KR20230103550A - Composition for preventing or treating periodontal disease comprising daphne kiusiana extract as an effective ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating inflammatory periodontal disease and a health food for preventing or improving inflammatory periodontal disease, comprising Daphne kiusiana extract as an active ingredient.
The present invention, since it is derived from a natural product that has been used as a natural medicine for a long time, has no side effects, and suppresses the production of inflammation-related factors such as TNF-α gene, IL1-β gene, IL-6 gene, iNOS or COX2, The composition of the invention can be usefully used in the prevention or treatment of inflammatory periodontal disease.

Description

Composition for preventing or treating periodontal disease containing white Seohyang extract as an active ingredient

The present invention relates to a composition for preventing or treating periodontal disease, and more particularly, for preventing or treating periodontal disease by inhibiting the expression of proinflammatory factors secreted from gingival fibroblasts and periodontal ligament cells ( Daphne kiusiana ) Relates to a composition for preventing or treating periodontal disease containing an extract as an active ingredient.

Periodontium is a general term for the tissues surrounding teeth. Periodontal tissue is composed of tissues of alveolar bone, periodontal ligament, cementum and gingiva (gum). Teeth are one of the chewing organs composed of enamel, dentin, and pulp, and periodontal tissue plays a role in fixing teeth. Specifically, alveolar bone supports teeth within the jawbone (jawbone), periodontal ligament connects the alveolar bone and teeth within the jawbone, and cementum is one of the hard tissues constituting teeth and contains fibers of the periodontal ligament as a tissue covering dentin around the root of the tooth. The gingiva is a type of mucous membrane in the oral cavity that surrounds the junction between the teeth and the jawbone, and corresponds to the soft tissue covering the alveolar bone.

Gingival fibroblasts and periodontal ligament fibroblasts are major cell components of gingival soft tissue connective tissue, and play a role in forming and maintaining an extracellular matrix. It is known that gingival fibroblasts are mainly involved in maintaining gingival connective tissue, and periodontal ligament fibroblasts are involved in repair and regeneration of adjacent alveolar bone and cementum in vivo as well as forming periodontal ligament.

The periodontal ligament refers to a fibrous connective tissue that connects the cementum of the tooth root (root) and alveolar bone, and both ends of the periodontal ligament are embedded in the cementum and alveolar bone of the root. The bundle of periodontal ligament fibers embedded in alveolar bone or cementum is called Sharpey's fiber.

The function of the periodontal ligament not only plays an important role in maintaining teeth and maintaining the structural characteristics of hard tissues, but also plays a role in resisting the impact of occlusal pressure and protecting soft tissues such as blood vessels and nerves from damage. Another important function of the periodontal ligament is to supply nutrients and function as a sensory receptor. Innervation of the periodontal ligament transmits proprioceptive, tactile, and pain sensations through the trigeminal nerve pathway, and detects external pressure applied to individual teeth. It plays an important role in the neuromuscular mechanisms that regulate and control the masticatory musculature.

The periodontal ligament contains various intermediary cells, and these cells not only form the periodontal ligament with their unique function, but also participate in the formation and resorption of cementum and alveolar bone to induce physiological tooth movement and to adapt the periodontal tissue to the occlusal pressure. and recover damage.

Periodontal disease can be classified into gingivitis, which is limited to the gums, and periodontitis, in which inflammation spreads to the alveolar bone surrounding the tooth root. That is, periodontal disease is not a disease in which the tooth itself is damaged, but corresponds to a disease in which inflammation occurs in the periodontal tissue supporting the tooth. When periodontal disease occurs, gingival bleeding and swelling, formation of periodontal pockets, and destruction of alveolar bone occur clinically, which eventually leads to tooth loss.

The causes of periodontal disease include local and systemic factors. Two known local causative factors include dental plaque, tartar and other local causes, and trauma from occulusion.

In the case of the pathogenesis caused by plaque, for example, when plaque mechanically accumulates in the periodontal pocket, it becomes a habitat for bacteria existing around it, and this habitat gradually changes from aerobic, breathable, gram-positive bacteria to anaerobic gram-negative bacteria, proliferate into the heart. At this time, anaerobic gram-negative bacteria proliferate into the deep part of the periodontal pocket. Toxins and all other products of the anaerobic gram-negative bacteria thus proliferated directly destroy tissue or stimulate the immune system, and various chain actions caused by the stimulated immune system thus cause inflammation along with destruction of periodontal tissue.

Representative periodontal pathogens among oral bacteria include Porphyromonas gingivalis, Treponema denticola , Prevotella intermedia and Aggregatibacter actinomycetemcomitans . Toxins or metabolites in lipopolysaccharides (LPS) formed by these microorganisms increase the secretion of proinflammatory cytokines from tissues and immune cells.

In particular, IL-1β and TNF-α are representative cytokines involved in tissue destruction, and IL-1β is responsible for the recruitment of inflammatory cells and the priming/degranulation of polymorphonuclear leukocytes. activation, increased production of inflammatory mediators such as prostaglandin and matrix metalloproteinases (MMP), inhibition of collagen synthesis, activation of T and B lymphocytes, and TNF-α, apoptosis, bone resorption , MMP secretion, and IL-6 production are increased. IL-6 produced in this way is involved in the tissue destruction process by promoting osteoclast formation, bone resorption, and T lymphocyte differentiation. As a defense mechanism against increased secretion of cytokines involved in tissue destruction, the function of polymorphonuclear leukocytes and immune response act as systemic factors.

However, it is known that antibacterial action and bacteriostatic action against anaerobic gram-negative bacteria, which are fundamental factors, and removal of toxic products of these bacteria and restoration of destroyed and lost periodontal tissue are important factors in the prevention and treatment of periodontal disease. .

The basic treatment of periodontal disease is a tartar removal (scaling) procedure that removes plaque and calculus, which are the cause of periodontal disease, and a similar procedure to remove plaque and calculus, which removes the factors that cause inflammation embedded in the cementum on the surface of the tooth root. There is root planing. When inflammation becomes severe due to periodontal disease, it is accompanied by damage to the alveolar bone, and when the alveolar bone is severely resorbed, bone grafting through regenerative periodontal surgery can be performed. The type of bone to be transplanted can be the patient's own bone (autogenous bone) or xenograft or synthetic bone.

In order to effectively treat periodontal disease, it is desirable not only to remove the causative bacteria of periodontal disease, but also to perform the process of regenerating periodontal tissue together. In addition, treatments using various growth factors are being implemented, and tooth replantation methods focusing on the regeneration of periodontal ligament cells and the formation of new cementum are also being implemented.

Baekseohyang ( Daphne kiusiana ) is an evergreen broad-leaved shrub of the dicotyledonous myrtle myrtaceae, and is also called white Seohyang. Its origin is Korea, and it grows mainly at the foot of the seaside mountains at an altitude of 50 ~ 1,300 m in Geoje Island, Jeonnam, Heuksan Island, and Jeju Island in Gyeongnam, and its height is about 1 m. Leaves grow alternately and are elliptical or inverted lancet-shaped, about 3 to 8 cm long and about 1.2 to 3.5 cm wide. The edges are flat and glossy, and the lower part narrows to continue with the short petiole.

White Seohyang leaves have been used to treat wounds, gout, and chronic dermatitis in oriental traditional medicine, but their biological activity is still unknown (Jeong Bo-seop et al., Dohae Hyangyakdaejeon, Younglimsa, Seoul, pp.741-742, 1998). ). A study on the chemical composition of White Seohyang reported that it contained anthocyanin-based and coumarin-based compounds (Ishikura, N, I. Botanical Magazine, 88: 41-45, 1975; Nakabayashi, T, Yakugaku Zasshi, 74: 192 -193, 1954). However, there is no report related to the anti-inflammatory activity of an extract of white Seohyang.

Therefore, the inventors of the present invention, in order to discover anti-inflammatory substances from natural extracts derived from plants, which can solve the problems of conventional periodontal disease (gingivitis and periodontitis) prevention, treatment, and improvement, the leaf extract of Baekseo-hyang was used to treat gingival fibroblasts. And the present invention was completed by confirming that the anti-inflammatory effect was provided by significantly reducing the expression of pro-inflammatory factors in periodontal ligament cells.

An object of the present invention is to provide a composition for the prevention or treatment of inflammatory periodontal disease (periodontal disease) containing an extract of White Seohyang as an active ingredient.

Objects of the present invention are not limited to those mentioned above, and other objects not mentioned will be clearly understood by those skilled in the art from the description below.

To solve the above technical problem, a composition for preventing or treating inflammatory periodontal disease is provided, containing the white paper extract as an active ingredient according to one aspect of the present invention.

In the present invention, "White Seohyang extract" means an extract obtained by extracting White Seohyang. The white paper extract may be extracted using an extraction method such as hot water extraction, cold needle extraction, reflux cooling extraction, or ultrasonic extraction, but any method for extracting a substance having an activity to prevent or treat inflammatory diseases may be used without limitation.

The White Seohyang extract can be extracted from various organs of natural, hybrid, and mutant plants, for example, it can be extracted from roots, aerial parts, stems, leaves, fruits, or plant tissue cultures, preferably from the leaves and varieties of White Seohyang. It can be extracted from the stem.

The White Seohyang extract is preferably prepared by a manufacturing method comprising the following steps, but is not limited thereto:

1) preparing in advance, adding an extraction solvent to each piece of high white paper, treating it with ultrasonic waves, and vortexing at preset intervals;

2) filtering after centrifuging the extract of step 1); and

3) Concentrating the filtered extract of step 2) under reduced pressure and then drying.

In the above method, the white sandalwood in step 1) can be used without limitation, such as cultivated or commercially available.

In the present invention, the term "extract" has a meaning commonly used in the art as a crude extract (crude extract), but also includes fractions in a broad sense.

The term "fraction" used in the present invention means an active fraction obtained by fractionating the activity of interest in the present invention using a solvent different from the solvent used for extraction.

In describing the present invention, "periodontium" refers to a complex organ composed of epithelial tissue, soft tissue connective tissue, and calcified connective tissue, and structurally includes gums (gingiva, gingiva), periodontal ligament (PDL: periodontal ligament), cementum, and alveolar bone.

"Periodontal disease" may mean an inflammatory disease occurring in the gingiva, periodontal ligament, and alveolar bone, which are tissues around the teeth that maintain teeth. Specifically, it may refer to a disease in which bacteria infect the gap between the gingiva (gum) and the tooth and damage the periodontal ligament and adjacent tissues, and may be classified into gingivitis and periodontitis according to the severity of the disease. In addition, in periodontal disease, as inflammation progresses and more tissues are damaged, periodontal pockets are formed, and as periodontitis is severe, the depth of periodontal pockets deepens. can be defined as a disease that causes bone loss.

The term "prevention" used in the present invention refers to any action that inhibits or delays the progression of inflammatory periodontal disease by administration of the composition of the present invention.

As used herein, the terms "treatment" and "improvement" refer to all activities in which symptoms of inflammatory periodontal disease are improved or beneficially changed by administration of the composition according to an embodiment of the present invention.

As used herein, the term "administering" means providing a given composition of the present invention to a subject by any suitable method.

The term "subject" used in the present invention refers to all animals, such as humans, monkeys, dogs, goats, pigs or mice, having a disease in which symptoms of inflammatory periodontal disease can be improved by administering the composition of the present invention.

As used herein, the term "fraction" refers to a product obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. After suspending the white paper extract of the present invention, the white paper extract is fractionated using a polar solvent such as water, methanol, or ethanol or a non-polar solvent such as hexane or ethyl acetate to obtain a polar solvent fraction and a non-polar solvent fraction, respectively.

The preventive or therapeutic composition is selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried agents and suppositories It may have any one dosage form, and may be various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in one or more compounds, such as starch, calcium carbonate, sucrose or lactose ( lactose) and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is.

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

White Seohyang extract or a fraction thereof of the present invention can be usefully used for the prevention or treatment of inflammatory periodontal disease.

The present invention provides a method for preventing or treating inflammatory disease, comprising administering the pharmaceutical composition to a subject suspected of having inflammatory periodontal disease.

In the present invention, the subject suspected of the inflammatory disease refers to all animals, including humans, having or may develop the disease, and by administering the pharmaceutical composition of the present invention to a subject suspected of having the inflammatory disease, the subject can be efficiently treated. there is. The composition and inflammatory periodontal disease are as described above.

In the present invention, the term "administration" means introducing the pharmaceutical composition of the present invention to a subject suspected of having an inflammatory disease by any suitable method, and the route of administration may be oral or parenteral various routes as long as it can reach the target tissue. can be administered through

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is dependent on the type and severity of the subject, age, sex, and disease. It may be determined according to factors including type, activity of drug, sensitivity to drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And it can be single or multiple administrations. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, and can be easily determined by those skilled in the art.

The pharmaceutical composition of the present invention is not particularly limited as long as it is an object of inflammatory disease, and any one can be applied. For example, non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, humans, birds and fish may be used, and the pharmaceutical composition may be used for parenteral, It can be administered subcutaneously, intraperitoneally, intrapulmonaryly and intranasally, and for local treatment, it can be administered by any suitable method including, if necessary, intralesional administration. The preferred dosage of the pharmaceutical composition of the present invention varies depending on the condition and body weight of the subject, the severity of the disease, the drug type, the route and duration of administration, but can be appropriately selected by those skilled in the art. For example, it may be administered by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection, but is not limited thereto.

A suitable total daily amount can be determined by a treating physician within the scope of sound medical judgment, and is generally 0.001 to 1000 mg/kg, preferably 0.05 to 200 mg/kg, more preferably 0.1 to 100 mg/kg. The amount of kg can be divided and administered once a day to several times.

As another aspect, the present invention provides a food composition for the prevention or improvement of inflammatory periodontal disease comprising the White Seohyang extract as an active ingredient.

The White Seohyang, its extracts, fractions, and inflammatory periodontal disease are as described above.

In the present invention, the term "improvement" refers to all activities that improve or benefit the symptoms of a suspected or affected subject of a disease such as inflammatory periodontal disease that is prevented or treated using a composition containing white foxglove extract or a fraction thereof as an active ingredient. says

Specifically, the extract or a fraction thereof of the present invention may be added to a food composition for the purpose of preventing or improving inflammatory diseases.

The food composition of the present invention may include pills, powders, granules, infusions, tablets, capsules, liquids, etc., and there is no particular limitation on the type of food to which the White Seohyang extract or a fraction thereof of the present invention can be added, For example, there are various beverages, chewing gum, tea, vitamin complexes, health supplements, and the like.

Other ingredients may be added to the food composition in addition to the white paper extract or a fraction thereof, and the type is not particularly limited. For example, it may contain various herbal extracts, food-acceptable food additives, natural carbohydrates, etc. as additional ingredients, like conventional foods, but is not limited thereto.

In the present invention, the term "food supplement additive" refers to a component that can be added to food supplementally, and can be appropriately selected and used by those skilled in the art as being added to prepare a health functional food of each formulation. Examples of food additives include various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners. , pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, etc. are included, but the types of food additives of the present invention are not limited by the above examples.

Examples of the natural carbohydrate include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (thaumatin, etc.), stevia extract (rebaudioside A, glycir hijin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can advantageously be used.

The food composition of the present invention may include health functional food. As used herein, the term "health functional food" or "health functional food" refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients having useful functions for the human body. says Here, functional means obtaining useful effects for health purposes such as adjusting nutrients for the structure and function of the human body or physiological functions. The health functional food of the present invention can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and components commonly added in the art during the preparation. In addition, unlike general drugs, there is an advantage in that there is no side effect that may occur when taking a drug for a long time by using food as a raw material, and it can be excellent in portability.

The mixing amount of active ingredients may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment). In general, at the time of preparing food, the white paper extract or a fraction thereof of the present invention may be added in an amount of 1 to 50% by weight, preferably 5 to 10% by weight of the raw material composition, but is not limited thereto. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount below the above range may be used.

There is no particular limitation on the type of food. Examples of foods to which the above substances can be added include meat, sausages, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice creams, various soups, beverages, tea, drinks, There are alcoholic beverages, vitamin complexes, etc., and includes all health functional foods in a conventional sense.

The present invention, as a natural product, has few side effects, prevents or treats inflammation of periodontal diseases (gingivitis and periodontitis) caused by various causes, and suppresses the expression of pro-inflammatory factors in gingival fibroblasts and periodontal ligament cells. It is possible to provide a composition for preventing or treating periodontal disease (periodontal disease) containing as an active ingredient.

The effects of the present invention are not limited to those mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

Figure 1 is a result of analyzing the profile (profile) through HPLC analysis of the extract extracted with 70% ethanol of the leaves of White Seohyang.
Figure 2 is a result of evaluating the cytotoxicity of the white seohyang leaf extract in periodontal ligament cells and gingival fibroblasts.
Figure 3 is a result of analyzing the TNF-α gene expression, an inflammatory factor, by treating periodontal ligament cells with LPS in a concentration-dependent manner in order to determine the concentration of LPS for establishing an inflammatory cell model.
Figure 4 is a result of analyzing the TNF-α gene expression, an inflammatory factor, by treating the white Seohyang leaf extract in a concentration-dependent manner to periodontal ligament cells and gingival fibroblasts in order to confirm the optimal anti-inflammatory effect of the White Seohyang leaf extract.
Figure 5 is the result of confirming the effect of white seohyang leaf extract on TNF-α gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts.
Figure 6 is the result of confirming the effect of white seohyang leaf extract on IL1-β, IL-6 gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts.
Figure 7 is the result of confirming the effect of white seohyang leaf extract on iNOS, COX2 gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts.

Objects and effects of the present invention, and technical configurations for achieving them will become clear with reference to the embodiments described later in detail in conjunction with the accompanying drawings. In describing the present invention, if it is determined that a detailed description of a known function or configuration may unnecessarily obscure the gist of the present invention, the detailed description will be omitted. And the terms to be described later are terms defined in consideration of donation in the present invention, which may vary according to the intention or custom of the user or operator.

However, the present invention is not limited to the embodiments disclosed below and may be implemented in a variety of different forms. Only these embodiments are provided to complete the disclosure of the present invention and to fully inform those skilled in the art of the scope of the invention, and the present invention is defined by the scope of the claims. only become Therefore, the definition should be made based on the contents throughout this specification.

Hereinafter, embodiments of the present invention will be described in detail.

Example: Preparation of White Seohyang Extract

1. Sample preparation

Finely grind the dried baekseohyang leaves in a blender and prepare them in powder form.

2. Preparation of White Seohyang Extract

About 10.18 g of the white sandalwood leaf powder prepared in advance was placed in a conical tube, and 70% ethanol (EtOH) three times the volume of the white sandalwood powder was added and sonicated. The extraction conditions of the ultrasonic extractor were set to high intensity, temperature of about 25 ° C, and time of about 30 minutes, and vortexing was occasionally performed during ultrasonic treatment to ensure good extraction.

Next, the sufficiently extracted extract was centrifuged. Centrifugation conditions were set at about 4,500 rpm for about 5 minutes and the temperature was maintained at about 25 °C. The extract was filtered by filtering the supernatant with filter paper, and the extraction was repeated three times.

The collected supernatant was transferred to a concentrating flask and concentrated using a rotary vacuum concentrator. The temperature of the constant temperature water bath was maintained at about 45° C. and the rotational speed was maintained at about 100 rpm. The supernatant was concentrated and kept overnight under reduced pressure (vacuum).

The 70% ethanol extract of White Seohyang leaves adhering to the wall of the concentration flask was scraped with a spatula, transferred to a vial, and weighed to determine the yield. For later analysis, it was stored in a refrigerator (about 4 °C).

Yield was calculated as extract weight (g) / used powder (g) weight x 100%.

Yield: 2.509 g / 10.18 g x 100% = 24.63%

3. HPLC profile analysis of the 70% ethanol extract from the leaves of white sandalwood

Figure 1 is the result of analyzing the profile through HPLC analysis of the extract extracted with 70% ethanol. The profile of the 70% ethanol extract from the leaves of Jeju Island (Jeju island) was confirmed through HPLC analysis, and the conditions were as follows.

Column: YMC J'Sphere ODS-H80 250 x 4.6 mm I.D. s-4 μm, 8 nm

Column temperature: 25℃

Wavelength: 280 nm

Flow rate: 1.2ml/min

Injection volume: 5 μL

Mobile phase (A): 0.1% formic acid in water

(B): 0.1% formic acid in Acetonitrile

Gradient mode:

Time (min.) B (%) 0 0 5 10 15 20 25 30 45 40 55 60

4. Isolation and culture of human gingival fibroblasts and periodontal ligament cells

Human gingival fibroblasts and periodontal ligament cells were isolated from gingival tissues attached to wisdom teeth and periodontal ligament tissues remaining at the root of wisdom teeth in the wisdom tooth extraction process of 10 adults (18-22 years old) at Seoul National University Dental Hospital. . Specifically, all experiments were performed with the patient's consent after approval from the hospital's Institutional Review Board. After that, the culture flask containing α-MEM (α-minimum essential medium, GIBCO, USA) was cultured in a 5% CO2 cell incubator at 37 °C.

5. Toxicity test of gingival fibroblasts and periodontal ligament cells of white Seohyang leaf extract

In this study, human-derived normal gingival fibroblasts and periodontal ligament cells were used.

The cells were prepared in α-MEM (α-minimum essential medium, GIBCO, USA) was cultured in a cell incubator (culture flask) at about 37 °C and about 5% CO ₂ .

These cells were washed with α-MEM/10% FBS medium and cultured in a 96-well plate at 3×10 ³ cells/ml in the same medium.

The next day, the culture medium was exchanged, and the extracts of the white rhododendron japonica were treated at concentrations of 10, 50, and 100 ug/ml, respectively, and reacted for 0, 24, and 48 hours, respectively, and then MTT (Methyl Thiazol-2-YL-2, 5 About 50 μl of -diphenyl Tetrazolium bromide, GIBCO, USA) solution was put into each well and incubated for 4 hours. After discarding the MTT solution, about 50 μl of DMSO (dimethyl sulfonide, Sigma, USA) was added to dissolve formazon crystals. . After shaking the plate well, absorbance was measured at 570 nm with an ELISA reader (THERMO maxTM, Molecular Devices Co., CA, USA). As a control group, α-MEM culture medium containing no test solution was used in each experiment. All experimental results were calculated as a percentage of the control group.

Figure 2 is a result of evaluating the cytotoxicity of the white seohyang leaf extract in periodontal ligament cells and gingival fibroblasts. Referring to Figure 2, even when the white Seohyang leaf extract was increased in a concentration-dependent manner, cytotoxicity was not shown, which means that safety was secured when used for the treatment of periodontal disease.

6. Anti-inflammatory efficacy test of gingival fibroblasts and periodontal ligament cells of white Seohyang leaf extract

In this study, human-derived normal gingival fibroblasts and periodontal ligament cells were used. Cells were prepared in α-MEM (α-minimum essential medium, GIBCO, USA) supplemented with 10% FBS (fetal bovine serum, GIBCO, USA), 100 U/ml penicillin (GIBCO, USA), and 100 μg/ml streptomycin (GIBCO, USA). , USA) was cultured in a 5% CO2 cell incubator (culture flask) at 37 °C.

Gingival fibroblasts and periodontal ligament cells were cultured until they formed a monolayer, and 0.02% EDTA (ethylene diamine tetra acetic acid, GIBCO, USA)-2.5% trypsin-PBS (phosphate buffer solution, GIBCO, USA) was 10:1: It was separated from the culture dish containing 9. These cells were washed with α-MEM/10% FBS medium and cultured in a 60 mm culture dish at 2.5×10 ⁵ cells/ml in the same medium.

The culture medium was exchanged the next day and the experiment was performed under the following conditions.

- Negative control group

- LPS alone treatment group (induction of inflammation)

- White Seohyang leaf extract alone treatment group

- LPS treatment group + White Seohyang leaf extract treatment group

LPS was treated at 1 ug/ml, and white sage leaf extract was treated at a concentration of about 50 ug/ml.

After about 48 hours, in order to confirm the expression of inflammatory factors, RNA was extracted, cDNA was synthesized for real-time gene analysis, and the following gene expression was analyzed using a real-time gene amplifier.

7. Real-time PCR analysis

After total RNA was isolated from human periodontal ligament cells using TRIzol reagent, cDNA was synthesized using about 2 μg of total RNA, 1 ul of reverse transcriptase, and 0.5 μg of oligo (dT). The synthesized cDNA of human periodontal ligament cells was used for real-time polymerase chain reaction using the primers in Table 2.

Real-time polymerase chain reaction was performed on an ABI PRISM 7500 sequence detection system (Applied Biosystems) using SYBR GREEN PCR Master Mix (Takara, Japan). The real-time polymerase chain reaction was about 94° C., 1 min; About 95 ° C., 15 seconds - 60 ° C., 34 seconds were performed under conditions of repeating 40 cycles. Analysis of the results was evaluated using the comparative cycle threshold (CT) method.

gene Primer (5'-3') sequence number hTNF-α forward CCCAGGGACCTCTCTCTAATC One reverse ATGGGCTACAGGCTTGTCACT 2 hIL1-b forward ACGCTCCGGGACTCACAGCA 3 reverse TGAGGCCCAAGGCCACAGGT 4 hIL6 forward AGGAGACTTGCCTGGTGAAA 5 reverse GCATTTGTGGTTGGGTCAGG 6 hiNOS forward GTTCTCAAGGCACAGGTCTC 7 reverse GCAGGTCACTTATGTCACTTATC 8 hCOX2 forward TTCTCCTTGAAAGGACTTATGGGTAA 9 reverse AGAACTTGCATTGATGGTGACTGTTT 10 hGAPDH forward CCATGGAGAAGGCTGGGG 11 reverse CAAAGTTCTCATGGATGACC 12

Experimental example:

1. Toxicity test of gingival fibroblasts and periodontal ligament cells of white Seohyang leaf extract

Before performing the anti-inflammatory effect on the leaves of White Seohyang, the cytotoxicity of the extracts from the leaves of White Seohyang was evaluated in gingival fibroblasts and periodontal ligament cells. White Seohyang leaf extract was treated with periodontal ligament cells and gingival fibroblasts at concentrations of 10 ug/ml, 50 ug/ml, and 100 ug/ml, and cytotoxicity was evaluated after 48 hours. showed no cytotoxicity.

2. Anti-inflammatory efficacy evaluation of gingival fibroblasts and periodontal ligament cells of white Seohyang leaf extract

2-1) in vitro Establishment of inflammatory cell model

In order to establish an inflammatory cell model in vitro , the optimal concentration of LPS for the establishment of an inflammatory cell model was confirmed by treating Lipopolysaccharide (LPS), an inflammation-inducing factor, a bacterial cell wall component. Periodontal ligament cells were treated with LPS at different concentrations, and expression of TNF-α gene, a representative inflammatory biomarker, was confirmed by performing RT-PCR.

Figure 3 is a result of analyzing the TNF-α gene expression, an inflammatory factor, by treating periodontal ligament cells in a concentration-dependent manner with LPS in order to determine the LPS concentration for establishing an inflammatory cell model. Referring to Figure 3, when the concentration of LPS in periodontal ligament cells was 1 ug / ml and 5 ug / ml, it was confirmed that the TNF-α gene expression increased by about 2 times or more, and rather decreased when 10 ug / ml showed a trend. Therefore, in the in vitro inflammatory model for the discovery of anti-inflammatory materials, the anti-inflammatory efficacy of the leaf extract of P.

3. in vitro Evaluation of anti-inflammatory efficacy of white sage leaf extract in inflammatory cell model

In order to evaluate the anti-inflammatory effect of White Seohyang leaf extract, in order to determine the optimal concentration of White Seohyang leaf extract exhibiting anti-inflammatory effect in periodontal ligament cells, different concentrations of White Seohyang leaf extract were treated in periodontal ligament cells and gingival fibroblasts. TNF-α gene expression was analyzed.

Figure 4 is a result of analyzing the TNF-α gene expression, an inflammatory factor, by treating the white Seohyang leaf extract in a concentration-dependent manner in periodontal ligament cells and gingival fibroblasts in order to confirm the optimal anti-inflammatory effect of the white Seohyang leaf extract. Referring to Figure 4, it was confirmed that the white Seohyang leaf extract suppressed TNF-α gene expression in a concentration-dependent manner in periodontal ligament cells, and suppressed TNF-α gene expression 5 times or more at a concentration of 50 ug/ml. Therefore, the optimal concentration for evaluating the anti-inflammatory effect of the white Seohyang leaf extract was determined to be 50 ug/ml.

4. Effects of White Seohyang Leaf Extract on TNF-α Gene Expression in LPS-Induced Inflammatory Response

According to the determination of the optimal concentration of 50 ug/ml to evaluate the anti-inflammatory effect of the leaf extract of the white bear, the anti-inflammatory effect of the leaf extract of the white bear was evaluated in an in vitro inflammatory cell model. Expression of the inflammatory factor TNF-α gene in periodontal ligament cells and gingival fibroblasts was measured under the following conditions.

Figure 5 is the result of confirming the effect of white seohyang leaf extract on TNF-α gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts. Referring to Figure 5, the following conclusions can be drawn:

- Negative control group

- LPS alone treatment group: inflammation

- White Seohyang leaf extract alone treatment group

- LPS treatment group + White Seohyang leaf extract treatment group: Periodontitis prevention effect confirmed

- LPS 24-hour pre-treatment + Baekseohyang leaf extract treatment group: Periodontitis treatment effect confirmed

In order to confirm the anti-inflammatory effect of the leaf extract on the inflammatory response induced by LPS, the TNF-α gene expression was measured after treatment with the leaf extract of the leaf extract under various experimental conditions. In the group treated with LPS alone, it was observed that TNF-α gene expression was increased more than 2-fold.

However, it was observed that the TNF-α gene expression was reduced about 5-fold in the group treated with the white Seohyang leaf extract alone, as in the previous result. In order to confirm the periodontitis preventive effect, it was confirmed that the group treated with LPS and white bear leaf extract suppressed TNF-α gene expression similarly to the group treated with white bear leaf extract alone.

In addition, in order to confirm the periodontitis treatment effect of the white Seohyang leaf extract, LPS was pretreated for about 24 hours to induce an inflammatory response, and then, the treatment of the white Seohyang leaf extract to confirm the therapeutic effect of the inflammatory response. As a result, it was confirmed that TNF-α gene expression was significantly reduced, similar to other experimental groups, even when the inflammatory response was induced with LPS and then treated with the leaf extract of White Seo.

As described above, it was confirmed that the white sage leaf extract provides a therapeutic effect as well as a preventive effect on periodontitis in vitro .

5. Effects of White Seohyang Leaf Extract on IL1-b and IL-6 Gene Expressions in LPS-Induced Inflammatory Response

In order to confirm the anti-inflammatory effect of the white Seohyang frond leaf extract, the other inflammatory factors, IL1-β and IL-6 gene expression, were examined after treating the white frond frond leaf extract under various experimental conditions.

Figure 6 is the result of confirming the effect of white seohyang leaf extract on IL1-β, IL-6 gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts. Referring to FIG. 6, similar to the TNF-α gene expression results, IL1 in the group treated with white foxtail leaf extract alone or with LPS, and in the group treated with white foxtail leaf extract after 24 hours pretreatment with LPS compared to the control group and the LPS treatment group. It was confirmed that -β and IL-6 gene expressions were significantly reduced.

6. Effects of White Seohyang Leaf Extract on iNOS and COX2 Gene Expressions in LPS-Induced Inflammatory Response

In order to confirm the anti-inflammatory effect of the white Seohyang leaf extract, the other inflammatory factors, iNOS and COX2 gene expression, were examined after treatment with the White Seohyang leaf extract under various experimental conditions.

Figure 7 is the result of confirming the effect of the white seohyang leaf extract on iNOS and COX2 gene expression in the inflammatory response induced by LPS in periodontal ligament cells and gingival fibroblasts. Referring to Figure 7, similar to the previous inflammatory factor gene expression results, iNOS was compared with the control group and the LPS-treated group in the group treated with the white Seohyang leaf extract alone, with LPS, and the group treated with the white Seohyang leaf extract after 24 hours of pretreatment with LPS. And it was confirmed that COX2 gene expression was significantly reduced.

In the present specification and drawings, preferred embodiments of the present invention are disclosed, and although specific terms are used, they are only used in a general sense to easily describe the technical content of the present invention and help understanding of the present invention, It is not intended to limit the scope. It is obvious to those skilled in the art that other modifications based on the technical idea of the present invention can be implemented in addition to the embodiments disclosed herein.

This study is a study related to the development of platform technology for commercialization of biopharmaceutical material value add-on using Jeju biological resources by supporting research funds for the 2021 regionally-led science and technology R&D project.

<110> HYSENSBIO Jeju National University Industry-Academic Cooperation Foundation <120> COMPOSITION FOR PREVENTING OR TREATING PERIODONTAL DISEASE COMPRISING DAPHNE KIUSIANA EXTRACT AS AN EFFECTIVE INGREDIENT <130> GP210067KR <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> HOMO SAPIENS <400> 1 cccagggacc tctctctaat c 21 <210> 2 <211> 21 <212> DNA <213> HOMO SAPIENS <400> 2 atgggctaca ggcttgtcac t 21 <210> 3 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 3 acgctccggg actcacagca 20 <210> 4 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 4 tgaggcccaa ggccacaggt 20 <210> 5 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 5 aggagacttg cctggtgaaa 20 <210> 6 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 6 gcatttgtgg ttgggtcagg 20 <210> 7 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 7 gttctcaagg cacaggtctc 20 <210> 8 <211> 23 <212> DNA <213> HOMO SAPIENS <400> 8 gcaggtcact tatgtcactt atc 23 <210> 9 <211> 26 <212> DNA <213> HOMO SAPIENS <400> 9 ttctccttga aaggacttat gggtaa 26 <210> 10 <211> 26 <212> DNA <213> HOMO SAPIENS <400> 10 agaacttgca ttgatggtga ctgttt 26 <210> 11 <211> 18 <212> DNA <213> HOMO SAPIENS <400> 11 ccatggagaa ggctgggg 18 <210> 12 <211> 20 <212> DNA <213> HOMO SAPIENS <400> 12 caaagttctc atggatgacc 20

Claims (13)

White Seohyang ( Daphne kiusiana ) A composition for preventing or treating inflammatory periodontal disease containing an extract as an active ingredient.
The composition for preventing or treating inflammatory periodontal disease according to claim 1, wherein the white paper extract is obtained by extracting dried white paper flowers with water, C ₁ ~ C ₂ lower alcohol or a mixed solvent thereof.
[Claim 3] The composition for the prevention or treatment of inflammatory periodontal disease according to claim 2, wherein the dried product of White Seohyang is white Seohyang leaves, stems, flowers or roots.
The composition for preventing or treating inflammatory periodontal disease according to claim 2, wherein the lower alcohol is ethanol or methanol.
A composition for preventing or treating inflammatory periodontal disease, containing as an active ingredient an organic solvent fraction prepared by additionally extracting the White Seohyang extract of claim 1 with an organic solvent.
The composition for preventing or treating inflammatory periodontal disease according to claim 5, wherein the organic solvent is hexane, ethyl acetate or butanol.
The method of claim 1, wherein the periodontal disease is Porphyromonas gingivalis ( Porphyromonas gingivalis ), Treponema denticola ( Treponema denticola ) or Prevotella intermedia ( Prevotella intermedia , Aggregatibacter actinomycetemcomitans ) Lipopolysaccharides produced from ) Composition for preventing or treating inflammatory periodontal disease, characterized in that induced by.
The composition for preventing or treating inflammatory periodontal disease according to claim 1, wherein the White Seohyang extract reduces the production of TNF-α (Tumor necrosis factor-alpha) cytokine.
The composition for preventing or treating inflammatory periodontal disease according to claim 1, further comprising a pharmaceutically acceptable carrier, excipient, or diluent in the White Seohyang extract.
The composition for preventing or treating inflammatory periodontal disease according to claim 1, wherein the white paper extract contains Umbelliferone, daphnetin-7-glucoside and Daphneolone.
The composition for preventing or treating inflammatory periodontal disease according to claim 1, wherein the White Seohyang extract inhibits TNF-α gene, IL1-β gene, IL-6 gene, iNOS or COX2 gene expression.
A method for preventing or treating inflammatory periodontal disease by administering the composition according to claim 1 to a non-human subject.
Health food for the prevention and improvement of inflammatory periodontal disease, containing white Seohyang extract or a fraction thereof as an active ingredient.

Images