KR20230071462A - Genome-edited Brassica rapa plant with high temperature resistance, and method for manufacturing the same - Google Patents

Abstract

The present invention relates to a GIGANTEA gene-corrected cabbage with an improved high-temperature resistance, wherein a Brassica rapa GIGANTEA (BrGI) gene-corrected cabbage of the present invention increases a growth and development rate and thus increasing productivity of the cabbage, and is very useful due to enabling to improve a resistance to high-temperature stress and being enabled to prepare for climate change.

Description

Transgenic cabbage with improved high temperature resistance and method for manufacturing the same {Genome-edited Brassica rapa plant with high temperature resistance, and method for manufacturing the same}

The present invention relates to GIGANTEA genetically corrected Chinese cabbage with enhanced high-temperature resistance.

Chinese cabbage (Brassica rapa L.) is one of the four major vegetable crops in Korea, and is a vegetable traditionally used in Korea as a source of vitamins that are processed in the form of kimchi and tend to be insufficient in winter. Due to the recent rapid climate change, the productivity of Chinese cabbage crops such as Chinese cabbage decreases and the cultivation cost increases.

Various studies are being conducted to obtain new functions by studying the genes of Chinese cabbage and regulating the expression of genes that can improve the functionality of Chinese cabbage. Recently, transgenic cabbage varieties are produced by correcting the Chinese cabbage gene using gene editing technology.

The CRISPR/Cas9 system is a genome (genome) editing method called CRISPR (Clustered regularly interspaced short palindromic repeat, CRISPR) gene scissors, which cuts a guide RNA that specifically binds to a specific base sequence and a specific base sequence. It is composed of Cas9 (CRISPR associated protein 9) endonuclease enzyme, which serves as a scissor. Using this CRISPR/Cas9 system, it is possible to introduce plasmid DNA into cells or animals to knock-out the function of a specific gene.

Accordingly, the inventors of the present invention completed the present invention by confirming that a specific gene promotes the growth of Chinese cabbage using gRNA to increase productivity, increase sugar content, and decrease glucosinolate content.

(001) Korean registered patent KR 10-2113500 (002) Korean Registered Patent KR 10-2193277

The problem to be solved by the present invention is to provide a transgenic cabbage in which the BrGI (Brassica rapa GIGANTEA) gene is corrected.

Another object of the present invention is 1) preparing a guide RNA consisting of the nucleotide sequence of SEQ ID NO: 1; 2) preparing a gene correction vector containing the guide RNA prepared in step 1); and 3) to provide a method for producing a transgenic cabbage with improved functionality, comprising the step of correcting the BrGI (Brassica rapa GIGANTEA) gene with a composition containing the vector for gene correction.

In order to solve the above problems, the present invention provides a transgenic cabbage in which the BrGI (Brassica rapa GIGANTEA) gene is corrected.

The term "guide RNA (gRNA)" of the present invention is a type of RNA (ribonucleic acid), and refers to an RNA that recognizes and finds the DNA to be edited in genome editing that corrects a specific gene of a human or animal or plant. do.

Gene editing technology includes engineered nuclease, and CRISPR-Cas9 is a type of gene editing.

In the present invention, "CRISPR-Cas9" is designed to cleave a desired gene sequence using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system, known as the immune system of microorganisms, and includes the Cas9 protein as a fixed component and a variable component. As such, it contains a guide RNA specific to the target gene. At this time, the condition of the target gene is 23 bp in length and only needs to end with two guanine bases (GG). When the guide RNA recognizes the target gene, the Cas9 protein binds to the guide RNA and acts as a nuclease to recognize and cut two guanine bases (GG) located about 3 bp downstream of the target gene, resulting in DNA double-strand damage. break, DSB). The CRISPR-Cas9 system may further include tracrRNA, and the tracrRNA may form a complex with gRNA to form a structure recognized by Cas9.

The guide RNA targets a specific sequence (SEQ ID NO: 1) of the BrGI (Brassica rapa GIGANTEA) gene, and the BrGI (Brassica rapa GIGANTEA) may be composed of the nucleotide sequence of SEQ ID NO: 2.

The BrGI (Brassica rapa GIGANTEA) gene is a circadian rhythm gene, and is involved in a mechanism of resistance to environmental stress such as salt or dry stress. Therefore, controlling the expression of BrGI (Brassica rapa GIGANTEA) by gene editing of BrGI (Brassica rapa GIGANTEA) in plants can increase the growth of Chinese cabbage, increase the free sugar content, decrease the glucosinolate content, and improve high temperature tolerance, Specifically, stems of transgenic cabbages in which the BrGI (Brassica rapa GIGANTEA) gene was corrected were formed, resulting in vigorous growth due to an increase in bulb width, improved live weight, bulb width, total number of leaves, and knot length, and among free sugars, glucose or The content of fructose was increased, and the quality of cabbage was improved by reducing the content of glucosinolate, which represents the bitter taste of cabbage. In addition, the resistance to high temperature exposure was excellent.

In the present invention, "transformation" is a phenomenon in which DNA, which is a genetic material, is injected into living cells of a different lineage, and DNA enters the cell and changes hereditary character, and is also referred to as transformation, transformation, or transformation.

The present invention comprises the steps of 1) preparing a guide RNA consisting of the nucleotide sequence of SEQ ID NO: 1; 2) preparing a gene correction vector containing the guide RNA prepared in step 1); and 3) correcting the BrGI (Brassica rapa GIGANTEA) gene with a composition containing the vector for gene correction.

The vector for gene correction of the present invention refers to a vector for plant transformation into which a guide RNA specifically recognizing is introduced to correct the BrGI (Brassica rapa GIGANTEA) gene in the plant.

The vector according to the present invention may further include a nucleotide sequence encoding the cas9 protein.

The vector may be functionally linked to an expression control sequence so that the expression of a desired gene can be suppressed or the expression of a gene can be enhanced. For example, vectors include expression control elements such as promoters, operators, initiation codons, stop codons, polyadenylation signals, and enhancers, as well as signal sequences or leader sequences for membrane targeting or secretion, and can be prepared in various ways depending on the purpose. . In addition, vectors can include selectable markers, and vectors can replicate autonomously or integrate into host DNA.

The vector of the present invention can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cutting and linking can be performed using enzymes generally known in the art.

In the present invention, "transformation" of a plant with the vector may be performed by a transformation technique known to those skilled in the art. Specifically, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation method ( liposome-mediated method), in-planta transformation, vacuum infiltration method, floral meristem dipping method, and Agrobacteriaspraying method can be used. there is.

In the present invention, correction of the BrGI (Brassica rapa GIGANTEA) gene means inducing the insertion or deletion of the BrGI (Brassica rapa GIGANTEA) gene in a specific region by the guide RNA transduced into the plant. Specifically, the gene may be corrected using the cas9 protein of the gene editing system.

Therefore, the method of the present invention may include transducing a vector expressing the cas9 protein or additionally processing the cas9 protein into the plant.

In addition, the vector for gene correction of the present invention may further include a gene encoding the cas9 protein to simultaneously transduce the guide RNA and the cas9 protein.

The functionality may consist of high temperature resistance.

Chinese cabbage prepared by the manufacturing method of the present invention can simultaneously exhibit the effect of enhancing high temperature resistance.

The BrGI (Brassica rapa GIGANTEA) genetically corrected cabbage of the present invention is very useful because it can prepare for climate change by improving high-temperature stress resistance.

Figure 1 is a photograph confirming the growth of GIGANTEA gene correction cabbage.
Figure 2 is a graph showing the results of investigating the growth of GIGANTEA gene correction cabbage.
Figure 3 is a graph showing the method and results for assaying the high temperature resistance of GIGANTEA genetically corrected Chinese cabbage (T2).
Figure 4 is a graph showing the results of verifying the high temperature resistance of GIGANTEA genetically corrected cabbage (T3).
5 is a photograph showing the result of confirming survival after exposure to high temperature of GIGANTEA gene correction cabbage.
Figure 6 is a photograph confirming the sequence of the correction gene of g1-21-3 confirmed high temperature resistance.
Figure 7 is a photograph confirming the sequence of the correction gene of g1-21-4 confirmed high temperature resistance.
8 is a graph showing the results of analyzing sugar metabolism changes in GIGANTEA gene-edited cabbage (1 month and 3 months of growth (harvest period)).
Figure 9 is a graph showing the change in glucosinolate content of GIGANTEA genetically corrected Chinese cabbage (1 month and 3 months of growth (harvest)).

Hereinafter, the present invention will be described in detail.

<Example 1> BrGI (Brassica rapa GIGANTEA) genetically corrected Chinese cabbage

The base sequence of the GIGANTEA gene (SEQ ID NO: 2; GenBank HQ6159401) derived from Brassica rapa was analyzed, and the guide RNA region was selected to specifically recognize only the GIGANTEA gene and not recognize the rest of the genes. As a restriction, a gRNA (guide RNA) specific to the g1 region was prepared (Table 1).

In the Chinese cabbage protoplast treated with the gRNA of g1, T or A is inserted between the 32nd and 33rd nucleotide sequences of the Zizantia gene (SEQ ID NO: 2) to efficiently induce insertion or deletion of the Chinese cabbage-derived Zizantia gene to correct the gene. did

name sequence number order GI-g1 One 5′-TCATCTGAGAGGTGGACCGATGG-3′

A gRNA gene (SEQ ID NO: 1) specific for g1 was inserted into the pHAtC vector to prepare a Zizantia gene editing construct. pHAtC contains a hygromycin resistance gene (HygR) and a Cas9 gene. The prepared construct for gene correction was transformed into Chinese cabbage (Brassica rapa, pekinensis, spp Chiifu) to prepare a transgenic Chinese cabbage plant. Transgenic individuals into which the gene construct was inserted were selected using hygromycin. In addition, untransformed Chinese cabbage was used as a control.

The DNA of the transgenic Chinese cabbage plants (T0) was extracted, and transformation was confirmed through deep sequencing. It is the GI gene sequence mutation induction rate of the transgenic plants transduced with the g1 construct after sowing seeds (T1) of self-crossing of the transformed plants in a hygromycin medium and selecting surviving individuals. In the case of the g1 construct, the insertion-deletion (indel) induction rate was 99.48%, and it was confirmed that transduction of the g1 construct efficiently induced sequence mutation (genetic correction) of the GIGANTEA gene of Chinese cabbage (Table 2).

name target sequence total
count insertion deletion indel indel frequency genotype mutation pattern GI-g1_21 TCATCTGAGAGGTGGACCGATGG
(SEQ ID NO: 1) 4782 2125 2632 4757 99.48% mutant
(bi-allelic) 2 del 1 inch

<Example 2> Growth analysis of BrGI gene correction cabbage

In order to confirm the increase in growth of BrGI (Brassica rapa GIGANTEA) gene editing vector transformants, antibiotic (hygromycin) selection and gene editing confirmed g1-21-3 and g1-21-4 line cabbage seedlings can be assembled It was transplanted into pots of the same size and grown for 3 months, and then observed to see whether or not a block was formed. As a result, it was confirmed that a block was formed normally and growth was vigorous due to an increase in mouth width. GI gene-corrected cabbages showed normal formation and increased growth (FIG. 1).

<Example 3> Growth analysis of BrGI gene correction cabbage

Fresh weight, length (neck width, bulb weight), number of total leaves, and stem length of BrGI (Brassica rapa GIGANTEA) genetically corrected Chinese cabbage were investigated.

As a result, the live weight, mouth width, total leaf number, and stem length of the g1-21-3 and g1-21-4 lines were improved, so the growth improvement was confirmed through the quantification of the growth amount (FIG. 2).

<Example 4> High temperature resistance test of BrGI gene correction cabbage

In order to test the high temperature tolerance of BrGI (Brassica rapa GIGANTEA) gene correction vector transformants, cut leaf discs of 3-week-old Chinese cabbage seedlings, put them in 45 ° C water, take them out after 30 minutes, 1 hour, 2 hours, and 3 hours and elute (EC) ; Electron leakage) was measured.

As a result, as the EC of the BrGI genetically corrected cabbages (g1-21-3 and g1-21-4) gradually increased, it was judged that the plants were less injured by high temperature exposure, and the high temperature resistance increased (Figs. 3 and 4 ). It was confirmed that high-temperature resistance increased in both T2 (FIG. 3) and T3 (FIG. 4) posteriors of the corrected Chinese cabbage.

In addition, in order to confirm the tolerance of BrGI gene corrected cabbage after exposure to high temperatures, 3-week-old Chinese cabbage seedlings were exposed to 40 ° C (same day and night) for 1 week and transferred to 23 ° C (normal growth optimum temperature) to confirm growth recovery.

As a result, the growth of 4 individuals of the BrGI genetically corrected Chinese cabbage (g1-21-3 and g1-21-4), especially g1-21-3, was restored, whereas only one of the branches of the control group started to grow again. Growth was greatly atrophied, and in the case of g1-21-4, only one individual was recovered, but growth was very vigorous (FIG. 5).

In addition, in order to check whether the high-temperature-resistant Chinese cabbage has been gene-corrected, the gene-correction of the cabbages (g1-21-3 and g1-21-4) that survived and recovered after exposure to high temperature at 40 ° C (same day and night) was checked. did

As a result, the gene correction of the four individuals g1-21-3 was confirmed, and the correction sequence was also confirmed as homo or hetero in two types, confirming that it was the gene correction and correction sequence of the surviving Chinese cabbage after exposure to high temperature (FIG. 6). Genetic correction of one g1-21-4 individual whose growth was restored to normal after high temperature was confirmed (FIG. 7).

<Example 5> Analysis of sugar metabolism increase in BrGI gene-correction cabbage

The contents of sucrose, glucose, and fructose in BrGI (Brassica rapa GIGANTEA) gene correction vector transformants 1-21-3 and g1-21-4 at 1 month and 3 months (harvest period) were measured.

As a result, the glucose and fructose content significantly increased at the first month of growth, and the fructose content increased at the harvest period, so it was confirmed that the increase in the free sugar content at the beginning of the growth period led to an increase in the growth rate at the harvest period (FIG. 8).

<Example 6> Analysis of changes in glucosinolate content of BrGI genetically corrected Chinese cabbage

BrGI (Brassica rapa GIGANTEA) gene correction vector transformant The glucosinolate content of the g1-21-3 and g1-21-4 lines at 1 month and 3 months (harvest) was analyzed.

As a result, the content of total glucosinolates decreased from the beginning of growth, and in particular, the content of total glucosinolates at the harvesting period significantly decreased. Looking at each component, it decreased in the case of aliphatic types that give off a bitter taste (arrows in FIG. 4), The indole type and aromatic type, known as anticancer components, rather increased, improving the functional quality of Chinese cabbage, and the free sugar content of GI genetically corrected cabbage increased (FIG. 9).

<110> RURAL DEVELOPMENT ADMINISTRATION <120> Genome-edited Brassica rapa plant with improved productivity, increased metabolite content and high temperature resistance, and method for manufacturing the same <130> DHP21-377 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> artificial sequence <220> <223> GI-g1 <400> 1 tcatctgaga ggtggaccga tgg 23 <210> 2 <211> 3552 <212> DNA 213 <br> <400> 2 atgacatcgc ctacttcatc tgagaggtgg accgatggtc ttcagttctc ttccttgtta 60 tggtctcccc cacgtgaccc tcaacaacat aaggatcaag tcgttgctta tgtcgaatac 120 tttggtcagt tcacatcaga gcaattccct gatgatattg ctgagttggt ccgtaatcag 180 tatccctcaa ctgagaagcg acttttggat gatgtgttgg ctatgtttgt actccatcat 240 cctgagcatg gtcatgctgt catccttccg attatctcat gtctcatcga tggcactcta 300 gtgtacagca aggaagctca tcccttcgcc tctttcattt ctttagtttc cccaaatagt 360 gagaatgact attcagagca atgggctttg gcgtgcggag aaatcctacg catcttgact 420 cattacaacc gtcccattta caagacggag cagcaaaatg gagaaacgga gagcaaagct 480 tctactagtg ggtctcctac gctttcagag gctaaggctg tatcaccagg acagcatgaa 540 aggaaaccgc taaggccttt gtctccatgg atcagtgata tactactcgc tgctcccctt 600 ggtattagaa gtgactactt tcgttggtgt agtggtgtta tgggtaaata tgctgctgga 660 gagctcaagc cacctaccat tggtgagtgt ccatcacctc tggctactac aatgggttct 720 actcgaggat ctggtaaaca tcctcaatat atgccttcga caccaagatg ggcggttgct 780 aatggagctg gtgtcatact gagtgtttgt gatgatgaag tcgctcggta tgagactgct 840 acgttaacag cggttgctgt ccctgcactt ctgcttcctc ccccaacgac atccttagat 900 gagcatttag ttgctggcct tccagctctt gagccttatg cacgtttgtt tcacagatat 960 tatgcgattg caactccaag tgctactcag agacttcttc ttggactctt ggaagcacca 1020 ccgtcgtggg ctccagatgc acttgatgct gccgtacagc ttgtggagct tctccgagct 1080 gctgaagatt atgcatctgg tgtaaggcta ccaaggaact ggatgcattt gcacttcttg 1140 cgtgcaatag gaatcgccat gtctatgagg gcaggcgttg ctgctgacgc tgcagctgct 1200 ttacttttcc gcatactgtc gcagccggca ctgctttttc ctccgctaag ccaagctgag 1260 ggaggtagaaa tcaaacacgc tcctattggt ggctacggtt caaattacag aaagcagata 1320 gaagttcctg cagcagaagc aaccattgaa gccactgcac aaggaatagc ctcaatgctt 1380 tgtgctcacg gacctgaagt ggagtggagg atctgcacta tatgggaagc tgcctatgga 1440 ttgatccctt taaactcctc agccgttgat ctccctgaga tcattgtcgc caccccactg 1500 cagcctccca tcttgtcatg gaacctatac atcccactcc tcaaagtact cgagtatctt 1560 ccacgtggga gtccttccga agcatgcttg atgaagatat tcgtcgccac ggtggaaaca 1620 atcctcagca ggactttccc gccagagact tctatcagga aagctagagc gagtttagcc 1680 acgagatcat cagcgaccaa aaacctagct atggctgagc ttcgtgctat ggtccatgct 1740 ctcttcttgg aatcatgcgc tggcgtggag atagcgtcgc gcctgctttt cgttgtgttg 1800 actgtgtgtg ttagccatga agcgcagtct agtgggagca agagacggag aagcgaagaa 1860 gatgctactg cagaggagaa tcaagacaat caaactagta accgtaaaag taggaacgtc 1920 aagggacaag gacctgtggc ggcgtttgat tcgtacgttc tcgctgctgt ctgtgctctc 1980 gcctgtgagg ttcagctgta tcctatgatc tccggaggag ggaacttctc caactctgca 2040 gtggctgcaa ccattacaaa gtctgtgaag ataaacggtt catctaacga gtacggagct 2100 gggattgact ctgcaatcaa gcacacacgc cgcatcttag cgattctcga ggcgctcttt 2160 tcgttgaagc catcttctgt ggggactccg tggagttaca gctctagcga gatagttgct 2220 gcggccatgg tcgcagctca catctccgaa ctgttcagac gctcaaaggc cttgacgcat 2280 gccttgtctg gtttgatgag atgcaaatgg gacaaggaga ttcataagag agcgtcgtct 2340 ttgtataacc tcatcgatgt tcatagcaaa gttgtagcat ccatcgtcga caaagctgaa 2400 cccttagaag cgtaccttaa gaacgccccg gtccagaagg attcgctggc ttggtttaac 2460 tggaaacaac agaacaacac atcatcagca gcagggtttg gtacagcggc ggtgacgtcc 2520 acgtcacgta atgaaatggc tccgagagga ggtaaccata agtatgctag gcattcagat 2580 gaaggctcag ggagtagatc gtcatcagat aagggcatca aagatctgct gttggatgct 2640 tctgatctag cgaatttcct cacggctgat aggctagcag ggttttaccg tggtacgcaa 2700 gttcttttga ggtcgatact tgctgagaaa ccggagcttt ctttctccgt tgtttcgctg 2760 ttgtggcaca aactgatcgc ttctcctgag atccagccca cagccgaaag cacctctgct 2820 cagcaaggat ggagacaggt agttgatgca ctatgcaatg tggtatctgc aacgccagca 2880 aaagcagctg cagccgttgt tcttcaggct gagagagagt tgcagccttg gatagccaaa 2940 gatgatgaag aaggtcagaa aatgtggaaa ataaaccaaa ggatagtgaa agtgatggtg 3000 gaactcatga ggaatcatga caggcctgag tcactggtga ttctggcaag tgcatctgat 3060 ctccttctga gagcaactga tggaatgctt gttgatggag aagcttgtac attacctcaa 3120 cttgagctac ttgaagctac agcaagagca atacagccag tgttagcttg gggaccatct 3180 ggactagcag tagttgacgg cttatcaaat ctattgaagt gtcgtctgcc ggcaacaata 3240 cggtgcctct cacacccaag tgcacacgta cgtgccttga gcacatcagt actacgagac 3300 atcatgaacc aaagcggcat aaccaccacc aaggcaactc caaaaccgcc gccaacaata 3360 acaaccgaga agaacggaac ggacagcccg tcgtacaggt tcttcaacgc ggcggcaata 3420 gactggaaag cagacataca aaagtgtttg aactgggaag cgcacagctt gctgtcgacg 3480 acaatgccga cacagtttct tgacacggcg gctcgggaat taggatgtac catatcaatg 3540 tcgtcccaat aa 3552

Claims (6)

Transgenic cabbage whose BrGI (Brassica rapa GIGANTEA) gene has been corrected to improve high-temperature resistance. The transformed cabbage according to claim 1, wherein the free sugar is glucose or fructose. 1) preparing a guide RNA consisting of the nucleotide sequence of SEQ ID NO: 1;
2) preparing a gene correction vector containing the guide RNA prepared in step 1); and
3) A method for producing a transgenic cabbage with enhanced high temperature resistance comprising the step of correcting the BrGI (Brassica rapa GIGANTEA) gene with a composition containing the vector for gene correction. The method of claim 3, wherein the gene correction vector further comprises a base sequence encoding the cas9 protein. The method of claim 4, wherein the composition further comprises a cas9 protein or an expression vector containing a nucleotide sequence encoding the cas9 protein. The method of claim 3, wherein the functionality is made of high temperature resistance.

Images