl-6 CTGCAAGAGACTTCCATCCAGTT AGGGAAGGCCGTGGTTGT mTnfα GGCTGCCCCGACTACGT ACTTTCTCCTGGTATGAGATAGCAAAT m36b4 GGATCTGCTGCATCTGCTTG GGCGACCTGGAAGTCCAACT mHprt TTGCTCGAGATGTCATGAAGGA AGCAGGTCAGCAAAGAACTTATAGC mMuf1-1 AGTGTCCATGTCTGGAGGTCGTTT ACTGGAGCACTCCTGCTTGTAGAT mAtrogin-1 GAGGCAGATTCGCAAGCGTTTGAT TCCAGGAGAGAATGTGGCAGTGTT mMyogenin CTACAGGCCTTGCTCAGCTC AGATTGTGGGCGTCTGTAGG mPgc1-α CCCTGCCATTGTTAAGACC TGCTGCTGTTCCTGTTTTC mIl-1β AAATACCTGTGGCCTGGGC CTTGGGATCCACACTCTCCAG

Example 1-10. Protein isolation and western blotting

Tissue samples were harvested and homogenized with a homogenizer in ice-col radioimmunoprecipitation (RIPA) assay lysis buffer containing protease and phosphatase inhibitor hops. C2C12 cells were scraped with ice-cold RIPA assay lysis buffer containing protease and phosphatase inhibitors. Then, the supernatant was collected by centrifugation at 10,000 rpm and 4°C for 10 minutes, and 10-15 μg of protein was separated using 8-10% SDS-PAGE and the protein was separated in Tris-buffered saline/Tween 20. It was transferred to a polyvinylidene difluoride (PVDF) membrane (Thermo Fisher Scientific, MA, USA) and blocked from light for 1 hour at room temperature. The membrane was washed several times with Tris-buffered saline with tween 20 (TBST) solution, and the muscle atrophy F-box (MAFbx/Atrogin-1), muscle-specific ring finger protein (Muscle specific ring finger protein) RING finger protein, MuRF1) (Santa Cruz biotechnology, CA, USA), glyceraldehyde-3-phosphate dehydrogenase GAPDH, β-Actin (Cell signaling Technology, Danvers , MA, USA), oxidative phosphorylation (OXPHOS) (Abcam, Cambridge, MA, USA) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha, PGC1-α) (Novus biologicals) was reacted overnight at 4°C. The following month, membranes were washed several times with 1X TBST and stained with secondary antibodies, goat anti-rabbit (Cell signaling Technology, Danvers, MA, USA) or goat anti-mouse IgG-HRP (Santa Cruz biotechnology, CA, USA). Incubated for 1 hour. The membrane was washed and reacted with ECL (Enhanced chemiluminescence) reagent (PerkinElmer, Waltham, MA, USA). To identify the band, ChemiDoc MP (Bio-Rad, CA, USA) was used, and the expression level was calculated using Image Lab (Bio-Rad, CA, USA) or Image J (NIH, MD, USA).

Example 1-11. statistical analysis

Experimental results were expressed as mean ± standard error of the mean (SEM). Statistical calculations were performed using ANOVA (one-way analysis of variance) with Bonferroni's multiple comparison test or Student's t-test. A p-value <0.05 was considered statistically significant. All analyzes were performed with GraphPad Prism 8.02.263 (La Jolla, California., USA).

Example 2. Confirmation of effect on metabolic parameters of Udo peanut sprout extract (PSE) of the present invention

To investigate whether Udo peanut sprout extract (PSE) affects metabolism, 8-week-old male C57BL/6 mice were treated with 1) saline (control) administration group, 2) low-fat diet (LF) group, and 3) dexamethasone ( Dex) injection group, 4) high fat/high sugar (HFHS) diet + dexamethasone (Dex) group, 5) high fat/high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group, respectively. After 10 weeks of diet, metabolic changes were examined. All Dex-administered groups were administered by intraperitoneal injection over the past 6 days.

As shown in Table 3, the Control group showed higher food intake and kcal intake than the HFHS+Dex group. In addition, it was confirmed that there was no significant difference in body weight and weight gain of mice between groups for 10 weeks (FIG. 1), glucose tolerance test (FIG. 2), fasting blood sugar (FIG. 3), epididymal fat weight, liver weight and muscle It was confirmed that there was no significant difference in weight (Table 3). It was confirmed that triglyceride and total cholesterol levels were decreased in the high fat/high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group than in the high fat / high sugar (HFHS) diet + dexamethasone (Dex) group (Fig. 4, Fig. 5).

Group Control Dex HFHS+Dex HFHS+Dex+PSE p-value Diet intake Food intake (g/mouse/day) 4.03± ^0.27b 4.63± ^0.11a 1.29± ^0.07c 1.15± ^0.11c <0.0001 Sucrose intake (g/mouse/day) - - 7.97±0.60 8.48±0.74 n.s. Total kcal intake (kcal/mouse/day) 15.65± ^1.03b 17.98±0.44 ^a 12.67± ^0.56c 12.29± ^0.72c <0.0001 Phenotypes BW (g) 32.0±1.13 30.5±0.52 31.9±0.90 31.2±1.63 n.s. BWG (g) 9.10±1.22 11.60±0.77 13.56±1.20 12.56±2.22 n.s. Muscle (g) 0.61±0.03 0.54±0.02 0.58±0.02 0.52±0.02 n.s. Muscle/BW (%) 1.00±0.04 0.94±0.04 0.96±0.03 0.90±0.06 n.s. Liver (g) 1.05± ^0.05b 1.55± ^0.06a 1.55± ^0.07a 1.57±0.08 ^a <0.0001 Liver/BW (%) 1.00± ^0.05b 1.55±0.05 ^a 1.48± ^0.06a 1.53±0.02 ^a <0.0001 Epididymal fat (g) 0.99±0.12 0.91±0.08 1.15±0.13 1.21±0.22 n.s. Epididymal fat/BW (%) 1.00±0.09 0.98±0.09 1.17±0.12 1.22±0.16 n.s. Blood Chemistry Triglycerides (mg/dL) 128.50± ^10.56c 278.25± ^22.63b 233.92± ^20.39a 228.69± ^14.17ab <0.0001 Total Cholesterol (mg/dL) 223.83±34.24 ^c 350.17± ^14.14a 401.94± ^23.31b 379.43± ^24.76b <0.0001

Example 3. Confirmation of improving exercise capacity of Udo peanut sprout extracts (Peanut sprout extracts, PSE)

To investigate whether Udo peanut sprout extract (PSE) has an effect on improving exercise capacity, 8-week-old male C57BL/6 mice were treated with 1) saline (control) administration group, 2) low-fat diet (LF) group, and 3) dexamethasone ( Dex) injection group, 4) high fat/high sugar (HFHS) diet + dexamethasone (Dex) group, 5) high fat/high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group, respectively. After feeding for 10 weeks, mouse models were evaluated by grip strength test and hanging test.

As a result, compared to the group injected only with dexamethasone (Dex), it was confirmed that the grip strength of the forelimbs and hindlimbs was significantly weakened in the high fat/high sugar (HFHS) diet + dexamethasone (Dex) group (FIGS. 6 and 7). In addition, the hanging test also lowered the high-fat/high-sugar (HFHS) diet + dexamethasone (Dex) group, but the high-fat/high-sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) forelimbs in the group. It was confirmed that the grip strength of the hind limbs was significantly increased, and it was confirmed that the hanging test ability, that is, the grip strength maintenance was improved (FIG. 8).

Therefore, after sacrificing each mouse model and staining the quadriceps muscle with hematoxylin and eosin (H&E) (FIG. 9), the muscle fiber size of the quadriceps muscle was measured using the MIPAR program. extracts, PSE), it was confirmed that muscle fibers were recovered in the group treated together (FIG. 10).

Example 4. Udo Peanut sprout extracts (Peanut sprout extracts, PSE) on skeletal muscle atrophy improvement effect

To investigate whether Udo peanut sprout extract (PSE) improves skeletal muscle atrophy, 8-week-old male C57BL/6 mice were treated with 1) saline (control) administration group, 2) low-fat diet (LF) group, and 3) dexamethasone (Dex). 4) high fat/high sugar (HFHS) diet + dexamethasone (Dex) group, 5) high fat/high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group, 10 weeks each During the diet, muscle atrophy factors, mitochondria production markers, and inflammatory markers of the mouse models were identified.

As a result, in the high-fat/high-sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group, MuRF1 and Atrogin1 protein and mRNA, which are muscle upper factors of the gastrocnemius, a bifurcated muscle at the back of the calf, It was confirmed that the expression level was suppressed compared to the dexamethasone (Dex) group and the high fat / high sugar (HFHS) diet + dexamethasone (Dex) group (FIGS. 11 and 12), and the inflammatory markers TNF-α, IL-6 and IL- It was confirmed that the mRNA expression of 1β was suppressed in the high fat / high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group than in the high fat / high sugar (HFHS) diet + dexamethasone (Dex) group (FIG. 13) .

In addition, the mRNA expression levels of atrophic genes MuRF-1 (Muscle RING-finger protein-1), Atrogin-1, and Myogenin in the quadriceps muscle were significantly affected by the high-fat/high-sugar (HFHS) diet. It was decreased in the high fat / high sugar (HFHS) diet + dexamethasone (Dex) + Udo peanut sprout extract (PSE) group than the + dexamethasone (Dex) group (FIG. 14), and PGC1-α (peroxisome proliferator-activated receptor gamma coactivator 1- alpha) expression was confirmed to increase (FIG. 15).

In addition, when the Udo peanut sprout extract (PSE) was treated with skeletal muscle cells (C2C12) by concentration, cytotoxicity was observed at the concentration of 200 ug / ml of the Udo peanut sprout extract, but it was confirmed that there was no effect on cell viability at other concentrations. (FIG. 16). In addition, the expression of muscle atrophy genes MuRF-1 and Atrogin-1 decreased compared to the dexamethasone (Dex) alone treatment group and the dexamethasone (Dex) + Udo peanut sprout extract (PSE) treatment group. In addition, it was confirmed that mRNA expression of PGC1-α, a gene for mitochondrial biosynthesis and functional activation, was increased (FIG. 17).

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be construed as being included in the present invention.

Claims (16)

Peanut ( Arachis hypogaea L. ) Muscle regeneration composition containing a sprout extract as an active ingredient. According to claim 1,
The extract is a composition that is extracted with any one solvent selected from the group consisting of water, C1 to C4 lower alcohols or mixed solvents thereof. According to claim 1,
Wherein the composition maintains metabolic parameters. According to claim 3,
The metabolism is body weight, glucose tolerance test, fasting blood glucose level, plasma triglyceride content, or total cholesterol, the composition. According to claim 1,
Wherein the composition increases muscle fibers. According to claim 5,
The muscle fibers are in the group consisting of quadriceps femoris, brachialis muscle, biceps brachii muscle, forearm muscle, rectus abdominis muscle, biceps femoris muscle, gracilis muscle, semitendinosus muscle, semimembranosus muscle, gastrocnemius muscle, vastus lateralis muscle, vastus medialis muscle, phalanx muscle, long head, medial muscle, etc. 1 or more, the composition. According to claim 1,
Wherein the composition promotes the expression of factors involved in myogenesis and differentiation. According to claim 7,
The factor is at least one selected from the group consisting of MuRF-1 (Muscle RING-finger protein-1), Artrogin-1, and Myogenin, composition According to claim 1,
Wherein the composition promotes the expression of factors involved in mitochondrial biosynthesis (biogenesis) and functional activity. According to claim 9,
Wherein the factor is PGC1-α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha). According to claim 1,
Wherein the composition reduces the inflammatory factors TNF-α, IL-6 and IL-1β, the composition. According to claim 1,
The composition is to increase the grip strength and grip maintenance due to muscle regeneration, the composition. Peanut ( Arachis hypogaea L. ) A pharmaceutical composition for preventing or treating muscle damage disease comprising an extract as an active ingredient. According to claim 13,
The disease is a group consisting of muscle strain, muscle rupture, muscle tearing, contusion, distortion, rotator cuff syndrome and myositis Which one or more muscle damage disease selected from, the composition. Peanut ( Arachis hypogaea L. ) Composition for improving athletic ability containing sprout extract as an active ingredient. Peanut ( Arachis hypogaea L. ) Composition for increasing muscle mass containing sprout extract as an active ingredient.

Images