KR20230097735A - Method for manufacturing Shinorine - Google Patents

Abstract

The present invention relates to a Saccharomyces cerevisiae strain into which a mycosporine-like amino acid biosynthetic gene has been introduced and a method for producing shinoline, and a large amount of shinorine can be rapidly produced by using the strain of the present invention.

Description

Method for manufacturing Shinorine {Method for manufacturing Shinorine}

The present invention relates to a method for producing shinorine.

Seaweeds are directly affected by UV rays, and therefore contain a lot of substances related to UV protection. Mycosporine-like amino acids (MAAs), one of the substances related to UV protection, are known to effectively absorb wavelengths in the range of 310-360 nm, and are therefore used as cosmetic materials. In addition, it is known to be involved in various biological processes such as osmotic pressure regulation and defense against oxidative stress, and it has the potential to be used as a functional food material such as antioxidant, anti-inflammatory, and anti-aging in the future.

Commercially available MAAs are also produced by extraction from the natural red algae Porphyra umbilicalis, but this process suffers from low extraction yields and complicated processes. On the other hand, biological production of MAAs using microorganisms is attracting attention as it can be an alternative for sustainable and economical production of MAAs.

However, although studies on microalgae culture and separation and purification are being conducted, these processes have a low extraction yield, and a lot of cost and time are required for separation and purification.

Korean Patent Publication No. 10-2015-0137244

An object of the present invention is to provide a microorganism capable of rapidly producing a large amount of shinorine.

An object of the present invention is to provide a method for rapidly producing a large amount of shinorine.

1. A Saccharomyces cerevisiae strain into which a mycosporine-like amino acid biosynthetic gene derived from Actinocinema mirum has been introduced.

2. The Saccharomyces cerevisiae strain according to 1 above, wherein the mycosporine-like amino acids biosynthetic gene has the nucleotide sequence of SEQ ID NOs: 1 to 4.

3. The Saccharomyces cerevisiae strain according to 1 above, wherein the strain is additionally deficient in the TAL1 gene.

4. The Saccharomyces cerevisiae strain according to 1 above, wherein the strain is additionally introduced with a xylose reductase gene, a xylitol dehydrogenase gene, and a xylo kinase gene.

5. The Saccharomyces cerevisiae strain according to 4 above, wherein the xylose reductase gene includes a NADPH-dependent xylose reductase gene and a NADH-dependent xylose reductase gene.

6. The strain of Saccharomyces cerevisiae according to 1 above, wherein the mycosporine-like amino acids biosynthetic gene is introduced into the chromosome of the strain.

7. In the above 6, the mycosporine-like amino acids biosynthetic gene is the ATG33 gene upstream intergenic region (int # 6) and the ASF1 gene upstream intergenic region (int Saccharomyces cerevisiae strain introduced into #4).

8. The saccharide according to the above 2, wherein the genes of SEQ ID NOs: 1 and 4 are operably linked to the TEF promoter and the GPM1 terminator, and the genes of SEQ ID NOs: 2 and 3 are operably linked to the GPD promoter and the CYC1 terminator. Lomyces cerevisiae strains.

9. In the above 1, the accession number is KCTC14827BP Saccharomyces cerevisiae strain.

10. A method for producing shinorine comprising culturing the Saccharomyces cerevisiae strain of any one of 1 to 9 above.

11. The method for producing shinoline according to 10 above, using xylose and glucose as carbon sources.

12. The method for producing shinoline according to 11 above, wherein the xylose is supplied while the glucose is maintained at a low concentration of 1 to 5 g/L.

The present invention provides a microorganism capable of rapidly producing a large amount of shinoline.

The microorganism of the present invention contains a shinoline biosynthetic enzyme gene and a xylose metabolism gene and does not contain a TAL1 gene, so that a large amount of shinorine can be rapidly produced.

The method for producing mycosporine-like amino acids of the present invention can rapidly produce a large amount of mycosporine-like amino acids by controlling the metabolic pathway of microorganisms.

1 shows the structural formulas of several mycosporine-like amino acids including shinorine. A is Mycosporine-Glycine, B is Shinorine, C is Porphyra-334, D is Palythine, and E is Asterina-330.
Figure 2 is a traditional shinoline extraction method derived from red algae Porphyra umbilicalis and from recombinant S. cerevisiae This is a brief description of the production method of Shinorin.
Figure 3 shows the mycosporine-like amino acid biosynthetic pathway of recombinant S. cerevisiae and the shinoline biosynthesis enzyme gene derived from Actinosynnema mirum .
4 shows a process for preparing expression cassettes of Amir4256 and Amir4257, which are genes for synoline biosynthesis enzymes derived from Actinosynnema mirum .
5 shows that the Amir4256, Amir4257, Amir4258, and Amir4259 genes, which are genes for synoline biosynthesis enzymes derived from Actinosynnema mirum, are inserted into the intergenic regions of INT#4 and INT#6 of S. cerevisiae .
Figure 6 shows the process of removing the TAL1 gene through genome editing using CRISPR-Cas9 gene scissors.
Figure 7 shows the HPLC results for confirming the production of shinorine in the recombinant S. cerevisiae (DM strain) of the present invention. The D452-2 strain is a control. A is to confirm the production of shinorine in the cell, and B is to confirm the production of shinorine in the medium.
8 shows LC-MS/MS spectroscopic analysis of shinorine produced by the DM strain. LC-MS/MS spectra of authentic Shinorin standards and LC-MS/MS spectra of cell extracts of strain DM. Conditions: ESI (positive), 2.5 kV, m/z 50-800, 40 V, 800 L/h, 500 °C, 150 °C, 0.5 mM sodium formate, leucine-enkephalin (m/z 556.2771)
Figure 9 shows shinorine production in batch fermentation by recombinant S. cerevisiae (DM strain). (A) Batch fermentation profile. Batch fermentation was performed in YP medium containing 20 g/L glucose at 30° C. and 250 rpm. The strain initial inoculum was inoculated at OD ₆₀₀ 1; (B) Concentration of shinorine in cell fractions and media produced by D452-2 and DM strains; (C) the content of shinorine produced by strains D452-2 and DM; (D) Productivity of shinoline produced by D452-2 and DM strains.
Figure 10 shows shinorine production in batch fermentation by recombinant S. cerevisiae (strain DX-M). (A) Batch fermentation profile using glucose; (B) Batch fermentation profile using a mixture of glucose and xylose. Batch fermentation was carried out at 30° C. and 250 rpm in YP medium containing 20 g/L glucose or a mixture of 10 g/L glucose and 10 g/L xylose. The strain was inoculated at an initial inoculation concentration of OD ₆₀₀ 1 . (C) cell fraction and shinoline concentration in the medium produced by strain DX-M in batch fermentation using glucose and batch fermentation using a mixture of glucose and xylose; (D) shinoline content produced by strain DX-M in batch fermentation using glucose and batch fermentation using a mixture of glucose and xylose; (E) Productivity of shinorine produced by batch fermentation using glucose and batch fermentation DX-M strain using a mixture of glucose and xylose.
11 shows shinoline production in batch fermentation by recombinant S. cerevisiae (DXdT-M) on a single carbon source. Fermentation profile, concentration and content of shinorine in batch fermentation when fed with glucose (A) or xylose (B). Fermentation was performed in YP medium containing 20 g/L of glucose or xylose at 30°C and 250 rpm. Cells of the DXdT-M strain were inoculated at an initial OD600 of 1. Shinorine concentration includes the amount of shinorine in the medium and the cell fraction produced by the DXdT-M strain.
Figure 12 shows shinoline production in batch fermentation by recombinant S. cerevisiae (strain DXdT-M) under a mixture of glucose and xylose. Fermentation profile, concentration and content of shinorine in batch fermentation when mixtures of 10 g/L glucose and 10 g/L xylose (A) or 50 g/L glucose and 50 g/L xylose (B) were fed. Fermentation was performed at 30° C. and 250 rpm in YP medium in which glucose and xylose were mixed. The initial inoculation concentration of the DXdT-M strain was inoculated at OD ₆₀₀ 1 . Shinorine concentration includes the amount of shinorine in the medium and the cell fraction produced by the DXdT-M strain.
13 shows shinoline production in batch fermentation by recombinant S. cerevisiae (strain DXdP-M) under a single carbon source. Fermentation profile, concentration and content of shinorine in batch fermentation under glucose (A) or xylose (B) feeding. Fermentation was performed in YP medium containing 20 g/L of glucose or xylose at 30°C and 250 rpm. Cells of the DXdP-M strain were inoculated at an initial OD ₆₀₀ of 1. Shinorine concentration includes the amount of shinorine in the cell fraction and medium produced by the DXdP-M strain.
Figure 14 shows shinoline production in batch fermentation by recombinant S. cerevisiae (strain DXdP-M) under a mixture of glucose and xylose. Fermentation profile, concentration and content of shinorine in batch fermentation when mixtures of 10 g/L glucose and 10 g/L xylose (A) or 50 g/L glucose and 50 g/L xylose (B) were fed. Fermentation was performed at 30° C. and 250 rpm in YP medium in which glucose and xylose were mixed. DXdP-M strain was inoculated at an initial inoculation concentration of OD ₆₀₀ 1. Shinorine concentration includes the amount of shinorine in the cell fraction and medium produced by the DXdP-M strain.
15 shows shinoline production in batch fermentation by recombinant S. cerevisiae (DXdTdP-M) on a single carbon source. Fermentation profile, concentration and content of shinorine in batch fermentation under glucose (A) or xylose (B) feeding. Fermentation was performed in YP medium containing 20 g/L of glucose or xylose at 30°C and 250 rpm. DXdTdP-M strain was inoculated at an initial inoculation concentration of OD ₆₀₀ 1 . Shinorine concentration includes the amount of shinorine in the medium and the cell fraction produced by the DXdTdP-M strain.
16 shows shinorine production in batch fermentation by recombinant S. cerevisiae (strain DXdTdP-M) under a mixture of glucose and xylose. Fermentation profile, concentration and content of shinorine in batch fermentation when mixtures of 10 g/L glucose and 10 g/L xylose (A) or 50 g/L glucose and 50 g/L xylose (B) were fed. Fermentation was performed at 30° C. and 250 rpm in YP medium in which glucose and xylose were mixed. The initial inoculation concentration of strain DXdTdP-M was inoculated at OD ₆₀₀ 1. Shinorine concentration includes the amount of shinorine in the medium and the cell fraction produced by the DXdTdP-M strain.
17 shows shinoline production in fed-batch fermentation by recombinant S. cerevisiae (DXdT-M) while feeding glucose and xylose. Fermentation, concentration, content and productivity profiles of shinoline in fed-batch fermentation fed intermittently with glucose (A) or xylose (B). In fed-batch fermentation with xylose added, glucose was continuously supplied after the glucose initially added was exhausted to maintain a concentration of 2 g/L (B). In CE, Glc and Glc & Xyl mean values corresponding to the concentration, content, and productivity of shinorine in fed-batch fermentation that supplies glucose (A) and xylose (B), respectively.
18 shows time course profiling of the concentration and content of shinorine produced by strain DXdT-M during fed-batch fermentation fed xylose. Values were obtained during fed-batch fermentation in which xylose was intermittently added while continuously supplying glucose (related to B in FIG. 17 ).
19 shows the production of shinorine using hydrolysates extracted from rice using the DXdT-M strain. It is a graph of fermentation profile (A), concentration (B), content (C) and productivity (D) of shinorine during batch fermentation including hydrolyzate extracted from rice raw material. Fermentation was performed in YP medium containing hydrolysate at 30 °C and 250 rpm. The initial inoculation concentration of the DXdT-M strain was inoculated at OD ₆₀₀ 1 . Shinorine concentration includes the amount of shinorine in the medium and the cell fraction produced by the DXdT-M strain.
20a to 20d show the codon-optimized gene sequences of Amir4256, Amir4257, Amir4258 and Amir4259 genes derived from Actinocinema mirum used in the present invention. FIG. 19a shows the base sequence of SEQ ID NO: 1, FIG. 19b shows the base sequence of SEQ ID NO: 2, FIG. 19c shows the base sequence of SEQ ID NO: 3, and FIG. 19d shows the base sequence of SEQ ID NO: 4.
21a to 21d show the nucleotide sequence of Donor DNA used in genome editing using CRISPR-Cas9 gene scissors. Figure 21a shows the nucleotide sequence of GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T Donor DNA targeting the intergenic #4 intergenic region of the chromosome of Saccharomyces cerevisiae strain (SEQ ID NO: 73). Figure 21b shows the nucleotide sequence of GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T Donor DNA targeting the intergenic #6 intergenic region of the chromosome of Saccharomyces cerevisiae strain (SEQ ID NO: 74). 21c shows the nucleotide sequence of Donor DNA for TAL1 gene deletion targeting TAL1 gene (SEQ ID NO: 75). 21D shows the nucleotide sequence of Donor DNA for PHO13 gene deletion targeting PHO13 gene (SEQ ID NO: 76). 21a and 21b, the nucleotide sequence of the GPD promoter is shown in green small letters, the TEF promoter nucleotide sequence is shown in black small letters, the CYC1 terminator is shown in purple capital letters, and the GPM1 terminator is shown in maroon capital letters. Amir4256, Amir4257, Amir4258 and Amir4259 sequences are shown in blue. The upstream sequences of FIGS. 21c and 21d are blue fluorescence, and the downstream sequences are yellow fluorescence.

The present invention relates to a Saccharomyces cerevisiae strain capable of rapidly producing a large amount of shinorine and a method for producing shinorine using the strain.

In the present invention, D452-2 is a control strain, DM is a strain into which a mycosporine biosynthetic gene is introduced, DXS is a strain into which a xylose metabolism gene is introduced, and DX-M is a strain into which a mycosporine biosynthetic gene and a xylose metabolism gene are introduced, DXdP is a strain in which the xylose metabolism gene is introduced and the PHO13 gene is deficient, DXdP-M is a strain in which the mycosporine biosynthesis gene and xylose metabolism gene are introduced and the PHO13 gene is deficient, and DXdT is the xylose metabolism gene is introduced and the TAL1 gene is deleted, DXdT-M is a strain in which the mycosporine biosynthesis gene and xylose metabolism gene are introduced, and the TAL1 gene is deleted, DXdPdT is a xylose metabolism gene is introduced and PHO13 and DXdPdT-M, a strain in which the TAL1 gene is deleted, is a strain in which the mycosporine biosynthesis gene and the xylose metabolism gene are introduced, and the PHO13 and TAL1 genes are deleted (Table 1).

The present invention provides a Saccharomyces cerevisiae strain into which a mycosporine-like amino acids biosynthetic gene derived from Actinosynnema mirum has been introduced.

Mycosporine-like amino acid biosynthetic genes derived from Actinosynnema mirum encode, for example, DHQS (3-dehydroquinate synthase), O-MT (O-methyltransferase), ATP-grasp ligase and D-ala-D-ala ligase The gene for the biosynthesis of mycosporine-like amino acid derived from Actinocinema mirum may be a codon-optimized gene, for example, a gene having a nucleotide sequence of SEQ ID NOs: 1 to 4. The gene having the nucleotide sequence of SEQ ID NO: 1 is a gene encoding D-ala-D-ala ligase (Amir4256), the gene having the nucleotide sequence of SEQ ID NO: 2 is a gene encoding ATP-grasp ligase (Amir4257), SEQ ID NO: The gene having the nucleotide sequence of 3 is the gene encoding O-MT (O-methyltransferase) (Amir4258), and the gene having the nucleotide sequence of SEQ ID NO: 4 is the gene (Amir4259) encoding DHQS (3-dehydroquinate synthase).

The Saccharomyces cerevisiae strain of the present invention may be one into which mycosporine-like amino acid biosynthetic genes having the nucleotide sequences of SEQ ID NOs: 1 to 4 have been introduced.

The mycosporine-like amino acid biosynthetic gene may be introduced into the Saccharomyces cerevisiae chromosome. For example, the mycosporine-like amino acid biosynthetic enzyme gene was introduced into the ATG33 gene upstream intergenic region (int#6) and the ASF1 gene upstream intergenic region (int#4) of the Saccharomyces cerevisiae strain. it may have been

The mycosporine-like amino acid biosynthetic gene may be introduced into the Saccharomyces cerevisiae chromosome using CRISPER/Cas9 genetic scissors.

In one embodiment of the present invention, the Amir4256 and Amir4257 genes were introduced into the int # 6 intergenic region of the Saccharomyces cerevisiae strain using CRISPER / Cas9 genetic scissors, and the Amir4258 and Amir4259 genes were introduced into the Saccharomyces cerevisiae strain. int#4 was introduced into the intergenic region.

The types of promoters and terminators operably linked to the mycosporine-like amino acid biosynthetic gene are not limited.

In one embodiment of the present invention, the Amir4256 and Amir4259 genes are operably linked to the TEF promoter and the GPM1 terminator, and the Amir4257 and Amir4258 genes are operably linked to the GPD promoter and the CYC1 terminator.

A strain of Saccharomyces cerevisiae into which a mycosporine-like amino acid biosynthesis gene has been introduced can produce Shinorine.

The Saccharomyces cerevisiae strain into which the mycosporine-like amino acid biosynthesis gene derived from Actinosynnema mirum of the present invention has been introduced may have a TAL1 gene deletion.

The TAL1 gene may be composed of the nucleotide sequence of Cheryl No. 5.

In one embodiment of the present invention, the TAL1 gene was deleted in the Saccharomyces cerevisiae strain using CRISPER/Cas9 genetic scissors, and for this purpose, donor DNA consisting of the nucleotide sequence of SEQ ID NO: 75 was used.

Deletion of the TAL1 gene prevents S7P (sedoheptulose 7-phosphate), an intermediate of mycosporine-like amino acids, from being used in glycolysis, which can increase the accumulation of S7P, thereby increasing the production and production of mycosporine-like amino acids (especially shinoline). Production efficiency can be increased.

The Saccharomyces cerevisiae strain into which the actinosynnema mirum-derived mycosporine-like amino acid biosynthetic gene of the present invention has been introduced may have a xylose metabolism gene additionally introduced, and the xylose The metabolic gene can be, for example, a xylose reductase gene, a xylitol dehydrogenase gene and a xylokinase gene.

The xylose metabolism gene may be a xylose reductase gene (XYL1, mutant XYL1) derived from Scheffersomyces stipitis (=Pichia stipitis) , a xylitol dehydrogenase gene (XYL2), and a xylokinase gene (XYL3).

The XYL1 gene may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 6, for example, a gene having the nucleotide sequence of SEQ ID NO: 7. The mutant XYL1 gene may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 8, for example, a gene having the nucleotide sequence of SEQ ID NO: 9. The XYL2 gene may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 10, for example, a gene having the nucleotide sequence of SEQ ID NO: 11. The XYL3 gene may be a gene encoding a protein having the amino acid sequence of SEQ ID NO: 12, for example, a gene having the nucleotide sequence of SEQ ID NO: 13.

The xylose reductase gene may include both the NADPH-dependent xylose reductase gene (XYL1) and the NADH-dependent xylose reductase gene (mutant XYL1), for example, the amino acid sequences of SEQ ID NOs: 6 and 8 It may include all genes encoding proteins having.

In one embodiment of the present invention, Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) The xylose metabolism gene introduced into the strain is a gene consisting of the nucleotide sequences of SEQ ID NOs: 7, 9, 11 and 13.

The Saccharomyces cerevisiae strain into which the xylose metabolism gene was introduced contains both the NADPH-dependent xylose reductase gene and the NADH-dependent xylose reductase gene, thereby converting xylose into xylitol NADPH and NADH are efficiently used to As a result, xylose metabolism efficiency is improved, and thus mycosporine (particularly shinorine) production and production efficiency may be increased.

The xylose metabolism gene may be introduced into the Saccharomyces cerevisiae chromosome.

A strain into which a mycosporine-like amino acid biosynthetic gene has been introduced into the chromosome is easier to culture than a strain into which a recombinant vector has been directly inserted, and cost and time can be reduced in mass production of the desired mycosporine-like amino acid (shinoline).

The Saccharomyces cerevisiae strain into which the actinosynnema mirum-derived mycosporine-like amino acid biosynthetic gene of the present invention has been introduced has a TAL1 gene deletion and a xylose metabolism gene (xylose lysate) ductase gene, xylitol dehydrogenase gene, and xylokinase) may be additionally introduced.

In one embodiment of the present invention, a mycosporine-like amino acid biosynthetic gene derived from Actinosynnema mirum is introduced, the TAL1 gene is deleted, and the xylose metabolism gene (xylose reductase gene, xylitol dehydrogenase gene) is introduced. A Saccharomyces cerevisiae strain DXdT-M into which a gynase gene and xylokinase) were additionally introduced was prepared. DXdT-M's production of shinoline (Fig. 12) was measured in the strain introduced with only mycosporine-like amino acid biosynthetic gene (DM, Fig. 9) and the strain introduced with mycosporine-like amino acid biosynthetic gene and xylose metabolism gene (DX-M, Fig. 9). 10), a strain in which the mycosporine-like amino acid biosynthetic gene and the xylose metabolism gene were introduced and the PHO13 gene was deleted (DXdP-M, FIG. 14), and the mycosporine-like amino acid biosynthetic gene and the xylose metabolism gene were introduced and the TAL1 gene and PHO13 gene were introduced. The yield was far superior to that of the gene-defective strain (DXdTdP-M, FIG. 16).

The mycosporine-like amino acid biosynthesis gene and xylose metabolism gene (xylose reductase gene, xylitol dehydrogenase gene and xylokinase) derived from Actinosynnema mirum of the present invention are introduced, and the TAL1 gene Defective Saccharomyces cerevisiae ( Saccharomyces cerevisiae ) strain can use lignocellulose as a carbon source, and even when lignocellulose is used, the productivity of shinorine is excellent.

In one embodiment of the present invention, it was confirmed that the DXdT-M strain can produce 54 mg/L of shinorine from lignocellulosic hydrolysate.

The present invention provides a strain of Saccharomyces cerevisiae, accession number KCTC14827BP. The accession number KCTC 14827BP strain is the DXdT-M strain of the present invention. Mycosporin-like amino acid biosynthetic genes (Amir4256, Amir4257, Amir4258 and Amir4259) derived from Actinosynnema mirum and xylose metabolism genes (XYL1, mutantXYL1, XYL2 and XYL3 described above) derived from Scheffersomyces stipitis (=Pichia stipitis ) It is a novel strain introduced and lacking the TAL1 gene, and has excellent shinoline productivity. In addition, the strain can produce a large amount of shinoline from lignocellulosic hydrolysates, and thus can be used for eco-friendly and economical production of shinoline.

The present invention provides a method for producing shinorine comprising the step of culturing any one of the above-described Saccharomyces cerevisiae strains.

The culturing method of the strain is not limited, and may be cultured by, for example, a batch culture method or a fed-batch culture method.

The present invention provides a method for producing shinorine using xylose and glucose as carbon sources.

By using xylose and glucose as carbon sources at the same time, it is possible to increase the production and production efficiency of shinoline in Saccharomyces cerevisiae strains.

When xylose and glucose are used as carbon sources at the same time, the production of shinoline and production efficiency can be increased when xylose is supplied while maintaining the glucose concentration of the culture at a low concentration (FIG. 17 B). For example, xylose may be supplied while maintaining the glucose concentration of the culture at a low concentration of 1 to 5 g/L.

In one embodiment of the present invention, in fed-batch fermentation using the DXdT-M strain, the concentration of glucose was maintained at a low concentration of 2 g / L and xylose was supplied intermittently to obtain 751 mg / L of cyano for 71 hours. got a lyn That is, it showed a productivity of 11 mg/L per hour.

Hereinafter, the present invention will be described in more detail with examples.

Example

1. Materials and Methods

1.1. base strain

The strains listed in Table 1 were used in the present invention. E. coli DH5α was used for genetic manipulation and cloning, and S. cerevisiae D452-2 was used as a control and basic strain for recombinant strain construction.

The DXS strain was utilized as a host for constructing a recombinant strain producing MAA from xylose and having deletion of TAL1 and/or PHO13 genes. The S. cerevisiae DXS strain was prepared according to the method described in "Jo JH, Park YC, Jin YS, Seo JH. Construction of efficient xylose-fermenting Saccharomyces cerevisiae through a synthetic isozyme system of xylose reductase from Scheffersomyces stipites".

1.2. Plasmid construction

Plasmids used in the present invention are listed in Table 2. Primers for constructing plasmids and strains and primers for colony PCR are listed in Tables 3 and 4, respectively. The S. cerevisiae codon-optimized genes of Amir4256, Amir4257, Amir4258 and Amir4259 are shown in Table 5, and these sequences were prepared by Macrogen (Seoul, Korea).

Polymerase chain reaction (PCR) was performed using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) to amplify the Amir4256, Amir4257, Amir4258 and Amir4259 genes, and the amplified DNA was prepared using the Gibson Assembly kit (New England Biolabs, Ipswich, MA). The amplified Amir4257 and Amir4259, respectively, were assembled into BamHI and XhoI treated p425GPDP-CYC1T to generate p425GPDP-Amir4257-CYC1T and p426TEFP-Amir4259-GPM1T. To construct p426TEFP-CYC1T, the TEF promoter was amplified from D452-2 genomic DNA, and then the fragment was assembled into p426GPDP-CYC1T digested with SacI and SpeI restriction enzymes. The GPM1 terminator was obtained by PCR from Amir4259 and D452-2 genomic DNA amplified from codon-optimized nucleotides of Amir4259. p426TEFP-CYC1T was digested with BamHI and KpnI. The three fragments were assembled with a Gibson assembly kit to construct p426TEFP-Amir4259-GPM1T. Amir4256 and p426TEFP-GPM1T were prepared from the synthesized Amir4256 and p426TEFP-Amir4259-GPM1T by PCR with the corresponding primers and ligated to prepare p426TEFP-Amir4256-GPM1T. To construct p426TEFP-Amir4256-GPM1T-GPDP-Amir4257-CYC1T, the expression cassette of TEFP-Amir4256-GPM1T was amplified from p426TEFP-Amir4256-GPM1T. Sequentially, the fragments were assembled into p425GPDP-Amir4257-CYC1T linearized by SacI. Similarly, TEFP-Amir4259-GPM1T was obtained from p426TEFP-Amir4259-GPM1T and then ligated with the linearized p424GPDP-Amir4258-CYC1T cleaved by SacI, resulting in p424GPDP-Amir4258-CYC1T-TEFP-Amir4259-GPM1T. Plasmid preparation and gel extraction were performed using a kit from Promega (Madison, WI) (FIG. 4).

1.3. Genome editing using CRISPR-Cas9

Introduction of expression cassettes related to the shinoline biosynthetic pathway and removal of TAL1 and PHO13 genes were performed using Cas9-mediated genome editing according to previously reported methods (Lee, Y.-G., Jin, Y.-S. , Cha, Y.-L., Seo, J.-H. 2017. Bioethanol production from cellulosic hydrolysates by engineered industrial Saccharomyces cerevisiae. Bioresource technology, 228, 355-361). To introduce the expression cassettes of the Amir4256 and Amir4257 genes, donor DNA fragments were prepared by PCR using the P21 and P22 primers in Table 2. The amplified donor DNA of TEFP-Amir4256-GPM1T-GPDP-Amir4257-CYC1T was designed to have 50 bp homology to be inserted into the intergenic region of INT#4 (FIG. 5). pRS42H-INT#4 was used for guide RNA expression. The amplified donor DNA and pRS42H-INT#4 were transformed into D452-2 harboring the pAUR_Cas9 strain using a modified lithium acetate transformation method. D452-2 carrying pAUR_Cas9 was cultured in 5 mL of YP medium containing 20 g/L glucose at 30°C and 250 rpm, and cells were inoculated at an initial OD ₆₀₀ 1 concentration to obtain fresh 2X containing 20 g/L glucose. Transformed in YP medium. After the OD ₆₀₀ reached 2.0, the cells were harvested and washed thoroughly twice with double distilled water (DDW).

Washed cells were mixed with 50% (w/v) PEG 3350, 1.0 M lithium acetate, denatured carrier DNA and gRNA plasmids and amplified donor DNA fragments. The mixture was subjected to heat shock at 42°C for 45 minutes and incubated with 1 mL of YP medium containing 20 g/L glucose at 30°C for 4 hours. Transformants were selected in YP medium containing 20 g/L glucose, 0.5 μg/mL Aureobacidin A (Takara, Japan) and 300 μg/mL hygromycin B (Sigma-Aldrich, St Louis, MO) . For plasmid curing of pAUR_Cas9 and pRS42H-INT#4, transformants were continuously concentrated for 2-3 days in YP medium containing 20 g/L glucose without aureobacidin A and hygromycin. Subsequently, a cassette of GPDP-Amir4258-CYC1T-TEFP-Amir4259-GPM1T was designed to be inserted into the intergenic region of INT#6 (FIG. 5) and obtained from PCR with the P23 and P24 primers listed in Table 3. Donor DNA and pRS42H-INT#6 were converted to D452-2 with TEFP-Amir4256-GPM1T-GPDP-Amir4257-CYC1T inserted and pAUR_Cas9 hidden. Transformation and selection of target strains were performed as described above. The resulting strains were named D-M strains expressing the genes of Amir4256, Amir4257, Amir4258 and Amir4259. Instead of D452-2, strain DX-M was prepared by applying the same method to strain DXS.

In addition, Cas9-mediated genome editing was used to delete the genes of TAL1 and PHO13 . As shown in Figure 6, the donor fragment for deletion of the TAL1 gene was designed to achieve complete deletion of the target gene when inserted into the genome. To generate a donor fragment for deletion of the target gene, a DNA fragment having 500 bp homology to the upstream sequence of the target gene was amplified with primers of P27 and P28. A fragment of 500 bp homology to the sequence downstream of the target gene was also amplified with the P29 and P30 primers. The two amplified fragments were ligated using overlapping PCR with primers of P27 and P30 to generate a TAL1 -targeting donor fragment. pRNA- TAL1 containing the guide RNA targeting sequence of the TAL1 gene was prepared by inverse PCR using pRS42H-INT#4 as a template and primers of P25 and P26. The TAL1 target donor fragment and pRNA- TAL1 were inserted into the DXS strain to transform the DXdT strain. Removal of the PHO13 gene was also performed in the same manner as described above. Donor DNA sequences for insertion and deletion of genes are detailed in Figures 21A to 21D.

1.4. culture conditions

E. coli was cultured in Lysogeny Broth (tryptone 10 g/L, yeast extract 5 g/L, sodium chloride 10 g/L, LB) medium containing 50 µg/mL ampicillin when necessary. S. cerevisiae strains were cultured in YP medium (10 g/L yeast extract and 20 g/L peptone) with glucose and/or xylose at 30° C. and 250 rpm. In the case of batch culture, seed cultures were prepared by culturing in 5 mL of YP medium with 20 g/L glucose at 30° C. and 250 rpm. Bacteria cultured overnight were collected and inoculated into fresh YP medium with an initial OD ₆₀₀ of 1.0. The main culture was performed in 50 mL of YP with glucose and/or xylose in a 250 mL flask at 30 °C and 250 rpm. Fed-batch fermentation was carried out in YP medium containing 20 g/L glucose with a working volume of 2 L in a 5 L fermentor (Kobiotech, Korea) at 30 °C while maintaining pH 5.5 with 5 M NaOH and 5 M HCl. During incubation, the agitation speed and air flow rate were maintained at 500 rpm and 1 vvm, respectively. DO levels were monitored with an O2 sensor (InPro6800/12/220 METTLER TOLEDO). When the initially added glucose was exhausted, 20 g/L glucose was fed intermittently using the 800 g/L glucose feed solution. 25 g/L of glucose and xylose were supplied for the glucose-xylose fed fermentation. After depletion of the initially added glucose, the 800 g/L glucose solution was fed continuously at a feed rate of 2 g/L. When the concentration of residual xylose in the medium decreased to 5 g/L or less, 25 g/L of xylose was intermittently supplied using a supply solution of 800 g/L of xylose.

1.5. Cell growth monitoring and metabolite measurement

Cell growth was monitored by optical density (OD) at 600 nm (OD ₆₀₀ ) using a spectrophotometer (UV-1900i, Shimadzu, Kyoto, Japan). An experiment was conducted to obtain the conversion factor of OD ₆₀₀ to DCW (Dry Cell Weight). Finally, the DCW was calculated by multiplying the conversion factor (0.35) by the OD. Concentrations of glucose, xylose, glycerol and acetate were measured by high-performance liquid chromatography (HPLC, SCL-40, Shimadzu, Kyoto, Japan) equipped with a refractive index (RI) detector. A Rezex ROA-Organic Acid H ⁺ column (Phenomenex, Torrance, CA) was eluted with 5 mM sulfuric acid at 60 °C and a flow rate of 0.6 mL/min. The culture was harvested and centrifuged at 13,000 rpm for 5 minutes, and the supernatant was collected and filtered using a 0.22 μm syringe filter for metabolite concentration analysis.

1.6. MAAs identification and quantification

During the culture, 4 mL of the culture solution was sampled. The collected culture medium was centrifuged at 4,000 rpm for 10 minutes, and the supernatant was used for analysis of MAA concentration in the medium. Cells from which the supernatant was removed were resuspended in 1 mL of DDW. After adding 1.5 mL of chloroform to the resuspended cells, the mixture was vortexed for 3 minutes to remove the cells. After the mixture was centrifuged at 4,000 rpm for 10 minutes, the water layer was collected and filtered through a 0.22 μm syringe filter to analyze intracellular MAA concentration. The concentrations of shinoline and porphyra-334 were measured using high-performance liquid chromatography (HPLC, SCL-40, Shimadzu, Kyoto, Japan) equipped with a variable wavelength detector (VWD) at 334 nm. Solvent conditions were 100% solvent A (solvent A; 0.1M triethylammonium acetate in water, pH 7.0) for 3 minutes, increasing to 50% solvent B in solvent A (solvent B; acetonitrile) over 30 minutes, 100% 100% solvent B for 5 minutes at a flow rate of 1 mL/min over 2 minutes.

A Capcell Pak UG120 C18 column (5 μm particle size, 250 × 4.6 mm ID, Shiseido, Japan) was maintained at 35 °C. LC-MS/MS experiments were performed as follows. Solvent conditions were 100% A (solvent A; H ₂ O containing 0.1% formic acid) for 2 minutes, 10% solvent B (solvent B, 0.1% formic acid at a flow rate of 0.35 mL/min in solvent A over 5 minutes). acetonitrile). An ACQUITY UPLC HSS T3 column (1.7 Am, 2.1 mm x 100 mm) was maintained at 40°C. MS conditions were as follows: ionization mode; ESI (positive), capillary voltage; 2.5 kV, scan range; m/z 50~800, cone voltage; 40V, desolvation N ₂ gas flow rate 800 L/h, desolvation temperature; 50° C., ion source temperature; 150° C., calibrator; 0.5 mM sodium formate, lock mass; Leucine-enkephalin (m/z 556.2771). Conditions for MRM analysis were as follows: compound; Shinorine, retention time; 1.03 min, switch quantifier; m/z 333.13 -> 255.10, 186.10, CV; 40, CE; 20, 45.

2. Results

2.1. Introduction of genes related to MAA biosynthetic pathway from A. mirum into S. cerevisiae

To implement MAA production in S. cerevisiae lacking the MAA biosynthetic pathway, four S. cerevisiae codon optimization gene was synthesized (Fig. 3 and Table 4). To construct an MAA-producing S. cerevisiae strain, an expression cassette consisting of a constitutive promoter, target gene and terminator was constructed and integrated into the genome of S. cerevisiae D452-2. The expression cassette of GPDP-Amir4258-CYCT-TEFP-Amir4259-GPM1T was integrated into the intergenic region (int#4) of the D452-2 genome using Cas9-mediated genome editing (FIG. 5). The GPDP-Amir4257-CYCT-TEFP-Amir4256-GPM1T cassette was genomicly integrated at the intergenic site (int#6).

Batch fermentation was performed in YP medium containing 20 g/L of glucose to confirm whether the resulting strains (D-M) could produce shinoline (FIG. 7). To confirm and quantify shinorine production by recombinant S. cerevisiae, cultures were harvested and separated into supernatants and cells. The supernatant was used to directly detect shinoline in the medium using HPLC, and intracellular shinoline was detected after removing the cells. There was a peak at 3.5 minutes in both the cell fraction and medium of the DM strain, whereas the peak did not appear in the D452-control strain, which does not contain the mycosporine-like amino acid (MAA) biosynthetic pathway.

LC-MS/MS analysis of cell fractions was performed to further confirm shinoline production by the D-M strain. In the LC-MS/MS spectrum, a peak was detected at a retention time of about 1 minute, the same as that of the shinorine standard in the sample of the DM strain. In addition, the mass fragmentation profile of the D-M strain was identical to that of the shinorine standard (FIG. 8). It was confirmed that introduction of the A. mirum-derived MAA biosynthetic pathway contributes to heterologous MAA production in S. cerevisiae. Finally, the DM strain produced 2.5 mg/L of shinoline with a small amount of Porphyra-334 (<0.2 mg/L) from 20 g/L of glucose within 7 hours, whereas the control strain (D452-2) No MAA accumulated. Except for MAA production, no significant differences were found in cell growth between the two strains, as well as glucose consumption and ethanol, glycerol and acetate production.

2.2. Production of MAA from xylose as a carbon source for MAA improvement

Sedoheptulose 7-phosphate (S7P) is the starting precursor for MAA production and is mainly synthesized via the pentose phosphate pathway (Fig. 1). Thus, elevated S7P levels in cells may contribute to improving MAA production. In the present invention, to produce MAA from xylose, an expression gene cassette for MAA production was integrated into the genome of the DXS strain. The resulting strain was named DX-M strain.

For the determination of MAA by the DXS strain, batch fermentation was performed in a medium containing glucose, xylose and a mixture of glucose and xylose. In batch fermentation in which only glucose was supplied in YP medium (FIG. 10), the D-M strain and the DX-M strain showed similar amounts of MAA (2.5 mg/L vs. 1.0 mg/L) production. However, when fermented with xylose as the sole carbon source, the DX-M strain consumed almost no xylose despite the expression of xylose assimilation genes. In batch fermentation using a mixture of 10 g/L glucose and 10 g/L xylose (FIG. 10), DX-M started consuming xylose gradually after depleting glucose in 6 hours. Cells grew and produced ethanol during the glucose consumption phase (0–6 h), whereas cells grew without ethanol accumulation during the xylose consumption phase (6–17 h). In batch fermentation using a mixture of glucose and xylose, the DX-M strain produced 34 mg/L of shinorine at a productivity of 2 g/L-h, which was 34- and 14.3-fold higher than glucose alone. Interestingly, the shinoline content (mg shinoline/g DCW) increased 22.7-fold.

2.3. TAL1 Increased sedoheptulose 7-phosphate (S7P) accumulation and shinoline production through genetic ablation.

Transaldolase is involved in the transaldolase reaction between S7P and G3P (glyceraldehyde 3-phosphate) in the pentose phosphate pathway. To prevent S7P from being used for MAA production and being converted to an intermediate for glycolysis, Cas9-mediated genome editing was used to remove the TAL1 gene encoding transaldolase.

In batch fermentation in which glucose was supplied only from YP medium (Fig. 11A), the recombinant strain (DXdT-M) from which the TAL1 gene was removed produced 36 mg/L of shinoline, which was 36 doubled.

In batch fermentation using a mixture of 10 g/L glucose and 10 g/L xylose, DXdT-M produced 73 mg/L of shinoline (14.8 mg/g DCW), a 3.1-fold increase compared to strain DX-M (Fig. 10B, 12A). In addition, batch fermentation was performed in a mixture of 50 g/L glucose and 50 g/L using the DXdT-M strain, and for 33 hours, the DXdT-M strain produced a total of 93 mg/L shinorine, resulting in a total of 2.8 mg/L-h showed productivity.

2.4. Increased production of shinoline by promoting the xylose assimilation pathway

An increase in shinoline production was confirmed by deleting the PHO13 gene to promote xylose fermentation. The DXdP-M strain was constructed by removing the PHO13 gene from the DX-M strain using Cas9-mediated genome editing. In batch fermentation in which only glucose was supplied in YP medium, DXdP-M produced 0.4 mg/L of shinoline with a productivity of 0.1 g/Lh (FIG. 13A), showing low ability to produce shinorine. In contrast to the DX-M and DXdT strains, the DXdP-M strain efficiently consumed xylose when only xylose was fermented as the sole carbon source (Figs. 11B and 13B). Although the DXdP-M strain showed improved xylose assimilation properties, the DXdT-M strain produced 11 mg/L of shinorine, 1.2-fold lower than when DX-M was given xylose alone (FIG. 13B). Given the increased cell growth and ethanol production, the consumed xylose may be directed towards the glycolytic pathway instead of the MAA biosynthetic pathway through S7P. In the case of fermentation supplied with a mixture of glucose and xylose, the DXdP-M strain also showed a fast xylose consumption rate, but the production of shinorine was still lower than that of the DX-M strain and the DXdT-M strain. These results suggest that ablation of the PHO13 gene contributed to cell growth and ethanol production, but not to the improvement of MAA production.

2.5. for MAA production PHO13 and TAL1 Synergistic effects of gene deletion

In order to confirm the synergistic effect of deletion of the PHO13 and TAL1 genes on shinoline production, the DXdTdP-M strain was prepared by additionally deleting the PHO13 gene of the DXdT-M strain in which all of the TAL1 genes were deleted. In batch fermentation fed only glucose in YP medium, the DXdTdP-M strain produced 19.2 mg/L of shinorine, representing a 46% reduction in shinorine production compared to that produced by the DXdT-M strain (FIG. 15A). When only xylose is fermented as the sole carbon source, the DXdTdP-M strain produces 10 mg/L shinoline with poor xylose fermentation assimilation (<1 g/L), a characteristic similar to that of the DX-M and DXdT-M strains. did.

DXdP-M. When a mixture of 20 g/L glucose and 20 g/L xylose was supplied as carbon source in batch fermentation, strain DXdTdP-M showed lower shinoline production than DXdT-M (68.7 mg/L vs. 73.1 mg/L). This phenomenon was also observed in batch fermentation using higher concentrations of glucose and xylose (50 g/L) (FIG. 16). As a result, there was no significant improvement in shinoline production when the PHO13 gene was further deleted in TAL1 -disrupted S. cerevisiae (DXdT-M). Finally, it was confirmed that the DXdT-M strain is suitable for mass production of shinorine.

2.6. Evaluation of MAA production by S. cerevisiae for industrial applications

In order to increase shinoline production by recombinant S. cerevisiae, fed-batch fermentation was implemented using the DXdT-M strain by intermittently adding a carbon source under controlled pH and oxygen conditions. First, fed-batch fermentation was performed by supplying glucose intermittently when the initially added glucose was depleted for 30 hours (FIG. 17A). As expected, glucose was consumed quickly and large amounts of ethanol (>100 g/L) accumulated during incubation. Cells of the DXdT-M strain grew to 15 g/L in 13 hours, but cell growth stopped after 13 hours and was maintained during culture. At 30 hours, 160.7 mg/L of shinorine was produced in cells and culture medium with 8.8 mg/g dry cell weight (DCW) content and 5.4 mg/L-h productivity (FIG. 17C-E). Thereafter, a second fed-batch fermentation was performed by intermittently adding xylose (FIG. 17B). For efficient cell growth, 20 g/L of glucose was initially supplied along with xylose. After the initially added glucose was exhausted, glucose was continuously supplied at a concentration of less than 2 g/L during cultivation to prevent assimilation of xylose. Xylose was fed intermittently when the xylose remained at a concentration of less than 5 g/L. In this case, the cells reached a DCW of 14.3 g/L within 19 hours and were maintained during culture. Finally, 751 mg/L of shinoline (45 mg/gDCW) was produced in 71 hours with a productivity of 11 g/L-h (Fig. 17 C-E), which was previously described in “Park, S.-H., Lee, K. , Jang, J.W., Hahn, J.-S. 2018. Metabolic engineering of Saccharomyces cerevisiae for production of shinorine, a sunscreen material, from xylose. ACS synthetic biology, 8(2), 346-357." (Shinorine concentration 31mg/L, Shinorine content 9.6mg/gDCW, and productivity 0.25mg/L-h), which were 24, 4.7, and 44 times improved. As a result of monitoring the production of shinoline over time in fed-batch fermentation that supplied xylose, it was confirmed that shinorine was not secreted into the medium but accumulated in the cells at the beginning of cell culture (FIG. 18A), and finally, about It was confirmed that 60% was accumulated in the cells and the rest was secreted into the medium.

2.7. Production of shinorine from lignocellulosic hydrolysates by recombinant S. cerevisiae (DXdT-M)

To apply to the industrial production of shinoline, rice straw-derived lignocellulosic hydrolyzate, which is an eco-friendly and economical carbon source, was used as a carbon source in the batch fermentation of the DXdT-M strain. Lignocellulosic biomass cannot be saccharified by enzymes in high yield without pretreatment, mainly because lignin in plant cell walls forms a barrier to enzyme attack (Sewalt et al., 1997). Therefore, in this study, experiments were conducted on rice straw pre-treated products and hydrolase-treated products. Medium for batch fermentation was prepared by mixing equal volumes of pre- and post-treatment components in YP medium. 23.0 g/L of glucose and 6 g/L of xylose were measured to be present in the medium (FIG. 19A). As expected, strain DXdT-M consumed glucose and xylose and produced 54 mg/L of shinoline (12.6 mg shinoline/g DCW) (FIG. 19 B-C). These results show that recombinant S. cerevisiae can mass-produce shinorine using lignocellulosic biomass as a carbon source and can be used for eco-friendly and economical production of shinoline.

Table 1 is information on strains used in the present invention.

Name Description D452-2 S. cerevisiae , MATα , leu2 , his3 , ura3 , and can1 D-M D452-2int#4:: GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T ,
int#6:: GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T DX123 D452-2
URA3::TDH3p-XYL1-TDH3t, PGK1p-XYL2-PGK1t, TDH3p-XYL3-TDH3t DXS DX123 HIS3:: TDH3p-mutant XYL1-TDH3t DX-M DXSint#4:: GPD _P -Amir4258-CYC _T -TEF _P -Amir4259-GPM1 _T ,
int#6:: TEF _P -Amir4256-GPM1 _T -GPD _P -Amir4257-CYC _T DXdT DXS tal1 Δ DXdT-M DXS tal1Δ int#4:: GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T ,
int#6:: GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T DXdP DXS pho13Δ DXdP-M DXS pho13Δ int#4:: GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T ,
int#6:: GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T DXdTdP DXS tal1Δ pho13Δ DXdTdP-M DXS tal1Δ pho13Δ
int#4:: GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T ,
int#6:: GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T

Table 2 is information on the plasmids used in the present invention.

Name Description p426GPD _P -CYC1 _T URA3 , 2μ origin, Amp ^r , GPD promoter, CYC1 terminator p426TEF _P -CYC1 _T URA3 , 2μ origin, Amp ^r , TEF promoter, CYC1 terminator p426TEF _P -GPM1 _T URA3 , 2μ origin, Amp ^r , TEF promoter, GPM1 terminator p426TEF _P -Amir4256-GPM1 _T URA3 , 2μ origin, Amp ^r , TEF _P -Amir4256-GPM1 _T p426GPD _P -Amir4257-CYC1 _T URA3, 2 μ origin, Amp ^r , GPD _P -Amir4257-CYC1 _T p426GPD _P -Amir4258-CYC1 _T URA3, 2 μ origin, Amp ^r , GPD _P -Amir4258-CYC1 _T p426TEF _P -Amir4259-GPM1 _T URA3 , 2μ origin, Amp ^r , TEF _P -Amir4259-GPM1 _T p426GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256- GPM1 _T URA3 , 2 μ origin, Amp ^r , GPD _P -Amir4257-CYC1 _T - TEF _P -Amir4256-GPM1 _T p426GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T URA3 , 2 μ origin, Amp ^r , GPD _P -Amir4258-CYC1 _T - TEF _P -Amir4259-GPM1 _T pAUR_Cas9 AUR1-C , CEN6 , ARS4 , TEF1 _P -Cas9-CYC1 _T pRS42H-INT#4 Hyg ^R , gBlock for intergenic region upstream ASF1 pRS42H-INT#6 Hyg ^R , gBlock for intergenic region upstream ATG33

The production of pAUR_Cas9 was described in "Lee, Y.-G., Jin, Y.-S., Cha, Y.-L., Seo, J.-H. 2017. Bioethanol production from cellulosic hydrolysates by engineered industrial Saccharomyces cerevisiae. Bioresource technology, 228, 355-361", and the production of pRS42H-INT#4 and pRS42H-INT#6 was described in "Jeong, D., Ye, S., Park, H., Kim, SR 2020. Simultaneous The method described in "fermentation of galacturonic acid and five-carbon sugars by engineered Saccharomyces cerevisiae. Bioresour Technol , 295 , 122259" was utilized.

Table 3 shows the primer sequences used in the construction of strains and plasmids used in the present invention. * Homologous sequences to Gibson assemblies are shown in lower case. **Sequences for homologous recombination with the genome are underlined. *** Guide RNA target sequences are written in italics (SEQ ID NOs: 38, 39, 44 and 45).

Constructed plasmids Target DNA template Name Sequence p426TEF _P -CYC1 _T TEF promoter D452-2 genomic DNA P01 gaacaaaagctggagctCATAGCTTCAAAATGTTTCTACTC
(SEQ ID NO: 14) P02 agcccgggggatccaCTTAGATTAGATTGCTATGCTTTCTTTC
(SEQ ID NO: 15) p426GPD _P -Amir4256-CYC1 _T Amir4256 Codon-optimized Amir4256 gene P03 acggattctagaactagtgATGCTTCGTGTTCTGCACCTGACCGGTTCG (SEQ ID NO: 16) P04 gacataactaattacatgacTCACCCCCTGCGCGCGGCGG
(SEQ ID NO: 17) p426GPD _P -Amir4257-CYC1 _T Amir4257 Codon-optimized Amir4257 gene P05 gacggattctagaactagtgATGTCTGACGCTGTCGCC
(SEQ ID NO: 18) P06 gacataactaattacatgacTTAGTCTCCTGAAGGCGC
(SEQ ID NO: 19) p426GPD _P -Amir4258-CYC1 _T Amir4258 Codon-optimized Amir4258 gene P07 gacggattctagaactagtgATGTCTGCGCCAGGCGCTC
(SEQ ID NO: 20) P08 gacataactaattacatgacTTACGGCTCTCCCGTGCC
(SEQ ID NO: 21) p426TEF _P -Amir4259-GPM1 _T Amir4259 Codon-optimized Amir4259 gene P09 taagttttctagaactagtgATGACCACGAATCTTACAGCTAC
(SEQ ID NO: 22) P10 cttatttcttTTACGCCGCTCCGCTTCTG
(SEQ ID NO: 23) GPM1 terminator D452-2 genomic DNA P11 agcggcgtaaAAGAAATAAGTCTGAAGAATGAATG
(SEQ ID NO: 24) P12 ctatagggcgaattgggtacTATTGCTATAACATGTCATGTCAC
(SEQ ID NO: 25) p426TEF _P -Amir4256-GPM1 _T Amir4256 Codon-optimized Amir4256 gene P13 agaactagtgATGTTGAGGGTTTTGCATCTGACC
(SEQ ID NO: 26) P14 cttatttcttTTAACCCCTACGTGCCGCCG
(SEQ ID NO: 27) p426TEF _P -GPM1 _T p426TEF _P - Amir4259-GPM1 _T P15 taggggttaaAAGAAATAAGTCTGAAGAATGAATG
(SEQ ID NO: 28) P16 ccctcaacatCACTAGTTCTAGAAAACTTAGATTAGATTG
(SEQ ID NO: 29) p426GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T TEF _P - Amir4256 - GPM1 _T p426TEF _P -Amir4256-GPM1 _T P17 agggaacaaaagctggagctTATTGCTATAACATGTCATGTCAC
(SEQ ID NO: 30) P18 tgataatgataaactgagctATAGCTTCAAAATGTTTCTACTCC
(SEQ ID NO: 31) p426GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T TEF _P - Amir4259 - GPM1 _T p426TEF _P -Amir4259-GPM1 _T P19 agggaacaaaagctggagctTATTGCTATAACATGTCATGTCAC
(SEQ ID NO: 32) P20 tgataatgataaactgagctATAGCTTCAAAATGTTTCTACTCC
(SEQ ID NO: 33) Donor DNA targeting INT#4 GPD _P - Amir4258 - CYC1 _T - TEF _P - Amir4259 - GPM1 _T p426GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T P21 GATGGCGCATCTATTTGCCGTCAAAAGATCCTCTCATACCATATTAAGTA TATTGCTATAACATGTCATGTCACCATTAATTAC
(SEQ ID NO: 34) P22 CCTCACTGAAAAAAGAAACGAGCGGAGGAATAGTATGATAAATCTTCAGCGCAAATTAAAGCCTTCGAGCGTCC
(SEQ ID NO: 35) Donor DNA targeting INT#6 GPD _P - Amir4257 - CYC1 _T - TEF _P - Amir4256 - GPM1 _T p426GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T P23 AGTCACTGACAGCCACCGCAGAGGTTCTGACTCCTACTGAGCTCTATTGG TATTGCTATAACATGTCATGTCACCATTAATTAC
(SEQ ID NO: 36) P24 TGAGAAATAAAGCATCGAGTACGGCAGTTCGCTGTCACTGAACTAAAACA GCAAATTAAAGCCTTCGAGCGTCC
(SEQ ID NO: 37) pRNA- TAL1 Guide RNAs targeting TAL1 pRNA-his-HYB P25 GCCTGTGCCG gttttagagctagaaatagcaagtt
(SEQ ID NO: 38) P26 AACTGCTTGA cgatcatttatctttcactgcggag
(SEQ ID NO: 39) Donor DNA targeting TAL1 Upstream region of TAL1 D452-2 genomic DNA P27 AATTAAATCGAAAACAAGAACCGAAACG
(SEQ ID NO: 40) P28 ccgagatacttcc TATGTACACGTATATGTGACGAGTTCGAG
(SEQ ID NO: 41) Downstream region of TAL1 D452-2 genomic DNA P29 atacgtgtacata GGAAGTATCTCGGAAATATTAATTTAGGCC
(SEQ ID NO: 42) P30 TTGATTCAGGTCAAAATGGATTCAGG
(SEQ ID NO: 43) pRNA- PHO13 Guide RNAs targeting PHO13 pRNA-his-HYB P31 GAGCCTGCAC gttttagagctagaaatagcaagtt
(SEQ ID NO: 44) P32 CATGATTGAA cgatcatttatctttcactgcggag
(SEQ ID NO: 45) Donor DNA targeting PHO13 Upstream region of PHO13 D452-2 genomic DNA P33 GGACAATTTATTCATGGCATCGTCATTG
(SEQ ID NO: 46) P34 ttgcattgctcctTTTCCCGAGTTGTATATTCTTTGTCAGG
(SEQ ID NO: 47) Downstream region of PHO13 D452-2 genomic DNA P35 acaactcgggaaaAGGAGCAATGCAAAATCTAGGGGTAG
(SEQ ID NO: 48) P36 TGGGCCATTTTTTAAAGGTTCTTCTG
(SEQ ID NO: 49)

Table 4 is a list of primers used for colony PCR.

Target DNA template Name Sequence TEF _P p426TEF _P -CYC1 _T CP01 CTATGACCATGATTACGCCAAGC
(SEQ ID NO: 50) CP02 GAGGTCGACGGTATCGATAAGC
(SEQ ID NO: 51) GPD _P - Amir4257 - CYC1 _T p426GPD _P -Amir4257-CYC1 _T CP03 CTTGACTAATAAGTATATAAAGACGG
(SEQ ID NO: 52) CP04 GAAATATAAATAACGTTCTTAATACTAACATAAC
(SEQ ID NO: 53) GPD _P - Amir4258 - CYC1 _T p426GPD _P -Amir4258-CYC1 _T CP03 CTTGACTAATAAGTATATAAAGACGG
(SEQ ID NO: 54) CP04 GAAATATAAATAACGTTCTTAATACTAACATAAC
(SEQ ID NO: 55) TEF _P - Amir4256 - GPM1 _T p426TEF _P -Amir4256-GPM1 _T CP05 GTTAATAAACGGTCTTCAATTTTCTC
(SEQ ID NO: 56) CP06 CTCCTCAAATTGCTACCACGAC
(SEQ ID NO: 57) TEF _P - Amir4259 - GPM1 _T p426TEF _P -Amir4259-GPM1 _T CP05 GTTAATAAACGGTCTTCAATTTTCTC
(SEQ ID NO: 58) CP06 CTCCTCAAATTGCTACCACGAC
(SEQ ID NO: 59) GPD _P - Amir4258 - CYC1 _T - TEF _P - Amir4259 - GPM1 _T p426GPD _P -Amir4258-CYC1 _T -TEF _P -Amir4259-GPM1 _T CP01 CTATGACCATGATTACGCCAAGC
(SEQ ID NO: 60) CP07 CAGTCACGACGTTGTAAAACGACG
(SEQ ID NO: 61) GPD _P - Amir4257 - CYC1 _T - TEF _P - Amir4256 - GPM1 _T p426GPD _P -Amir4257-CYC1 _T -TEF _P -Amir4256-GPM1 _T CP01 CTATGACCATGATTACGCCAAGC
(SEQ ID NO: 62) CP07 CAGTCACGACGTTGTAAAACGACG
(SEQ ID NO: 63) INT#4 Engineered D452-2 genomic DNA CP08 GCTCGATCTTCTATCCTCTTTAGGT
(SEQ ID NO: 64) CP09 CGAAGAAGTGACCTTAGCCTTCG
(SEQ ID NO: 65) INT#6 Engineered D452-2 genomic DNA CP10 GCCATTGAGTCAAGTTAGGTGCATCC
(SEQ ID NO: 66) CP11 CGTGAACACTTATATAACTTAGCCCG
(SEQ ID NO: 67) TAL1 Engineered D452-2 genomic DNA CP12 GCAACATCAAGTCATAGTCAATTGAATTG
(SEQ ID NO: 68) CP13 GATAATAGGAAAGAAGACAGGCACG
(SEQ ID NO: 69) PHO13 Engineered D452-2 genomic DNA
CP14 CCTGTTACTGTGATACTAACGGGCAAC
(SEQ ID NO: 70) CP15 CCCTCAGAAATCATCAATTGGACCATC
(SEQ ID NO: 71) Sequencing primers for guide RNA sequences pRNA-TAL1, pRNA-PHO13 CP16 CAATGTTCTGTTCAAAAGATTTTG
(SEQ ID NO: 72)

Korea Research Institute of Bioscience and Biotechnology KCTC14827BP 20211215

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Method for manufacturing Shinorine <130> 21P10050 <160> 76 <170> KoPatentIn 3.0 <210> 1 <211> 1020 <212> DNA <213> Artificial Sequence <220> < 223> Amir4256 <400> 1 atgttgaggg ttttgcatct gaccggaagc cctgtgagcc cgtttttcgc ggagttgagc 60 actgtgtacg gtcgtggatg ccttggggcg gcagcagacc cggcgaggta tgagttctta 120 gtagctcatg tcactcccga cggaag gtgg agattccctg cagatttgac accagaagcc 180 ctggctgcgg cacccagatt aggtctgcct gaagctttag ggttaatcga atccagatct 240 gtagatgttg ctgtgcctca gttattttgc cctccaggca tgacaacata tagagccttg 300 ttagacgcat tgggcgtgcc ctaccc agga aacccgccag atgttatggc tctgggagct 360 gataaagcca tgactagagc cgttgtcgcg gcagcagggg ttccggtgcc ggagggacgt 420 gtagtcacta gcgctgatcc gtgtccgcta cctcctccct tcgtggttaa accagttgac 480 gcagacaatt cagacggctt gactttagtt cacgataggg cagattacca tgccgctctt 540 gat gctgcat tcgcatgtag tccaagacgt cgtgccctgg tggagagata tgtaccgcct 600 ggacgtgaag tgcgttgtgg tgttttggtt agatcaggtg tccccacacc attaccgctg 660 gaggagtacc ccttaccatc aggcgtgaga cctagggcgg acaaattagc ggacgat gga 720 gggggcagct tgagtctagt agcaaaagct gatggtcgta gctggatagt ggaccacgac 780 gaccctgtta cggccgccgt acaagaacaa gcacttagat gccatgaagc gctggggtgc 840 agggactata gtttatttga cttcagaatc gatccagagg gcaggccctg gtttctagag 900 gcgggattgt actgctcatt cgctccgaca tccgtgatca cgacgatggc tggagccgca 960 ggtatcggac tagcggaact tttcgctgag gctgtgacaa cggcggcacg taggggttaa 1020 1020 <210> 2 <211> 1356 <212> DNA <213> Artificial Sequence <220> <223> Amir4257 <400> 2 atgtctgacg ctgtcgcccc tcagagagtc ccaggcaggg tgccaggaag atcaggctct 60 ggcagagtga gtaggacgtt aggtgcctta gcattactac tggcggcatt accgttttca 120 gcggcgctta ccgctgtagc tgcacttaga gctgccgtca g accttcccc agctagggca 180 acacctagac gtccgcgtac ggtattgctg acgggtggta aaatgacgaa agcactacac 240 cttgcgaggg catttcacag agccggacat agagttgtcc tggtggaaac cgcgcgttat 300 cgtctaacag cgcatcgttt ctctcgtgcc gttgacgcct tccacgtagt tccggattct 360 gccgatcctc gttacccgca ggctttactg gcaatagtag aaagagaagg agtagatgtc 420 tttgtgcccg tatgttcccc tgcgtcatca gtccacgatg ccgcggcagc tccgttgtta 480 gctacacgtt gcgaagtgtt acacgcagga ttagaagtgg ttgagcttct tgacgacaaa 540 catcgtttcg ctgagctgag cgcggaactg ggtctacctg taccacgttc tcacaggatt 600 actgcgcctg agcaggtgct agatcttggg cttgacggtc cgcacgttct aaagtccata 660 ccgtatgatc ccgtcaaccg tttagactta accccgttgc caagacccac cccagaagcc 720 actctagaat ttttgagggg aaaggacgtt agagatggac atccttgggt actacaagaa 780 ttcgtcgcag gaaaagagta ttgtacgcat tccacagtcc cggac gtgct ttagcaatcg aatgcaatcc gagaactcat 1020 tctgcgatta cgatgtttca tgatcatcct gatttagcac gtgcgtactt ggacccggat 1080 gctccccaga taaggcctct tccctccagt aggcccacct attggctatt tcatgaattg 1140 tggagggctc taagcgaacc gggtacagca agagagagac ttagagtcgt tgccagagga 1200 aaggaagccg tattcgactg gtctgaccct ctaccgttcc ttttacttca A mir4258 <400> 3 atgtctgcgc caggcgctcc aaggccagtt accccggtcg cactgcttgc agacaccttg 60 gcaagattag ccggcaggag tgatttgccc cctgacgtcg tcgcagaatt atctgccgcg 120 gcagagttgg catctggagt cgacggttac gctggtcgtt gtacgactcc cgaatcccct 180 gcactgagag aactggcggc cagaactgcc gaacatgact ggcgtggcag agggggcgga 240 gt tgcgttgg aacaggaaat gctgtccggt cacgtggagg gacagctatt aaagaccttg 300 cttagagccc taagggcgag aagggtattg gaaatcggca tgtttacagg gtatagcgcg 360 ttagccatgg cggaagaact acccgatgat ggagtcgtcg tagcctgtga actagacccc 420 gacgtt gcag cttttgccag agagagattt agtgctagcc cgcacggtag gaaggtagat 480 gtacgtgtcg gcccggcctt cgg gagccag ggacgctgtt ggtgccgctg ttgacagatt taatagacat 720 gtcgctcaga ggcccgacgt cgcccaggtt ctagtacctg tgagggacgg gcttacgtta 780 atcagaagag taacacctgg cacggagag ccgtaa 816 <210> 4 <211> 1221 <21 2> DNA <213> Artificial Sequence <220> <223> Amir4259 <400> 4 atgaccacga atcttacagc taccgttact gccacggaaa atgatttcag agtccgtgct 60 gtcgaggaga gagattactt gctaacttat gtagatggag ctttcagtcc agaatccagc 120 cgtatagcgg atcatcacag ag cacatggg aggtgcttaa tgatcgtaga cgccaatgtt 180 cataggctac acggcgatag gatcagggca tacttcgagc accatgggat cgcactgaca 240 gctcttcctt tagccatcga tgaaacacaa aagtccttaa gaacggtcga acgtatcgtt 300 gacgcattcg gcgaattcgg cctaatcaga aaggagcccg tgttggtagt tggtggaggc 360 ttgttgaccg atgtagcggg cttcgcgtgc gccgttttcc gtcgtagcac cgactacgtt 420 agagtaccca ctagtttaat cggattgatt gatgcttccg tt gcgataaa ggtagctgtc 480 aaccacggcc gtacaaaaaa ccgtttgggt gcgtttcatg cttcaaagga agtcgtatta 540 gatttttcct tcctaggcac cttaccgact gaacaagtaa ggaatggaat ggccgagttg 600 gtcaaaattg cggtcgtggc gaatgcg gaa gtttttcgtc tgttagagaa atacggagag 660 gaccttcttc acactgcctt cggcactgtt gacgggaccc cccagctgcg tgagacagcc 720 cgtaaagtca cccatgaggc aatcggaaca atgctggctc tggaagcccc taatctgcgt 780 gaattagatc tggacagggc cattgcgttt gggcacacat ggagccccgc tttggagtta 840 gcaccggaaa cgccatacct aacggacat gccataagtg tagatatggc tctttcttg c 900 actattgctg aaaggagagg atatctggcc acctccgaga gggataggat cttttggctt 960 ctgagcaagg tcgggttatc tctggactca cctcacctga ctccagaact tttgagagct 1020 gcaactgaga gtatcgttca gactagagac ggccttcaga gggcggctat gcccagac ca 1080 atcggcacgt gctgtttcgt caacgatttg acggagtctg agctacttga tggacttgcc 1140 gcccacaggg agcttgtagc caggtatcca agaggtgggg ctggtgagga tgttagggtg 1200 accagaagcg gagcggcgta a 1221 <210> 5 <211> 1008 <212> DNA <213> Saccharomyces cerevisiae <400> 5 atgtctgaac cagctcaaaa gaaacaaaag gttgctaaca actctctaga acaattgaaa 60 gcctccggca ctgtcgttgt tgccgacact ggtgatttcg gctctattgc caagtttcaa 120 cctcaagact ccacaactaa cccatcattg atcttggctg ctgccaagca accaacttac 180 gccaagttga tcgatgttgc cgtggaatac ggtaagaagc atggtaagac caccgaagaa 240 caagtcgaaa atgctgtgga cagattgtta gtcgaattcg gtaaggagat cttaaagatt 300 gttccaggca gagtctccac cgaagttgat gctagattgt cttt tgacac tcaagctacc 360 attgaaaagg ctagacatat cattaaattg tttgaacaag aaggtgtctc caaggaaaga 420 gtccttatta aaattgcttc cacttgggaa ggtattcaag ctgccaaaga attggaagaa 480 aaggacggta tccactgtaa tttgactcta ttatattctcc t tcgttcaagc agttgcctgt 540 gccgaggccc aagttacttt gatttcccca tttgttggta gaattctaga ctggtacaaa 600 tccagcactg gtaaagatta caagggtgaa gccgacccag gtgttatttc cgtcaagaaa 660 atctacaact actacaagaa gtacggttac aagactattg ttatgggtgc ttctttcaga 720 agcactgacg aaatcaaaaa cctggctggt gttgactatc taacaatttc tccag cttta 780 ttggacaagt tgatgaacag tactgaacct ttcccaagag ttttggaccc tgtctccgct 840 aagaaggaag ccggcgacaa gatttcttac atcagcgacg aatctaaatt cagattcgac 900 ttgaatgaag acgctatggc cactgaaaaa ttgtccgaag gtat cagaaa attctctgcc 960 gatattgtta ctctattcga cttgattgaa aagaaagtta ccgcttaa 1008 < 210> 6 <211> 318 <212> PRT <213> Pichia stipitis <400> 6 Met Pro Ser Ile Lys Leu Asn Ser Gly Tyr Asp Met Pro Ala Val Gly 1 5 10 15 Phe Gly Cys Trp Lys Val Asp Val Asp Thr Cys Ser Glu Gln Ile Tyr 20 25 30 Arg Ala Ile Lys Thr Gly Tyr Arg Leu Phe Asp Gly Ala Glu Asp Tyr 35 40 45 Ala Asn Glu Lys Leu Val Gly Ala Gly Val Lys Lys Ala Ile Asp Glu 50 55 60 Gly Ile Val Lys Arg Glu Asp Leu Phe Leu Thr Ser Lys Leu Trp Asn 65 70 75 80 Asn Tyr His His Pro Asp Asn Val Glu Lys Ala Leu Asn Arg Thr Leu 85 90 95 Ser Asp Leu Gln Val Asp Tyr Val Asp Leu Phe Leu Ile His Phe Pro 100 105 110 Val Thr Phe Lys Phe Val Pro Leu Glu Glu Lys Tyr Pro Pro Gly Phe 115 120 125 Tyr Cys Gly Lys Gly Asp Asn Phe Asp Tyr Glu Asp Val Pro Ile Leu 130 135 140 Glu Thr Trp Lys Ala Leu Glu Lys Leu Val Lys Ala Gly Lys Ile Arg 145 150 155 160 Ser Ile Gly Val Ser Asn Phe Pro Gly Ala Leu Leu Leu Asp Leu Leu 165 170 175 Arg Gly Ala Thr Ile Lys Pro Ser Val Leu Gln Val Glu His Pro 180 185 190 Tyr Leu Gln Gln Pro Arg Leu Ile Glu Phe Ala Gln Ser Arg Gly Ile 195 200 205 Ala Val Thr Ala Tyr Ser Ser Phe Gly Pro Gln Ser Phe Val Glu Leu 210 215 220 Asn Gln Gly Arg Ala Leu Asn Thr Ser Pro Leu Phe Glu Asn Glu Thr 225 230 235 240 Ile Lys Ala Ile Ala Ala Lys His Gly Lys Ser Pro Ala Gln Val Leu 245 250 255 Leu Arg Trp Ser Ser Gln Arg Gly Ile Ala Ile Ile Pro Lys Ser Asn 260 265 270 Thr Val Pro Arg Leu Leu Glu Asn Lys Asp Val Asn Ser Phe Asp Leu 275 280 285 Asp Glu Gln Asp Phe Ala Asp Ile Ala Lys Leu Asp Ile Asn Leu Arg 290 295 300 Phe Asn Asp Pro Trp Asp Trp Asp Lys Ile Pro Ile Phe Val 305 310 315 <210> 7 <211> 1026 <212> DNA <213> Pichia stipitis <400> 7 tacaactata ctacaatgcc ttctattaag ttgaactctg gttacgacat gccagccgtc 60 ggtttcggct gttggaaagt cgacgtcgac acctgttctg aacagatcta ccgtgctatc 120 aagaccggtt acagattgtt cgacggtgcc gaagattacg ccaacgaaaa gttagttggt 180 gccggtgtca agaaggccat tgacgaaggt atcgtcaagc gtgaagactt gttccttacc 240 tccaagttgt ggaacaacta ccaccaccca gacaacgtcg aaaaggcctt gaacagaacc 300 ctttctgact tgcaagttga ctacgttgac ttgttcttga tccacttccc agtcaccttc 360 aagttcgttc cattagaaga aaagtaccca ccaggattct actgtgta a gggtgacaac 420 ttcgactacg aagatgttcc aattttagag acctggaagg ctcttgaaaa gttggtcaag 480 gccggtaaga tcagatctat cggtgtttct aacttcccag gtgctttgct cttggacttg 540 ttgagaggtg ctaccatcaa gccatctgtc ttg caagttg aacaccaccc atacttgcaa 600 caaccaagat tgatcgaatt cgctcaatcc cgtggtattg ctgtcaccgc ttactcttcg 660 ttcggtcctc aatctttcgt tgaattgaac caaggtagag ctttgaacac ttctccattg 720 ttcgagaacg aaactatcaa ggctatcgct gctaagcacg gtaagtctcc agctcaagtc 780 ttgttgagat ggtcttccca aagaggcatt gccatcattc caaagt ccaa cactgtccca 840 agattgttgg aaaacaagga cgtcaacagc ttcgacttgg acgaacaaga tttcgctgac 900 attgccaagt tggacatcaa cttgagattc aacgacccat gggactggga caagattcct 960 atcttcgtct aagaaggttg ctttatagag aggaaataaa acctaata ta cattgattgt 1020 acattt 1026 <210> 8 <211 > 318 <212> PRT <213> Artificial Sequence <220> <223> mutant XYL1 (R276H) <400> 8 Met Pro Ser Ile Lys Leu Asn Ser Gly Tyr Asp Met Pro Ala Val Gly 1 5 10 15 Phe Gly Cys Trp Lys Val Asp Val Asp Thr Cys Ser Glu Gln Ile Tyr 20 25 30 Arg Ala Ile Lys Thr Gly Tyr Arg Leu Phe Asp Gly Ala Glu Asp Tyr 35 40 45 Ala Asn Glu Lys Leu Val Gly Ala Gly Val Lys Lys Ala Ile Asp Glu 50 55 60 Gly Ile Val Lys Arg Glu Asp Leu Phe Leu Thr Ser Lys Leu Trp Asn 65 70 75 80 Asn Tyr His His Pro Asp Asn Val Glu Lys Ala Leu Asn Arg Thr Leu 85 90 95 Ser Asp Leu Gln Val Asp Tyr Val Asp Leu Phe Leu Ile His Phe Pro 100 105 110 Val Thr Phe Lys Phe Val Pro Leu Glu Glu Lys Tyr Pro Pro Gly Phe 115 120 125 Tyr Cys Gly Lys Gly Asp Asn Phe Asp Tyr Glu Asp Val Pro Ile Leu 130 135 140 Glu Thr Trp Lys Ala Leu Glu Lys Leu Val Lys Ala Gly Lys Ile Arg 145 150 155 160 Ser Ile Gly Val Ser Asn Phe Pro Gly Ala Leu Leu Leu Leu Asp Leu Leu 165 170 175 Arg Gly Ala Thr Ile Lys Pro Ser Val Leu Gln Val Glu His His Pro 180 185 190 Tyr Leu Gln Gln Pro Arg Leu Ile Glu Phe Ala Gln Ser Arg Gly Ile 195 200 205 Ala Val Thr Ala Tyr Ser Ser Ser Phe Gly Pro Gln Ser Phe Val Glu Leu 210 215 220 Asn Gln Gly Arg Ala Leu Asn Thr Ser Pro Leu Phe Glu Asn Glu Thr 225 230 235 240 Ile Lys Ala Ile Ala Ala Lys His Gly Lys Ser Pro Ala Gln Val Leu 245 250 255 Leu Arg Trp Ser Ser Gln Arg Gly Ile Ala Ile Ile Pro Lys Ser Asn 260 265 270 Thr Val Pro His Leu Leu Glu Asn Lys Asp Val Asn Ser Phe Asp Leu 275 280 285 Asp Glu Gln Asp Phe Ala Asp Ile Ala Lys Leu Asp Ile Asn Leu Arg 290 295 300 Phe Asn Asp Pro Trp Asp Trp Asp Lys Ile Pro Ile Phe Val 305 310 315 <210> 9 <211> 1026 <212> DNA <213> Artificial Sequence <220> <223> mutant XYL1 (R276H) <400> 9 tacaactata ctacaatgcc ttctattaag ttgaactctg gttacgacat gccagccgtc 60 ggt ttcggct gttggaaagt cgacgtcgac acctgttctg aacagatcta ccgtgctatc 120 aagaccggtt acagattgtt cgacggtgcc gaagattacg ccaacgaaaa gttagttggt 180 gccggtgtca agaaggccat tgacgaaggt atcgtcaagc gtgaagactt gttccttacc 240 tccaagttgt ggaacaacta ccacca ccca gacaacgtcg aaaaggcctt gaacagaacc 300 ctttctgact tgcaagttga ctacgttgac ttgttcttga tccacttccc agtcaccttc 360 aagttcgttc cattagaaga aaagtaccca ccaggattct actgtggtaa gggtgacaac 420 ttcgactacg aagat gttcc aattttagag acctggaagg ctcttgaaaa gttggtcaag 480 gccggtaaga tcagatctat cggtgtttct aacttcccag gtgctttgct cttggacttg 540 ttgagaggtg ctaccatcaa gccatctgtc ttgcaagttg aacaccaccc atacttgcaa 600 caaccaagat tgatcgaatt cgctcaatcc cgtggtattg ctgtcaccgc ttactcttcg 660 ttcggtcctc aatctttcgt tgaattgaac caaggtagag ctttgaacac ttctccattg 720 ttcgagaacg aaactatcaa ggctatcgct gctaagcacg gtaagtctcc agctcaagtc 780 ttgttgagat ggtcttccca aagaggcatt gccatcattc caaagtccaa cactgtccca 840 cacttgtt gg aaaacaagga cgtcaacagc ttcgacttgg acgaacaaga tttcgctgac 900 attgccaagt tggacatcaa cttgagattc aacgacccat gggactggga caagattcct 960 atcttcgtct aagaaggttg ctttatagag aggaaataaa acctaatata cattgattgt 1020 acattt 1026 <210> 10 <211> 363 <212> PRT <213> Pichia stipitis <400> 10 Met Thr Ala Asn Pro Ser Leu Val Leu Asn Lys Ile Asp Asp Ile Ser 1 5 10 15 Phe Glu Thr Tyr Asp Ala Pro Glu Ile Ser Glu Pro Thr Asp Val Leu 20 25 30 Val Gln Val Lys Lys Thr Gly Ile Cys Gly Ser Asp Ile His Phe Tyr 35 40 45 Ala His Gly Arg Ile Gly Asn Phe Val Leu Thr Lys Pro Met Val Leu 50 55 60 Gly His Glu Ser Ala Gly Thr Val Val Gln Val Gly Lys Gly Val Thr 65 70 75 80 Ser Leu Lys Val Gly Asp Asn Val Ala Ile Glu Pro Gly Ile Pro Ser 85 90 95 Arg Phe Ser Asp Glu Tyr Lys Ser Gly His Tyr Asn Leu Cys Pro His 100 105 110 Met Ala Phe Ala Ala Thr Pro Asn Ser Lys Glu Gly Glu Pro Asn Pro 115 120 125 Pro Gly Thr Leu Cys Lys Tyr Phe Lys Ser Pro Glu Asp Phe Leu Val 130 135 140 Lys Leu Pro Asp His Val Ser Leu Glu Leu Gly Ala Leu Val Glu Pro 145 150 155 160 Leu Ser Val Gly Val His Ala Ser Lys Leu Gly Ser Val Ala Phe Gly 165 170 175 Asp Tyr Val Ala Val Phe Gly Ala Gly Pro Val Gly Leu Leu Ala Ala 180 185 190 Ala Val Ala Lys Thr Phe Gly Ala Lys Gly Val Ile Val Val Asp Ile 195 200 205 Phe Asp Asn Lys Leu Lys Met Ala Lys Asp Ile Gly Ala Ala Thr His 210 215 220 Thr Phe Asn Ser Lys Thr Gly Gly Ser Glu Glu Leu Ile Lys Ala Phe 225 230 235 240 Gly Gly Asn Val Pro Asn Val Val Leu Glu Cys Thr Gly Ala Glu Pro 245 250 255 Cys Ile Lys Leu Gly Val Asp Ala Ile Ala Pro Gly Gly Arg Phe Val 260 265 270 Gln Val Gly Asn Ala Ala Gly Pro Val Ser Phe Pro Ile Thr Val Phe 275 280 285 Ala Met Lys Glu Leu Thr Leu Phe Gly Ser Phe Arg Tyr Gly Phe Asn 290 295 300 Asp Tyr Lys Thr Ala Val Gly Ile Phe Asp Thr Asn Tyr Gln Asn Gly 305 310 315 320 Arg Glu Asn Ala Pro Ile Asp Phe Glu Gln Leu Ile Thr His Arg Tyr 325 330 335 Lys Phe Lys Asp Ala Ile Glu Ala Tyr Asp Leu Val Arg Ala Gly Lys 340 345 350 Gly Ala Val Lys Cys Leu Ile Asp Gly Pro Glu 355 360 <210> 11 <211> 1235 <212> DNA <213> Pichia stipitis <400> 11 cctcacttta gtttgtttca atcaccccta atactcttca cacaattaaa atgactgcta 6 0 acccttcctt ggtgttgaac aagatcgacg acatttcgtt cgaaacttac gatgccccag 120 aaatctctga acctaccgat gtcctcgtcc aggtcaagaa aaccggtatc tgtggttccg 180 acatccactt ctacgcccat ggtagaatcg gtaacttcgt tttgaccaag ccaatggtct 240 tgggtcacga atccgccggt actgttgtcc aggttggtaa gggtgtcacc tctcttaagg 300 ttggtgacaa cgtcgctatc gaaccaggta ttccatccag attctccgac gaataca aga 360 gcggtcacta caacttgtgt cctcacatgg ccttcgccgc tactcctaac tccaaggaag 420 gcgaaccaaa cccaccaggt accttatgta agtacttcaa gtcgccagaa gacttcttgg 480 tcaagttgcc agaccacgtc agcttggaac tcggtgctct tgttga gcca ttgtctgttg 540 gtgtccacgc ctctaagttg ggttccgttg ctttcggcga ctacgttgcc gtctttggtg 600 ctggtcctgt tggtcttttg gctgctgctg tcgccaagac cttcggtgct aagggtgtca 660 tcgtcgttga cattttcgac aacaagttga agatggccaa ggacattggt gctgctactc 720 acaccttcaa ctccaagacc ggtggttctg aagaattgat caaggctttc gg tggtaacg 780 tgccaaacgt cgttttggaa tgtactggtg ctgaaccttg tatcaagttg ggtgttgacg 840 ccattgcccc aggtggtcgt ttcgttcaag tcggtaacgc tgctggtcca gtcagcttcc 900 caatcaccgt tttcgccatg aag gaattga ctttgttcgg ttctttcaga tacggattca 960 acgactacaa gactgctgtt ggaatctttg acactaacta ccaaaacggt agagaaaatg 1020 ctccaattga ctttgaacaa ttgatcaccc acagatacaa gttcaaggac gctattgaag 1080 cctacgactt ggtcagagcc ggtaagggtg ctgtcaagtg tctcattgac ggccctgagt 1140 aagtcaaccg cttggctggc ccaaagtgaa ccagaaacga aaatgattat caaatagctt 1200 tatag acctt tatccaaatt tatgtaaact aatag 1235 <210> 12 <211> 623 <212> PRT <213> Pichia stipitis <400> 12 Met Thr Thr Thr Pro Phe Asp Ala Pro Asp Lys Leu Phe Leu Gly Phe 1 5 10 15 Asp Leu Ser Thr Gln Gln Leu Lys Ile Ile Val Thr Asp Glu Asn Leu 20 25 30 Ala Ala Leu Lys Thr Tyr Asn Val Glu Phe Asp Ser Ile Asn Ser Ser 35 40 45 Val Gln Lys Gly Val Ile Ala Ile Asn Asp Glu Ile Ser Lys Gly Ala 50 55 60 Ile Ile Ser Pro Val Tyr Met Trp Leu Asp Ala Leu Asp His Val Phe 65 70 75 80 Glu Asp Met Lys Lys Asp Gly Phe Pro Phe Asn Lys Val Val Gly Ile 85 90 95 Ser Gly Ser Cys Gln Gln His Gly Ser Val Tyr Trp Ser Arg Thr Ala 100 105 110 Glu Lys Val Leu Ser Glu Leu Asp Ala Glu Ser Ser Leu Ser Ser Gln 115 120 125 Met Arg Ser Ala Phe Thr Phe Lys His Ala Pro Asn Trp Gln Asp His 130 135 140 Ser Thr Gly Lys Glu Leu Glu Glu Phe Glu Arg Val Ile Gly Ala Asp 145 150 155 160 Ala Leu Ala Asp Ile Ser Gly Ser Arg Ala His Tyr Arg Phe Thr Gly 165 170 175 Leu Gln Ile Arg Lys Leu Ser Thr Arg Phe Lys Pro Glu Lys Tyr Asn 180 185 190 Arg Thr Ala Arg Ile Ser Leu Val Ser Ser Phe Val Ala Ser Val Leu 195 200 205 Leu Gly Arg Ile Thr Ser Ile Glu Glu Ala Asp Ala Cys Gly Met Asn 210 215 220 Leu Tyr Asp Ile Glu Lys Arg Glu Phe Asn Glu Glu Leu Leu Ala Ile 225 230 235 240 Ala Ala Gly Val His Pro Glu Leu Asp Gly Val Glu Gln Asp Gly Glu 245 250 255 Ile Tyr Arg Ala Gly Ile Asn Glu Leu Lys Arg Lys Leu Gly Pro Val 260 265 270 Lys Pro Ile Thr Tyr Glu Ser Glu Gly Asp Ile Ala Ser Tyr Phe Val 275 280 285 Thr Arg Tyr Gly Phe Asn Pro Asp Cys Lys Ile Tyr Ser Phe Thr Gly 290 295 300 Asp Asn Leu Ala Thr Ile Ile Ser Leu Pro Leu Ala Pro Asn Asp Ala 305 310 315 320 Leu Ile Ser Leu Gly Thr Ser Thr Thr Thr Val Leu Ile Ile Thr Lys Asn 325 330 335 Tyr Ala Pro Ser Ser Gln Tyr His Leu Phe Lys His Pro Thr Met Pro 340 345 350 Asp His Tyr Met Gly Met Ile Cys Tyr Cys Asn Gly Ser Leu Ala Arg 355 360 365 Glu Lys Val Arg Asp Glu Val Asn Glu Lys Phe Asn Val Glu Asp Lys 370 375 380 Lys Ser Trp Asp Lys Phe Asn Glu Ile Leu Asp Lys Ser Thr Asp Phe 385 390 395 400 Asn Asn Lys Leu Gly Ile Tyr Phe Pro Leu Gly Glu Ile Val Pro Asn 405 410 415 Ala Ala Ala Gln Ile Lys Arg Ser Val Leu Asn Ser Lys Asn Glu Ile 420 425 430 Val Asp Val Glu Leu Gly Asp Lys Asn Trp Gln Pro Glu Asp Asp Val 435 440 445 Ser Ser Ile Val Glu Ser Gln Thr Leu Ser Cys Arg Leu Arg Thr Gly 450 455 460 Pro Met Leu Ser Lys Ser Gly Asp Ser Ser Ser Ala Ser Ser Ser Ser Ala Ser 465 470 475 480 Pro Gln Pro Glu Gly Asp Gly Thr Asp Leu His Lys Val Tyr Gln Asp 485 490 495 Leu Val Lys Lys Phe Gly Asp Leu Tyr Thr Asp Gly Lys Lys Gln Thr 500 505 510 Phe Glu Ser Leu Thr Ala Arg Pro Asn Arg Cys Tyr Tyr Val Gly Gly 515 520 525 Ala Ser Asn Asn Gly Ser Ile Ile Arg Lys Met Gly Ser Ile Leu Ala 530 535 540 Pro Val Asn Gly Asn Tyr Lys Val Asp Ile Pro Asn Ala Cys Ala Leu 545 550 555 560 Gly Gly Ala Tyr Lys Ala Ser Trp Ser Tyr Glu Cys Glu Ala Lys Lys 565 570 575 Glu Trp Ile Gly Tyr Asp Gln Tyr Ile Asn Arg Leu Phe Glu Val Ser 580 585 590 Asp Glu Met Asn Ser Phe Glu Val Lys Asp Lys Trp Leu Glu Tyr Ala 595 600 605 Asn Gly Val Gly Met Leu Ala Lys Met Glu Ser Glu Leu Lys His 610 615 620 <210> 13 <211> 2202 <212> DNA <213> Pichia stipitis <400> 13 atagatccct ggaggatacc cacagacatt actgctacta attcatacca tacttgacgt 60 atatctgcgc atacatatct accccaactt tcatataaaa ttcctagatt tattgcatct 120 tctaatagag tcatttttca gattt ttcaa tttccataga aagcatacat tttcatacag 180 cttctatttg ttaatcgacc tgataatttt actagccata tttctttttt tgatttttca 240 cttaatcgac atataaatac tcacgtagtt gacactcaca atgaccacta ccccatttga 300 tgctccagat aagctcttcc tcgggttcga tctttcgact cagcagttga agatcatcgt 360 caccgatgaa aacctcgctg ctctcaaaac ctacaatgtc gagttcgata gcatcaacag 420 ctctgtccag aagggtgtca ttgctatcaa cgacgaaatc agcaagggtg ccattatttc 480 ccccgtttac atgtggttgg atgcccttga ccatgttttt gaagacatga agaaggacgg 540 attccccttc aacaaggttg ttggtatttc cggttcttgt caacagcacg gttcggtata 600 ctggtctaga acggccgaga aggtcttgtc cgaattggac gctgaatctt cgttatc gag 660 ccagatgaga tctgctttca ccttcaagca cgctccaaac tggcaggatc actctaccgg 720 taaagagctt gaagagttcg aaagagtgat tggtgctgat gccttggctg atatctctgg 780 ttccagagcc cattacagat tcacagggct ccagattaga aagttgtcta ccagattcaa 840 gcccgaaaag tacaacagaa ctgctcgtat ctctttagtt tcgtcatttg ttgccagtgt 900 gttgctt ggt agaatcacct ccattgaaga ggccgatgct tgtggaatga acttgtacga 960 tatcgaaaag cgcgagttca acgaagagct cttggccatc gctgctggtg tccaccctga 1020 gttggatggt gtagaacaag acggtgaaat ttacagagct ggtatcaatg agttgaagag 1080 aaagttgggt cctgtcaaac ctataacata cgaaagcgaa ggtgacattg cctcttactt 1140 tgtcaccaga tacggcttca accccgactg taaaatctac tcgttcaccg gagacaattt 1200 ggccacgatt atctcgttgc ctttggctcc aaatgatgct ttgatctcat tgggtacttc 1260 tactacagtt ttaattatca ccaagaacta cgctccttct tctcaatacc atttgtttaa 1320 acatccaacc atgcctgacc actacatggg catgatctgc tactgtaacg gttccttggc 1380 cagagaaaag gttagagacg aagtcaacga aaagttcaat gtagaagaca agaagtcgtg 1440 ggacaagttc aatgaaatct tggacaaatc cacagacttc aacaacaagt tgggtattta 1500 cttcccactt ggcgaaattg tccctaatgc cgctgctcag atcaagagat cggtgttgaa 1560 cagcaagaac gaaattgtag acgttgagtt gggcgacaag aactggcaac ctgaagatga 1620 tgtttcttca attgtagaat cacagacttt gtcttgtaga ttgagaactg gtccaatgtt 1680 gagcaagagt ggagattctt ctgcttccag ctctgcctca cctcaaccag aaggtgatgg 1740 tacagatttg cacaaggtct accaagactt ggttaa aaag tttggtgact tgtacactga 1800 tggaaagaag caaacctttg agtctttgac cgccagacct aaccgttgtt actacgtcgg 1860 tggtgcttcc aacaacggca gcattatccg caagatgggt tccatcttgg ctcccgtcaa 1920 cggaaactac aaggttgaca ttcctaacgc ctgtgcattg ggtggtgctt acaaggccag 1980 ttggagttac gagtgtgaag ccaagaagga atggatcgga tacgatcagt atatcaacag 2040 attgtttgaa gtaagtgacg agatgaatct gttcgaagtc aaggataaat ggctcgaata 2100 tgccaacggg gttggaatgt tggccaagat ggaaagtgaa ttgaaacact aaaatccata 2160 atagcttgta tagaggtata gaaaaagaga acgtta taga gt 2202 <210> 14 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gaacaaaagc tggagctcat agcttcaaaa tgtttctact c 41 <210> 15 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 agcccggggg atccacttag attagattgc tatgctttct ttc 43 <210> 16 <2 11> 49 < 212 > DNA <213> Artificial Sequence <220> <223> primer <400> 16 acggattcta gaactagtga tgcttcgtgt tctgcacctg accggttcg 49 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 17 gacataacta attacatgac tcaccccctg cgcgcggcgg 40 <210> 18 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gacggattct agaactagtg atgtctgacg ctgtcgcc 38 <210> 19 <211> 38 < 212 > DNA <213> Artificial Sequence <220> <223> primer <400> 19 gacataacta attacatgac ttagtctcct gaaggcgc 38 <210> 20 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gacggattct agaactagtg atgtctgcgc caggcgctc 39 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gacataacta attacatgac ttacggctct cccgtgcc 38 <210> 22 <211> 43 < 212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 taagttttct agaactagtg atgaccacga atcttacagc tac 43 <210> 23 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cttatttctt ttacgccgct ccgcttctg 29 <210> 24 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 agcggcgtaa aagaaataag tctgaagaat gaatg 35 <210> 25 <211> 44 <21 2> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ctatagggcg aattgggtac tattgctata acatgtcatg tcac 44 <210> 26 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 AGACTAGTG ATGTGAGGGGGTTTGCAT GACC 34 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence CG 30 <210> 28 <211> 35 <212> DNA < 213> Artificial Sequence <220> <223> primer <400> 28 taggggttaa aagaaataag tctgaagaat gaatg 35 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ccctcaacat cactagttct agaaaactta gattagattg 40 <210> 30 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 agggaacaaa agctggagct tattgctata acatgtcatg tcac 44 <210> 31 <211> 44 <212> DNA < 213> Artificial Sequence <220> <223> primer <400> 31 tgataatgat aaactgagct atagcttcaa aatgtttcta ctcc 44 <210> 32 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 agggaacaaa agctggagct tattgctata acatgtcatg tcac 44 <210> 33 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 gatggcgcat ctatttgccg tcaaaagatc ctctcatacc atattaagta tattgctata 60 acatgtcatg tcaccattaa ttac 84 <210> 35 <211> 74 <212> DNA <213> Artificial Sequence <220 ><223 > primer <400> 35 cctcactgaa aaaagaaacg agcggaggaa tagtatgata aatcttcagc gcaaattaaa 60 gccttcgagc gtcc 74 <210> 36 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 agtcactgac agccaccgca gaggttctga ctcctactga gctctattgg tattgctata 60 acatgtcatg tcaccattaa ttac 84 <210> 37 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 tgagaaataa agcatcgagt acggcagttc gctgtcactg aactaaaaca gcaaattaaa 60 gccttcgagc gt cc 74 <210> 38 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 gcctgtgccg gttttagagc tagaaatagc aagtt 35 <210> 39 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 AACTGCTGA CGATCATTTA TCTTTTACTG CGGAG 35 <210> 40 <211> 28 <212> DNA <213> Artificial sequence GAAACG 28 <210> 41 <211> 42 < 212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ccgagatact tcctatgtac acgtatatgt gacgagttcg ag 42 <210> 42 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer < 400> 42 atacgtgtac ataggaagta tctcggaaat attaatttag gcc 43 <210> 43 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 ttgattcagg tcaaaatgga ttcagg 26 <210> 44 <211> 35 < 212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 gagcctgcac gttttagagc tagaaatagc aagtt 35 <210> 45 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 45 catgattgaa cgatcattta tctttcactg cggag 35 <210> 46 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ggacaattta ttcatggcat cgtcattg 28 <210> 47 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 ttgcattgct ccttttcccg agttgtat tctttgtcag g 41 <210> 48 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 acaactcggg aaaaggagca atgcaaaatc taggggtag 39 <210> 49 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 tgggccattt tttaaagggt tcttctg 27 <210> 50 <211> 23 <21 2> DNA <213> Artificial Sequence <220> <223> primer <400> 50 ctatgaccat gattacgcca agc 23 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 gaggtcgacg gtatcgataa gc 22 <210> 52 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 cttgactaat aagtatataa agacgg 26 <210> 53 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 gaaatataaa taacgttctt aatactaaca taac 34 <210> 54 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cttgactaat aagtatataa agacgg 26 < 210> 55 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 gaaatataaa taacgttctt aatactaaca taac 34 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence < 220> <223> primer <400> 56 gttaataaac ggtcttcaat ttctc 25 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 ctcctcaaat tgctaccacg ac 22 <210> 58 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 gttaataaac ggtcttcaat ttctc 25 <210> 59 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 59 ctcctcaaat tgctaccacg ac 22 <210> 60 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 ctatgaccat gattacgcca agc 23 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 61 cagtcacgac gttgtaaaac gacg 24 <210> 62 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400 > 62 ctatgaccat gattacgcca agc 23 <210> 63 <211> 24 <212> DNA <213> Artificial sequence <220> <223> primer <400> 63 cagtcacgac gttgtaaaac gacg 24 <210> 64 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 64 gctcgatctt ctatcctctt taggt 25 <210> 65 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 65 cgaagaagtg accttagcct tcg 23 <210> 66 <211> 25 <212> DNA <213 > Artificial Sequence <220> <223> primer <400> 66 gccattgagt caagttaggt catcc 25 <210> 67 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 67 cgtgaacacc ttatataact tagcccg 27 <210> 68 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 68 gcaacatcaa gtcatagtca attgaattg 29 <210> 69 <211> 25 <212> DNA <213> Artificial Sequence < 220> <223> primer <400> 69 gataatagga aagaagacag gcacg 25 <210> 70 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 70 cctgttactg tgatactaac gggcaac 27 <210> 71 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 71 ccctcagaaa tcatcaattg gaccatc 27 <210> 72 <211> 24 <212> DNA <213> Artificial Sequence <220> <223 > primer <400> 72 caatgttctg ttcaaaagat tttg 24 <210> 73 <211> 3682 <212> DNA <213> Artificial Sequence <220> <223> donorDNA_GPD-Amir4258-CYC1-TEF-Amir4259-GPM1 <400> 73 tattgctata a catgtcatg tcaccattaa ttaccactca ttccaacata ctgtccctga 60 cgaaaactgt ttatgcgagc gcaaaatgaa cctattcaat taataatact cctcaaattg 120 ctaccacgac aggctgaaaa aagatgtcga cgaataatgt aatcgtgtca aacaaacgtt 180 atcttgacta tatatagcta cttaatt tga aataataaac tatacaagtc tatatcattg 240 atatattcag taagaaaaat ggaggggaaaa agaaatcatc aaatcattca ttcttcagac 300 ttatttcttt tacgccgctc cgcttctggt caccctaaca tcctcaccag ccccacctct 360 tggatacctg gctacaagct cc ctgtgggc ggcaagtcca tcaagtagct cagactccgt 420 caaatcgttg acgaaacagc acgtgccgat tggtctgggc atagccgccc tctgaaggcc 480 gtctctagtc tgaacgatac tctcagttgc agctctcaaa agttctggag tcaggtgagg 540 tgagtccaga gataacccga ccttgctcag aagccaaaag atcctatccc tctcggaggt 600 ggccagatat cctctccttt cagcaatagt gcaagaaaga gccatatcta cacttatggc 660 atgtccgtgt aggtatggcg tttccggtgc taactccaaa gcggggctcc atgtgtgccc 720 aaacgcaatg gccctgtcca gatctaattc acgcagatta ggggcttcca gagccagcat 780 tgttccgatt gcctcatggg tgactttacg ggctgtctca cgcagctggg gggtcccgtc 840 aacagtgccg aaggcagtgt gaagaaggtc ctctccgtat ttctctaaca gacgaaaaac 900 ttccgcattc gccacgaccg caattttgac caactcggcc attccattcc ttacttgt tc 960 agtcggtaag gtgcctagga aggaaaaatc taatacgact tcctttgaag catgaaacgc 1020 acccaaacgg ttttttgtac ggccgtggtt gacagctacc tttatcgcaa cggaagcatc 1080 aatcaatccg attaaactag tgggtactct aacgtagtcg gtgctacgac ggaaaacggc 1140 gcacgcgaag cccgctacat cggtcaacaa gcctccacca actaccaaca cgggctcctt 1 T ctacgatca ttaagcacct 1380 cccatgtgct ctgtgatgat ccgctatacg gctggattct ggactgaaag ctccatctac 1440 ataagttagc aagtaatctc tctcctcgac agcacggact ctgaaatcat tttccgtggc 1500 agtaacggta gctgtaagat tcgtggtcat cactagttct agaaaactta gattagattg 1560 ctatgctttc tttctaatga gcaagaagta aaaaaagttg taatagaaca agaaaaatga 1620 aact gaaact tgagaaattg aagaccgttt attaacttaa atatcaatgg gaggtcatcg 1680 aaagagaaaa aaatcaaaaa aaaaattttc aagaaaaaga aacgtgataa aaatttttat 1740 tgcctttttc gacgaagaaa aagaaacgag gcggtctctt ttttcttttc caaaccttta 1800 gtacgggtaa ttaacgacac cctagaggaa gaaagagggg aaatttagta tgctgtgctt 1860 gggtgttttg aagtggtacg gcgatgcgcg gagtccgaga aaatctggaa gagtaaaaaa 1920 ggaggtagaaa cattttgaag ctatagctca gtttatcatt atcaatactc gccatttcaa 1980 agaatacgta aataattaat agtagtgatt ttcctaactt tatttagtca aaaaattagc 2040 cttttaattc tgctgtaacc c gtacatgcc caaaataggg ggcgggttac acagaatata 2100 taacatcgta ggtgtctggg tgaacagttt attcctggca tccactaaat ataatggagc 2160 ccgcttttta agctggcatc cagaaaaaaa aagaatccca gcaccaaaat attgttttct 2220 tcaccaac ca tcagttcata ggtccattct cttagcgcaa ctacagagaa caggggcaca 2280 aacaggcaaa aaacgggcac aacctcaatg gagtgatgca acctgcctgg agtaaatgat 2340 gacacaaggc aattgaccca cgcatgtatc tatctcattt tcttacacct tctattacct 2400 tctgctctct ctgatttgga aaaagctgaa aaaaaaggtt gaaaccagtt ccctgaaatt 2460 attcccctac ttgactaata agtata taaa gacggtaggt attgattgta attctgtaaa 2520 tctatttctt aaacttctta aattctactt ttatagttag tctttttttt agttttaaaa 2580 caccagaact tagtttcgac ggattctaga actagtgatg tctgcgccag gcgctccaag 2640 gccagttacc ccggt cgcac tgcttgcaga caccttggca agattagccg gcaggagtga 2700 tttgccccct gacgtcgtcg cagaattatc tgccgcggca gagttggcat ctggagtcga 2760 cggttacgct ggtcgttgta cgactcccga atcccctgca ctgagagaac tggcggccag 2820 aactgccgaa catgactggc gtggcagagg gggcggagtt gcgttggaac aggaaatgct 2880 gtccggtcac gtggagggac agctattaaa gacct tgctt agagccctaa gggcgagaag 2940 ggtattggaa atcggcatgt ttacagggta tagcgcgtta gccatggcgg aagaactacc 3000 cgatgatgga gtcgtcgtag cctgtgaact agaccccgac gttgcagctt ttgccagaga 3060 gagatttagt gctagcccgc actagggga a ggtagatgta cgtgtcggcc cggccttaga 3120 tacattggct ggattagtcg gtggtgaacc cttcgatttg gtatttgttg atgctgacaa 3180 ggcgggatac accgagtact tggcggtggt actagatgga ggtctattag cgcctcacgg 3240 acttgtatgc gtggataata cgctgatgca aggtaagact tacttgccgg gagccaggga 3300 cgctgttggt gccgctgttg acagatttaa tagacatgtc gctcagaggc ccgac ctatt tattt 3540 ttttatagtt atgttagtat taagaacgtt atttatattt caaatttttc tttttttct 3600 gtacagacgc gtgtacgcat gtaacattat actgaaaacc ttgcttgaga aggttttggg 3660 acgctcgaag gctttaattt gc 3682 <210> 74 <211> 4021 <212> DNA <213> Artificial Sequence <220> <223> donorDNA_GPD-Amir4257-CYC 1-TEF-Amir4256-GPM1 <400> 74 tattgctata acatgtcatg tcaccattaa ttaccactca ttccaacata ctgtccctga 60 cgaaaactgt ttatgcgagc gcaaaatgaa cctattcaat taataatact cctcaaattg 120 ctaccacgac aggctgaaaa aagatgtcga cgaataatgt aatcgtgtca aacaaacgtt 180 atcttgacta tatatag cta cttaatttga aataataaac tatacaagtc tatatcattg 240 atatattcag taagaaaaat ggaggggaaaa agaaatcatc aaatcattca ttcttcagac 300 ttatttcttt taacccctac gtgccgccgt tgtcacagcc tcagcgaaaa gttccgctag 360 tccgatacc t gcggctccag ccatcgtcgt gatcacggat gtcggagcga atgagcagta 420 caatcccgcc tctagaaacc agggcctgcc ctctggatcg attctgaagt caaataaact 480 atagtccctg caccccagcg cttcatggca tctaagtgct tgttcttgta cggcggccgt 540 aacagggtcg tcgtggtcca ctatccagct acgaccatca gcttttgcta ctagactcaa 600 gctgcccc ct ccatcgtccg ctaatttgtc cgccctaggt ctcacgcctg atggtaaggg 660 gtactcctcc agcggtaatg gtgtggggac acctgatcta accaaaacac cacaacgcac 720 ttcacgtcca ggcggtacat atctctccac cagggcacga cgtcttggac tacatgcgaa 780 tgcag catca agagcggcat ggtaatctgc cctatcgtga actaaagtca agccgtctga 840 attgtctgcg tcaactggtt taaccacgaa gggaggaggt agcggacacg gatcagcgct 900 agtgactaca cgtccctccg gcaccggaac ccctgctgcc gcgacaacgg ctctagtcat 960 ggctttatca gctcccagag ccataacatc tggcgggttt cctgggtagg gcacgcccaa 1020 tgcgtctaac aaggctctat at gttgtcat gcctggaggg caaaataact gaggcacagc 1080 aacatctaca gatctggatt cgattaaccc taaagcttca ggcagaccta atctgggtgc 1140 cgcagccagg gcttctggtg tcaaatctgc agggaatctc caccttccgt cgggagtgac 1200 atgagctact aagaactcat acctc gccgg gtctgctgcc gccccaaggc atccacgacc 1260 gtacacagtg ctcaactccg cgaaaaacgg gctcacaggg a ggtcatcga aagagaaaaa aatcaaaaaa 1500 aaaattttca agaaaaagaa acgtgataaa aatttttatt gcctttttcg acgaagaaaa 1560 agaaacgagg cggtctcttt tttcttttcc aaacctttag tacgggtaat taacgacacc 1620 ctagaggaag aaaga gggga aatttagtat gctgtgcttg ggtgttttga agtggtacgg 1680 cgatgcgcgg agtccgagaa aatctggaag agtaaaaaag gagtagaaac attttgaagc 1740 tatagctcag tttatcatta tcaatactcg ccatttcaaa gaatacgtaa ataattaata 1800 gtagtgattt tcctaacttt atttagtcaa aaaattagcc ttttaattct gctgtaaccc 1860 gtacatgccc aaaatagggg gcgggttaca cagaatatat aacatc gtag gtgtctgggt 1920 gaacagttta ttcctggcat ccactaaata taatggagcc cgctttttaa gctggcatcc 1980 agaaaaaaaa agaatcccag caccaaaata ttgttttctt caccaaccat cagttcatag 2040 gtccattctc ttagcgcaac tacagagaac aggggcacaa acaggcaaaa aacgggcaca 2100 acctcaatgg agtgatgcaa cctgcctgga gtaaatgatg acacaaggca attgacccac 2160 gcatgtatct atctcatttt cttacacctt ctattacctt ctgctctctc tgatttgggaa 2220 aaagctgaaa aaaaaggttg aaaccagttc cctgaaatta ttcccctact tgactaataa 2280 gtatataaag acggtaggta ttgattgtaa ttctgtaaat ctatttctta aacttcttaa 2340 attctacttt tatagttagt ctttttttta gttttaaaac accagaactt agtttcgacg 2400 gattctagaa ctagtgatgt ctgacgctgt cgcccctcag agagtcccag gcagggtgcc 2460 aggaagatca ggctctggca ggtgagtag gacgtag gt gccttagcat tactactggc 2520 ggcattaccg ttttcagcgg cgcttaccgc tgtagctgca cttagagctg ccgtcagacc 2580 ttccccagct agggcaacac ctagacgtcc gcgtacggta ttgctgacgg gtggtaaaat 2640 gacgaaagca ctacaccttg cgagggcatt tcacagagcc ggacatagag ttgtcctggt 2700 gggaaaccgcg cgttatcgtc taacagcgca tcgtttctct cgtgccgt tg acgccttcca 2760 cgtagttccg gattctgccg atcctcgtta cccgcaggct ttactggcaa tagtagaaag 2820 agaaggagta gatgtctttg tgcccgtatg ttcccctgcg tcatcagtcc acgatgccgc 2880 ggcagctccg ttgttagcta cacgttgc ga agtgttacac gcaggattag aagtggttga 2940 gcttcttgac gacaaacatc gtttcgctga gctgagcgcg gaactgggtc tacctgtacc 3000 acgttctcac aggattactg cgcctgagca ggtgctagat cttgggcttg acggtccgca 3060 cgttctaaag tccataccgt atgatcccgt caaccgttta gacttaaccc cgttgccaag 3120 acccacccca gaagccactc tagaattttt gaggggaaag gacgttagag atggacatcc 3180 ttgg gtacta caagaattcg tcgcaggaaa agagtattgt acgcattcca cagtccgtaa 3240 tggaagagtg gtagtgtatg gatgctgcga atcttccgct ttccaagtga attacgaaat 3300 ggtggataag ccggaaattg aaaggtgggt acgtgctttc gcggaagcca ccggt gtcac 3360 cggacaggta tcatttgatt ttattgagtc cgctgacgga cgtgctttag caatcgaatg 3420 caatccgaga actcattctg cgattacgat gtttcatgat catcctgatt tagcacgtgc 3480 gtacttggac ccggatgctc cccagataag gcctcttccc tccagtaggc ccacctattg 3540 gctatttcat gaattgtgga gggctctaag cgaaccgggt acagcaagag agagacttag 3600 agtcgttgcc agaggaa agg aagccgtatt cgactggtct gaccctctac cgttcctttt 3660 acttcaccat gtacacgtcc ccttattact acttagggcg ttagtaaggg gacaagactg 3720 ggtacgtgtc gactttaata tcggaaaact tgttgcgcct tcaggagact aagtcatgta 3780 attagttatg tcac gcttac attcacgccc tccccccaca tccgctctaa ccgaaaagga 3840 aggagttaga caacctgaag tctaggtccc tatttatttt tttatagtta tgttagtatt 3900 aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg tgtacgcatg 3960 taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg ctttaatttg 4020 c 4021 <210> 75 <211> 1000 <212> DNA <213> Artificial Sequence <220> <223> donorDNA_Disrupt of TAL1 <400> 75 aattaaatcg aaaacaagaa ccgaaacgcg aataaataat ttatttagat ggtgacaagt 60 gtataagtcc tcatcgggac agctacgatt tctctttcgg ttttggctga gctactggtt 120 gctgtgacgc agcggcatta gcgcggcgtt atgagctacc ctcgtggcct gaaagatggc 180 gggaataaag cggaactaaa aattactgac tgagccatat tgaggtcaat ttgtcaactc 240 gtcaagtcac gtttggtgga cggccccttt ccaacgaatc gtatatacta acatgcgcgc 300 gcttcctata tacacatata catatatata tatatatata tgtgg cgtg tatgtgtaca 360 cctgtattta atttccttac tcgcgggttt ttcttttttc tcaattcttg gcttcctctt 420 tctcgagtat ataatttttc aggtaaaatt tagtacgata gtaaaatact tctcgaactc 480 gtcacatata cgtgtacata ggaagtatct cggaaatatt aatttaggcc atgtccttat 540 gcacgtttct tttgatactt acgggtacat gtacacaagt atatctatat atataaatta 600 atgaaaatcc cctattata tatatgactt taacgagaca gaacagtttt ttatttttta 660 tcctatttga tgaatgatac agtttcttat tcacgtgtta tacccacacc aaatccaata 720 gcaataccgg ccatcacaat cactgtttcg gcagccccta agatcagaca aaacatccgg 780 aaccacctta aatcaacgtc c catatgaat ccttgcagca aagccgctcg gtgttcttta 840 ttcataagca acctcattaa tctatagtct gaaactaatt tccttcttga gctgcagcca 900 ataataaaaa ataatggcgg cactatacta caacatagga ggatcacaat gatgttttcg 960 atgctgtaaa cgtccctgaa tccattttga cctgaatcaa 1000 <210> 76 <211> 1000 < 212> DNA <213> Artificial Sequence <220> <223> donorDNA_Disrupt of PHO13 <400> 76 ggacaattta ttcatggcat cgtcattgat ataagtggct tgagctgtgg ataagaaaag 60 ccatatattt atataaacat ttagatatga ataggaagta gattgttcga cgcaactacc 120 cgttcaagaa gtataatggg gaatggtctc atcttccctc acaggatata gttctctgaa 180 gagatacata cgtttgtgta tactatgctt ctttat caac tcaagttttg tagaggaaga 240 cgttgaagat ggtgatgtga catcttact attctccagc acgttttcag tatttactta 300 atcgtatatt aatgacgtcc cttatctatt aactttccgg ttttctttt tttcggtgaa 360 tgttctttcc gttttagtga attttt caat tgtaattgac gcaatcggtt tataacaagc 420 agacataaat atcaagctcg agccaaatca caaaaaaagc cttatagctt gccctgacaa 480 agaatataca actcgggaaa aggagcaatg caaaatctag gggtagaatt actttttgaa 540 aaggaaaaat attcaggttt gttgttttta tgtaagttgt atgatttgat atacatatat 600 atatatatat aatatatatt gtacatgtgt ttttccgggg aagaatggat tatccggagg 660 tgtgaataaa atgatgacga ttataggttt gtgttgtaat atttagataa ctcaattctc 720 gccagtttga actccaacct agactggttc aaagcttttg ctatcaagat gagatatatg 780 gaattttcgt ctttatcgtc cacttgtatc ttt atttcct cgtcatcttc atcaatattg 840 attccattaa taatcgattt atcgctcaga gtgttgacca attcggtctt gttggggaag 900 aaatgttcca tttttcttcc caagttttga attctttcac aaacccaggc aattctttgt 960aagcctaatg cagcagaaga accctttaaa aaatggccca 1000

Claims (12)

A Saccharomyces cerevisiae strain into which a mycosporine-like amino acid biosynthetic gene derived from Actinocinema mirum has been introduced.
The Saccharomyces cerevisiae strain according to claim 1, wherein the mycosporine-like amino acid biosynthetic gene has the nucleotide sequence of SEQ ID NOs: 1 to 4.
The Saccharomyces cerevisiae strain according to claim 1, wherein the strain is additionally deficient in the TAL1 gene.
The Saccharomyces cerevisiae strain according to claim 1, wherein the strain is additionally introduced with a xylose reductase gene, a xylitol dehydrogenase gene, and a xylokinase gene.
The Saccharomyces cerevisiae strain according to claim 4, wherein the xylose reductase gene includes a NADPH-dependent xylose reductase gene and a NADH-dependent xylose reductase gene.
The Saccharomyces cerevisiae strain according to claim 1, wherein the mycosporine-like amino acid biosynthetic gene is introduced into the chromosome of the strain.
The method according to claim 6, wherein the mycosporine-like amino acid biosynthetic gene is introduced into the intergenic region (int#6) upstream of the ATG33 gene and the intergenic region (int#4) upstream of the ASF1 gene, saccharide Lomyces cerevisiae strains.
The method according to claim 2, wherein the genes of SEQ ID NOs: 1 and 4 are operably linked to the TEF promoter and the GPM1 terminator, and the genes of SEQ ID NOs: 2 and 3 are operably linked to the GPD promoter and the CYC1 terminator, Saccharomyces cerevisiae strains.
The method according to claim 1, Accession number is KCTC14827BP Saccharomyces cerevisiae strain.
A method for producing shinorine comprising culturing the Saccharomyces cerevisiae strain of any one of claims 1 to 9.
The method according to claim 10, wherein xylose and glucose are used as carbon sources.
The method according to claim 11, wherein the xylose is supplied while maintaining the glucose at a low concentration of 1 to 5 g/L.

Images