KR20230086123A - OsHDSTART1 gene regulating plant ideotype and use thereof - Google Patents

Abstract

The present disclosure relates to the control of supermorphism in crop leaves through editing of the rice-derived OsHDSTART1 gene.
According to the present disclosure, the guide RNA for editing the OsHDSTART1 gene can induce mutations in the target sequence of the OsHDSTART1 gene to induce beneficial hypermorphic changes in leaves. In the transgenic rice containing the modified protein expressed by the edited OsHDSTART1 gene according to the present disclosure, the supermorphic variation in which the leaves are rolled outward is increased, so the water use efficiency of the leaves is increased and the soil water consumption is reduced, resulting in a water-poor environment. can increase survivability. Therefore, using the guide RNA for editing the OsHDSTART1 gene according to the present disclosure and the vector including the guide RNA and an endonuclease can contribute to the production of plants with improved drought tolerance.

Description

OsHDSTART1 gene regulating plant ideotype and use thereof {OsHDSTART1 gene regulating plant ideotype and use thereof}

The present disclosure relates to the control of supermorphism in crop leaves through rice-derived OsHDSTART1 gene correction.

Rice is an important crop that produces rice, which is eaten as a staple food by millions of people worldwide. Due to rising temperatures, drought, increased soil salinity, and increased pesticide-resistant pests and pathogens, the growing environment for rice is deteriorating year by year, making it increasingly difficult to predict changes in the growing environment.

The need to develop and breed rice varieties with excellent characteristics to cope with these environmental changes is continuously emerging, and as one of the means to solve this problem, genome/gene editing is attracting attention.

Genome/gene editing is a natural or artificial restriction enzyme that recognizes and cuts the desired nucleotide sequence and precisely cuts the nucleotide sequence of the desired genome or gene in animal or plant cells with higher efficiency than existing technologies. It is a molecular tool that corrects the genetic information on the genome. In fact, since the gene editing method was used for gene knock-out in Drosophila in 2002, it has been used in Arabidopsis, tobacco, rice, corn, etc. It has been shown that successful genetic manipulation can be induced in plants of

The CRISPR/Cas9 system, which has recently been attracting attention, is a genome (genome) editing tool using an enzyme called CRISPR (Clustered regularly interspaced short palindromic repeat, CRISPR) gene scissors, and a guide RNA that specifically binds to a specific base sequence. (guide RNA) and the Cas9 (CRISPR associated protein 9) endonuclease enzyme that acts as scissors to cut specific base sequences. Using this CRISPR/Cas9 system, it is possible to introduce a specific gene or mutation into the genome of a plant or animal, or to knock-out a specific gene or mutation.

However, due to problems such as the off-target effect, recently, in order to increase the success rate of the desired gene editing, the accuracy and correction efficiency of the target position of the gene to be corrected are high while changing the non-specific position. There is a growing demand for CRISPR/Cas9 systems that do not result in

On the other hand, the plant's ideotype, which refers to the structure of the above-ground part of the plant, affects the productivity of crops. Factors that determine plant sheath type include liver length (e.g. height of rice, length from ground surface to head of ear), length of head (e.g. length from ear neck to end of ear), number of ears per individual (e.g. effective number of ears) ), degree of tiller, about ten leaf blades, leaf angle, etc. (Guo, J., E.S. Seong, Y.H. Kim, H.J. Jo, J.H. Cho and M.H. Wang. 2007. Transformation of 'Ilmibyeo, using pCAMBIA 1300 and microstructural investigation of leaves.Korean J. Plant Res. 20(5):437-441.;Jin, J., W. Huang, J.P. Gao, J. Yang, M. Shi, M.Z. Zhu, D. Luo and H. X. Lin. 2008. Genetic control of rice plant architecture under domestication. Nature Genet. 40:1365-1369; Peng, S., G. S. Khush, P. Virk, Q. Tang and Z. Yingbin. to increase rice yield potential.Field Crops Research 108(1):32-38.).

Leaves, which are one of the factors that affect the sheath shape of rice, play various roles necessary for the growth of crops, such as photosynthesis, respiration, and evaporation. The efficiency of photosynthesis, respiration, and evaporation can vary depending on the width, length, erectness, and curl of the leaf, which is closely related to the growth of rice itself and the yield of ears, so the shape of the leaf is one of the important agricultural traits.

On the other hand, abscisic acid is a plant hormone that inhibits various processes occurring during plant growth, and is commonly abbreviated as ABA. As a type of sesquiterpene, it is abundantly present in dormant seeds, tree buds, and bulbs, and the content usually decreases during germination. When a plant lacks water, ABA is synthesized in large quantities, and the stomata are closed to suppress transpiration and protect plants from drying out.

In addition, it induces dormancy, and when plants are stressed, the content of ABA increases so that plants can withstand various stresses. In addition, it is speculated that the decrease in the synthesis of abscisic acid causes premature germination and wilting of plants. ABA also inhibits the increase of alpha-amylase mRNA by gibberellin in the aleurone layer. If abscisic acid synthesis can be controlled in plants, it has been expected that beneficial properties such as drying tolerance as well as control of plant expression such as suppression of early germination and regulation of seed dormancy will be possible.

Attempts have been made to improve the sheath shape of rice, but there is no case in which the relationship between the kinase-related gene that regulates ABA signaling in plants and the sheath variation of rice leaves has been identified and the characteristics of rice have been improved through this.

In this situation, there is still a need to develop improved rice varieties that exhibit excellent growth characteristics in response to climate environmental changes by inducing supermorphic changes in rice leaves through highly accurate and efficient genome or genetic manipulation techniques.

Republic of Korea Patent No. 10-2113500 (Announcement date: 2020.05.21)

The present disclosure was made to develop rice varieties having improved characteristics that have been required in the art as described above, and introduces mutations that increase water utilization efficiency by inducing beneficial supermorphic mutations related to leaves, more specifically leaf curling A gene editing tool for, more specifically, a guide RNA for editing a gene involved in leaf curl supermorphism in rice, a nucleic acid sequence encoding the guide RNA, and a nucleic acid sequence encoding an endonuclease. Rice leaves containing It is an object of the present invention to provide a vector for editing genes involved in supermorphism in curling, and a composition for editing genes involved in supermorphism in leaf curling in rice containing the vector as an active ingredient.

In addition, an object of the present disclosure is to provide transgenic plants with increased water utilization efficiency and/or reduced water loss rate compared to wild-type or unmodified plants by transducing the above-described vector or composition.

The present inventors continuously searched for genes that induce beneficial hypermorphic mutations related to rice leaves, and introduced mutations into the OsHDSTART1 gene encoding the OsHDSTART1 protein homeodomain. was induced and the water utilization efficiency was improved accordingly to complete the present invention.

The present disclosure provides a nucleic acid sequence encoding a guide RNA that specifically recognizes the OsHDSTART1 gene (or a specific gene region) encoding the homeodomain of the rice-derived OsHDSTART1 protein.

The guide RNA may induce a desired gene mutation, more specifically, an insertion/deletion (IN/DEL) mutation by specifically guiding an endonuclease to a target sequence of the rice-derived OsHDSTART1 gene.

The present disclosure provides a vector for gene editing of the OsHDSTART1 gene encoding the homeodomain of the OsHDSTART1 protein, including a nucleic acid sequence encoding the guide RNA and a nucleic acid sequence encoding the endonuclease.

The present disclosure provides an OsHDSTART1 gene editing composition comprising a nucleic acid encoding the guide RNA or the vector as an active ingredient.

The present disclosure provides a transgenic plant that expresses the modified OsHDSTART1 gene or modified OsHDSTART1 protein and/or exhibits the modified OsHDSTART1 protein activity by the vector or the composition.

The transgenic plant according to the present disclosure may be a plant in which leaf curling occurs outward, water utilization efficiency of the leaf is increased, and/or water loss rate is reduced.

The plant may be rice ( Orizaya stavia ).

The present disclosure provides seeds obtained from transgenic plants having a modified OsHDSTART1 gene or a modified OsHDSTART1 protein activity.

The present disclosure provides a vector comprising a nucleotide sequence identical to the nucleotide sequence of SEQ ID NO: 3 encoding guide RNA for editing the OsHDSTART1 gene or having at least 90% sequence identity with this nucleotide sequence and a nucleic acid sequence encoding an endonuclease. preparing; and inducing a mutation in a target sequence of the OsHDSTART1 gene by transducing the vector into the plant.

The present disclosure provides transgenic plants and seeds thereof, which exhibit a supermorphic transformation in which leaves are rolled outward and have increased water utilization efficiency, prepared by the above production method.

The guide RNA specific to the rice-derived OsHDSTART1 gene according to the present disclosure can induce a DNA sequence modification of the target sequence of the OsHDSTART1 gene to control leaf supermorphism. Specifically, a transgenic plant exhibiting a sheath variation of leaves according to the present disclosure exhibits a sheath variation in which leaves are rolled outward, increases the water use efficiency of the leaf, and can increase viability in an environment where water is scarce by reducing soil moisture consumption. Guide RNA according to the present disclosure, a vector containing a guide RNA and an endonuclease, a method for transforming a target plant according to the introduction of the vector, and a plant and its seed prepared by the method are resistant to climate change. improved, productivity can be expected to increase.

Figure 1 shows the distribution of SnRK2 phosphorylation motifs found in the amino acid sequences of 2,839 transcription factor genes.
Figure 2 shows the locations of major functional regions and phosphorylation motifs of OsHDSTART1 protein.
Figure 3 shows a schematic diagram of the OsHDSTART1 gene editing vector OsHDSTART1-pRGEB32.
Figure 4 shows colony PCR analysis of Agrobacteria (LBA4404) into which the OsHDSTART1-pRGEB32 vector was introduced.
Figure 5 shows the PCR assay of rice transformed by introducing the OsHDSTART1-pRGEB32 vector.
Figure 6 shows the nucleotide sequence mutation (A) and amino acid mutation (B) of the target gene of transgenic rice into which the OsHDSTART1-pRGEB32 vector was introduced.
7 shows the results of nucleotide sequence analysis of Os04g53540, a homologous gene of Os08g08820, in the transgenic rice homoline in which the OsHDSTART1 gene was edited.
Figure 8 shows the analysis of leaf morphology of transgenic rice homo lines in which the OsHDSTART1 gene was edited.
9 shows cytomorphological analysis through cross-sectional PI staining of OsHDSTART1 gene-edited transgenic rice leaves.
10 shows analysis of water utilization traits of OsHDSTART1 gene-edited transgenic rice and wild-type rice (Samkwang rice).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In general, the nomenclature used herein and the experimental methods described below are those well known and commonly used in the art.

As used herein, the term "OsHDSTART1 (Oryza sativa Homeo Domain StAR-related lipid Transfer 1)" is a polypeptide or protein derived from the Os08g08820 gene located on chromosome 8 of rice ( Oryza sativa ), and is an amino acid represented by SEQ ID NO: 2 can have a sequence. The nucleic acid sequence encoding OsHDSTART1 is represented by oshdstart1 and may have the nucleotide sequence represented by SEQ ID NO: 1. Homologues, analogs, etc., which have the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and exhibit substantially the same function, are included in the scope of the present disclosure.

The Os08g08820 gene according to the present disclosure was selected as a candidate based on its association with the SnRK2 kinase protein involved in ABA signaling, which is a hormone that induces stress tolerance in plants. Specifically, the present inventors found that among rice transcription factors containing a plurality of phosphorylation motifs (RXXS/T) recognized by SnRK2 protein kinase, for example, at least 3, at least 4, at least 5 or more, the homeopathic Os08g08820 gene was selected by searching for a gene having a domain, and as a result of inducing mutation at a specific position in the homeodomain encoded by this gene, the modified gene and the modified protein encoded by this gene were expressed, leading to the outer leaf It was confirmed that this drying induces supermorphic transformation, thereby increasing the water utilization efficiency. The present inventors named the Os08g08820 gene “OsHDSTART1” to highlight the structural features related to leaf curl supermorphism.

In one aspect, the present disclosure relates to a nucleic acid sequence encoding a guide RNA that specifically recognizes a gene encoding the homeodomain of OsHDSTART1 protein.

As used herein, the term "guide RNA (gRNA)" refers to a specific RNA that recognizes and finds a nucleic acid sequence encoding a specific gene in an animal or plant subject, complementary to all or part of a target DNA sequence. It refers to ribonucleic acid that binds and plays a role in guiding an endonuclease protein to a corresponding target DNA sequence. The guide RNA is a dual RNA comprising two RNAs, that is, crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or refers to a single chain guide RNA (sgRNA) form comprising a first region comprising a sequence complementary to a sequence in whole or in part with a sequence in the target DNA and a second region comprising a sequence interacting with an RNA-guided nuclease, , RNA-guided nucleases can be included in the scope of the present disclosure without limitation as long as they can have activity in the target sequence.

The guide RNA according to the present disclosure may preferably be in the form of a single-stranded guide RNA, but is not limited thereto, and may be appropriately selected depending on the type of endonuclease used or a microorganism derived therefrom. In addition, the guide RNA may be, for example, a single-stranded oligonucleotide transcribed from a plasmid template or in vitro or ex vivo , but is not limited thereto.

The nucleic acid sequence encoding the guide RNA according to the present disclosure is a gene (oshdstart1) encoding the OsHDSTART1 protein including the homeodomain of the OsHDSTART1 protein, more specifically, a gene encoding the OsHDSTART1 protein having the amino acid sequence represented by SEQ ID NO: 2 As long as it can be specifically recognized, it can be used without particular limitation.

In one embodiment, the guide RNA according to the present disclosure is, but is not limited to, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95 % of the nucleotide sequence of SEQ ID NO: 3 %, at least 96%, at least 97%, at least 98%, preferably 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%, most preferably It may represent 100% identity.

The OsHDSTART1 protein is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98%, preferably at least 90% of the amino acid sequence represented by SEQ ID NO: 2 Preferably it may represent 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%, most preferably 100% identity.

The gene encoding the OsHDSTART1 protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, preferably 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%, most preferably 100% identity. . In addition, the gene encoding the OsHDSTART1 protein may have a degenerate nucleotide sequence of SEQ ID NO: 1 according to codon degeneracy.

The nucleic acid sequence encoding the guide RNA according to the present disclosure specifically recognizes a target gene, specifically, a gene encoding the homeodomain of the OsHDSTART1 protein, and guides an endonuclease, such as Cas9, to the gene to generate the desired gene. Editing can be encouraged.

The guide RNA according to the present disclosure may induce insertion and/or deletion of a specific base at a target position of a gene encoding rice-derived OsHDSTART1 protein.

The nucleic acid sequence encoding the guide RNA according to the present disclosure is specific to the homeodomain of the OsHDSTART1 protein, specifically the homeodomain region in the amino acid sequence represented by SEQ ID NO: 2, specifically the region from amino acid positions 107 to 162 If it is recognized as an endonuclease and can induce a mutation, specifically a mutation that causes a supermorphic mutation in which the leaf is rolled outward, it can be used without limitation.

It will be apparent to those skilled in the art in light of the present disclosure to specify and select sequences of guide RNAs having these properties.

The nucleic acid sequence encoding the guide RNA according to the present disclosure does not specifically recognize other genes highly homologous to the Os08g08820 gene, specifically the Os04g53540 gene, and does not induce non-specific gene mutation in the homology region. can do.

In another aspect, the present disclosure provides a nucleic acid sequence encoding the above-described guide RNA, particularly a nucleic acid sequence represented by SEQ ID NO: 3, and an endonuclease, particularly a OsHDSTART1 protein comprising a nucleic acid sequence encoding Cas9. It relates to a vector for inducing editing of a gene (oshdstart1) encoding a domain.

As used herein, the term "genome/gene editing" refers to a technology capable of introducing target-directed mutations into genomic sequences of animal and plant cells, including human cells, and includes one or more by cutting DNA. A specific genome or gene can be knocked out or knocked in by deletion, insertion, substitution, etc. of nucleic acid molecules, or mutations can be introduced into non-coding DNA sequences that do not produce proteins. refers to the skills For the purpose of the present disclosure, the gene editing may be to introduce a desired mutation into a plant by using an endonuclease such as a Cas protein and a guide RNA.

As used herein, the term “endonuclease” or “endonuclease protein” refers to Cas9 (CRISPR associated protein 9), Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), It may be selected from the group consisting of zinc finger nuclease (ZFN) or a functional analogue thereof, and may preferably be a Cas9 protein, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from known databases such as GenBank of National Center for Biotechnology Information (NCBI). For example, the Cas9 protein is Streptococcus pyogenes derived Cas9 protein, Campylobacter jejuni derived Cas9 protein, Streptococcus thermophilus or Streptococcus aureus Cas9 protein derived from Neisseria meningitidis ( Neisseria meningitidis ) derived Cas9 protein, Pasteurella multocida ( Pasteurella multocida ) derived Cas9 protein, Francisella novicida ( Francisella novicida ) derived Cas9 protein, etc. It may be selected from the group, but is not limited thereto.

The Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double stranded DNA breaks. In order for the Cas9 protein to accurately bind to the nucleotide sequence of the target DNA and cut the DNA strand, a short nucleotide sequence consisting of three bases known as PAM (Protospacer Adjacent Motif) must exist near the nucleotide sequence of the target DNA, and the Cas9 protein must be present near the nucleotide sequence of the target DNA. Cut between the third and fourth base pairs from the sequence (NGG). The guide RNA and endonuclease protein of the present disclosure form a ribonucleic acid-protein complex and operate as RNA-Guided Engineered Nuclease (RGEN) in plants.

As used herein, the term "CRISPR/Cas9" or "CRISPR/Cas9 system" is a gene editing tool that cuts a desired gene sequence using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system known as the microbial immune system. , Edits genes by non-homologous end joining (NHEJ) mechanism that induces insertion-deletion (InDel) mutations due to incomplete repair in the DNA repair process by introducing double helix breaks at specific target positions in genes . It contains the Cas9 protein as a constitutive component and a guide RNA specific to the target gene as a variable component.

As used herein, the term "target gene" refers to a specific nucleic acid, such as DNA, to be edited within the genome or gene of a plant.

In one aspect of the present disclosure, the target gene is a gene encoding the homeodomain of the OsHDSTART1 protein (oshdstart1), more specifically, a gene encoding the OsHDSTART1 protein having the amino acid sequence represented by SEQ ID NO: 2, or substantially It may be a homologue or analog showing the same function, but is not limited thereto.

A vector according to the present disclosure is an expression system (expression cassette) capable of inserting a nucleic acid sequence (DNA) encoding a guide RNA specific to a target gene and a nucleic acid sequence encoding an endonuclease protein and expressing them in a host cell. It may be a vector such as a plasmid, including The plasmid contains elements for expression of the gene of interest, and may include a replication origin, a promoter, an operator, a transcription termination sequence, and the like, and into the genome of a plant. A suitable enzyme site (e.g., restriction enzyme site) for introduction and/or optionally a selectable marker to confirm successful introduction into plant cells and/or a ribosome binding site (RBS) for translation into a protein and / or transcription regulators and the like may be further included.

For example, the vector according to the present disclosure includes a nucleic acid sequence of SEQ ID NO: 3 encoding a guide RNA that specifically recognizes the OsHDSTART1 gene encoding the homeodomain of the OsHDSTART1 protein and Cas9 operably linked to the guide RNA. It may be a recombinant vector containing a nucleic acid sequence, particularly a recombinant binary vector for plant transformation that can be introduced into Agrobacterium tumefaciens (see FIG. 3).

In one embodiment, the vector for editing the target gene according to the present disclosure specifically recognizes the OsHDSTART1 gene encoding the homeodomain of the rice-derived OsHDSTART1 protein and introduces a guide RNA for inducing gene editing Plant transformation It may refer to a recombinant vector for

The vector according to the present disclosure may include a gene editing enzyme that introduces a mutation into the OsHDSTART1 gene encoding the homeodomain of the OsHDSTART1 protein, preferably a nucleotide sequence encoding the Cas9 protein.

Vectors according to the present disclosure can be prepared using genetic recombination techniques well known in the art.

In another embodiment, the present disclosure relates to a gene editing composition encoding OsHDSTART1 comprising the above-described vector as an active ingredient. Here, "OsHDSTART1 gene", "guide RNA", and "vector" are as described above.

The composition for editing the gene encoding OsHDSTART1 according to the present disclosure is a mutation that causes the outer leaf curl supermorphism of rice leaves at a specific position of the gene encoding OsHDSTART1, more specifically, the gene having the nucleotide sequence represented by SEQ ID NO: 1 can be introduced As a result, the mutation can improve the water utilization efficiency of rice.

In another embodiment, the present disclosure relates to a transgenic plant expressing a gene encoding a modified OsHDSTART1 comprising a mutation introduced by the vector or the composition. A transgenic plant according to the present disclosure may exhibit a supermorphism in which leaves are rolled outward.

As used herein, the term “transformation” refers to a phenomenon in which DNA, which is a genetic material, is injected into a living plant cell of a different lineage, and DNA enters the cell and changes hereditary character, transformation, transformation, or Also called transformation. Plant cells used for plant transformation may be any plant cells. The plant cell is a cultured cell, cultured tissue, cultured organ or whole plant tissue. The plant tissue is a differentiated or undifferentiated plant tissue, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, that is, single cells, protoplasts ( protoplast), bud and callus tissue. Thus, the plant tissue may be in planta or may be in organ culture, tissue culture or cell culture.

Transformation of the plant cell may be performed by a transformation technique known to those skilled in the art. Specifically, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation method ( liposome-mediated method), in-planta transformation, vacuum infiltration method, floral meristem dipping method, and Agrobacteria spraying method. can

As used herein, the term “plant” is understood to include not only mature plants but also plant cells, plant tissues, and seeds of plants that can develop into mature plants.

Vegetable crops including cabbage, Arabidopsis, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion or carrot according to the present disclosure; food crops including rice, wheat, barley, maize, soybean, potato, wheat, red beans, oats or sorghum; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut or rapeseed; fruit trees including apple trees, pear trees, jujube trees, peaches, kiwi trees, grapes, tangerines, persimmons, plums, apricots or bananas; flowers including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies or tulips; And any one selected from the group consisting of feed crops including ryegrass, red clover, orchard grass, alpha alpha, tall fescue or perennial ryegrass, specifically rice, wheat, barley, corn, soybean, potato, wheat, A food crop including red beans, oats or sorghum, more specifically rice ( Orizaya stavia ).

The transgenic plant according to the present disclosure may be a plant in which supermorphic transformation occurs in which leaves are rolled outward and water utilization efficiency of the leaves is increased.

In one embodiment of the present disclosure, transgenic rice in which the gene encoding OsHDSTART1 has been edited by the vector or gene editing composition according to the present disclosure shows a supermorphic variation in which leaves are rolled outward compared to wild type (Samkwang rice), which is a control. can The transgenic rice according to the present disclosure can express the modified OsHDSTART1 protein by introducing an A or T insertion mutation into the 445 bp position of the gene encoding the wild-type OsHDSTART1 protein and consequently generating a premature stop codon (FIG. 6 and FIG. 7). The OsHDSTART1 protein may exhibit an activity that promotes leaf curl outward compared to the wild-type protein.

In other words, the transformed rice according to the present disclosure may express a modified OsHDSTART1 protein that exhibits an activity to increase supermorphism in which leaves are rolled outward.

The modified OsHDSTART1 protein according to the present disclosure is limited as long as mutations are introduced into the wild-type OsHDSTART1 protein, more specifically, the homeodomain of the protein to increase supermorphism in which leaves are rolled outward and/or increase water utilization efficiency. without which it should be included within the scope of this disclosure.

The modified OsHDSTART1 protein according to the present disclosure has a single nucleotide insertion mutation introduced into the nucleotide sequence encoding the homeodomain region of the wild-type OsHDSTART1 protein, and has an abnormal phosphorylation motif compared to the wild-type protein. . Transgenic rice expressing a variant OsHDSTART1 protein exhibiting these characteristics should, without limitation, be included within the scope of the present disclosure.

In one embodiment, the modified OsHDSTART1 protein according to the present disclosure may be expressed from a gene having any one nucleotide sequence selected from SEQ ID NOs: 14, 16, 18, and 20, but is not limited thereto.

The transgenic rice according to the present disclosure may have an increased leaf rolling index (LRI) of 40% or more compared to wild-type rice. In addition, the transgenic rice according to the present disclosure may have a low soil water consumption compared to the wild type (control) in the condition of not watering for 3 days (None mode). The transgenic rice according to the present disclosure may have the characteristics of showing a low water loss rate and high water utilization efficiency while exhibiting a sheath variation in which the leaves are rolled outward.

In another embodiment, the present disclosure relates to the seed of the transgenic plant or the plant in which the gene has been edited.

The seed according to the present disclosure may be a hybrid seed obtained from offspring rice obtained by crossing OsHDSTART1 gene-edited transgenic rice with leaf curling as a mating pattern with rice to be introduced.

In another embodiment, the present disclosure provides a vector comprising a guide RNA for editing the OsHDSTART1 gene consisting of a nucleotide sequence identical to or at least 90% identical to the nucleotide sequence of SEQ ID NO: 3; and transducing the vector into the plant to induce a mutation at the target site of the OsHDSTART1 gene.

Hereinafter, the present disclosure will be described in more detail through examples. These examples are only for exemplifying the present disclosure, and it will be apparent to those skilled in the art that the scope of the present disclosure is not to be construed as being limited by these examples.

Example 1: OsHDSTART1 gene selection

SnRK2 protein kinase (SnRK2 kinase) is a key positive regulator that mediates ABA signal transduction. It is noted to play an important role in plant stress response, but the target transcription factor gene under the action is not known much. . SnRK2 protein kinase has been reported to phosphorylate serine/threonine residues of the RXXS/T amino acid motif.

First, the amino acid sequences of 2,839 rice transcription factor genes were extracted through an open DB, and a candidate transcription factor group including the SnRK2 protein kinase phosphorylation motif (RXXS/T) was searched (FIG. 1), among which the OsHDSTART1 (Os08g08820) gene was found. were selected (Fig. 2). Table 1 shows the nucleotide sequence and amino acid sequence of the OsHDSTART1 gene.

division order OsHDSTART1
base sequence
(SEQ ID NO: 1) atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60
ccgtcggcgc agctgcccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120
gcactccagc agcaatactt cgatcagatc ccggtgacga cgacggcggc ggcggacagc 180
ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240
aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cgaccaggac 300
cccaaccagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360
atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420
agggagctgg gtcttgaacc tctgcaggtt aaattctggt ttcagaacaa gcgcacacag 480
atgaagaacc agcacgagag gcacgagaac gcgcagctgc gggcggagaa cgacaagctg 540
cgcgcggaga acatgcgata caaggaggcc ctgagcagcg cgtcgtgccc caactgcggc 600
ggccccgccg ccctcggcga gatgtccttc gacgagcacc acctccgcgt cgagaacgcc 660
cgcctccgcg acgagatcga ccgcatctcc ggcatcgccg ccaagcacgt cggcaagccc 720
cccatcgtct ccttccccgt cctctcctcc ccgctcgccg tcgccgccgc ccgctcccct 780
ctcgacctcg ccggcgccta cggcgtcgtc acccccggcc tcgacatgtt cggcggcgcc 840
ggcgacctcc tccgcggcgt gcacccgctc gacgccgaca agcccatgat cgtggagctc 900
gccgtcgccg ccatggacga gctcgtccag atggcccagc tcgacgagcc gctctggtcg 960
tcgtcgtcgg agccggcggc ggcgttgctc gatgaggagg agtacgcgcg catgttcccg 1020
cgcggcctcg gccccaagca gtacggcctc aagtcggagg cgtcccgcca tggcgccgtc 1080
gtcatcatga cgcacagcaa cctcgtcgag atcctcatgg atgtgaatca attcgcgacg 1140
gtgttctcga gcatcgtgtc gagagcgtcc acgcacgagg tgttgtccac aggcgtggca 1200
ggcaactaca atggtgcact gcaagtgatg tcaatggagt ttcaagtgcc gtcgccgctg 1260
gtgccgacga gggagagcta tttcgtcagg tactgcaaga acaactccga cgggacatgg 1320
gccgtcgtcg atgtctctct cgacagcctc cgccccagcc ctgtccagaa atgccggcgc 1380
aggccgtctg gctgcctcat ccaagaaatg cccaatggct actccaaggt gacatgggtg 1440
gagcatgtgg aggtggacga cagctcggtg cacaacatct acaagccatt ggtgaactcc 1500
ggcctcgcat tcggcgcgaa acggtgggtc ggcacgctgg accggcaatg cgagcgcctc 1560
gccagcgcca tggccagcaa catccccaat ggcgaccttg gagtgattac aagcgtggag 1620
gggaggaaga gcatgttgaa gctggcggag aggatggtgg cgagcttctg cggcggcgtg 1680
acggcgtcgg tggcgcacca gtggacgacg ctgtcgggca gcggggcgga ggacgtgcgc 1740
gtcatgacga ggaagagcgt cgacgacccc ggcaggccac cgggcatcgt gctcaacgcc 1800
gccacctcct tctggctccc cgtccctccc gccgccgtct tcgacttcct ccgcgacgag 1860
acctctcgca gcgagtggga cattctgtcc aacggcggcg ccgtccaaga aatggctcac 1920
attgccaacg gccgtgacca tggcaactct gtctcgcttc ttcgtgtcaa tagtgcaaat 1980
tcaaaccaga gcaacatgct gatcctgcaa gagagctgca cggacgcgtc gggctcctac 2040
gtggtgtacg cgccggtgga catcgtggcg atgaacgtgg tgctcaacgg cggcgacccg 2100
gactacgtgg cgctgctgcc gtcggggttc gccatccttc ccgacgggcc gtcggggaac 2160
gcgcaggccg ccgtcgggga gaacggctcc ggctccggcg gggggtccct cctgacggtg 2220
gcgttccaga tcctcgtcga ctccgtgccg acggcgaagc tctcgctggg ctccgtcgcg 2280
acggtgaaca gcctcatcgc ctgcacggtg gagcgcatca aggccgccgt ctgcagggac 2340
agcaaccctc agtag OsHDSTART1
amino acid sequence
(SEQ ID NO: 2) MTPARRMPPV IGRNGVAYES PSAQLPLTQA DMLDSHHLQQ ALQQQYFDQI PVTTTAAADS 60
GDNMLHGRAD AGGLVDEFES KSCSENVDGA GDGLSGDDQD PNQRPRKKRY HRHTQHQIQE 120
MEAFFKECPH PDDKQRKELS RELGLEPLQV KFWFQNKRTQ MKNQHERHEN AQLRAENDKL 180
RAENMRYKEA LSSASCPNCG GPAALGEMSF DEHHLRVENA RLRDEIDRIS GIAAKHVGKP 240
PIVSFPVLSS PLAVAAARSP LDLAGAYGVV TPLDMFGGA GDLLRGVHPL DADKPMIVEL 300
AVAAMDELVQ MAQLDEPLWS SSSEPAAALL DEEEYARMFP RGLGPKQYGL KSEASRHGAV 360
VIMTHSNLVE ILMDVNQFAT VFSSIVSRAS THEVLSTGVA GNYNGALQVM SMEFQVPSPL 420
VPTRESYFVR YCKNNSDGTW AVVDVSLDSL RPSPVQKCRR RPSGCLIQEM PNGYSKVTWV 480
EHVEVDDSSV HNIYKPLVNS GLAFGAKRWV GTLDRQCERL ASAMASNIPN GDLGVITSVE 540
GRKSMLKLAE RMVASFCGGV TASVAHQWTT LSGSGAEDVR VMTRKSVDDP GRPPGIVLNA 600
ATSFWLPVPP AAVFDFLRDE TSRSEWDILS NGGAVQEMAH IANGRDHGNS VSLLRVNSAN 660
SNQSNMLILQ ESCTDASGSY VVYAPVDIVA MNVVLNGGDP DYVALLPSGF AILPDGPSGN 720
AQAAVGENGS GSGGGSLLTV AFQILVDSVP TAKLSLGSVA TVNSLIACTV ERIKAAVCRD 780
SNPQ*

Example 2: OsHDSTART1 sgRNA sequencing and gene editing vector construction

2-1. Determination of an effective guide RNA correcting the OsHDSTART1 gene

Determine the single guide RNA sequence (gRNA-OsHDSTART1) for the OsHDSTART1 gene in order to investigate the function of the OsHDSTART1 gene using CRISPR/Cas9 gene editing technology and to determine whether it can be used for the purpose of improving the disaster resistance traits of rice. did To this end, based on the nucleotide sequence encoding Homoeodomain (see Fig. 2), which is the main functional region of OsHDSTART1 protein, NGG type PAM was created using Cas-Designer of CRISPR RGEN Tools ( http://www.rgenome.net ), an open database. The following gRNA sequence (20 mer) having an off-target index of 0 and an out-of-frame score of 60% or more was determined.

SEQ ID NO: 3: gRNA-OsHDSTART1: 5'-AACCAGAATTTAACCTGCAG-3'

2-2. Production of binary vector for plant transformation with guide RNA introduced

To clone a single guide RNA into the pRGEB32 vector, a 381 bp primary PCR product was first amplified using the following pair of OsU3 primers (SEQ ID NO: 4: OsU3-F, SEQ ID NO: 5: OsU3-R).

Contains the following pRGEB32-HdIII primer (SEQ ID NO: 6) containing the Hind III restriction enzyme sequence and the following synthetic primer (SEQ ID NO: 7: gRNA-OsHDSTART1-R1) containing a single guide RNA sequence (SEQ ID NO: 3) of the OsHDSTART1 gene A guide RNA cassette was constructed. A second PCR was performed using the cassette. The second PCR product was digested with restriction enzymes Bsa I and Hind III, and then cloned into the Bsa I and Hind III sites of the pRGEB32 vector by infusion to construct an OsHDSTART1 gene editing vector (OsHDSTART1-pRGEB32 vector).

SEQ ID NO: 4: OsU3-F: 5'-aag gaa tct tta aac ata cga aca gat cac tta aag-3'

SEQ ID NO: 5: OsU3-R: 5'-tgc cac gga tca tct gca caa ctc-3'

SEQ ID NO: 6: pRGEB32-HdIII: 5'-gac atg att acg cc a ag ctt aag gaa tct tta aac ata c-3'

SEQ ID NO: 7: gRNA-OsHDSTART1-R1: 5'-att tct agc tct aaa ac c tgc agg tta aat tct ggt t tg cca cgg atc atc tgc-3'

Figure 3 shows a schematic diagram of the OsHDSTART1 gene editing vector OsHDSTART1-pRGEB32. Referring to FIG. 3, a strategy for introducing the synthesized DNA fragment having the nucleotide sequence of the target guide RNA and OsHDSTART1 gene into the final plant transformation vector is shown.

Example 3: Insertion of OsHDSTART1 gene editing vector Construction of transgenic rice and confirmation of introduction vector

3-1. Production of transgenic rice

The OsHDSTART1 gene editing vector completed in Example 2 was introduced into Agrobacteria LBA4404 and transformed, followed by colony PCR using the following pair of primers (SEQ ID NO: 8: OsHDSTART1-R2, SEQ ID NO: 9: M13R). Agrobacteria into which the vector was introduced were selected.

SEQ ID NO: 8: OsHDSTART1-R2: 5'-ctg cag gtt aaa ttc tgg tt-3'

SEQ ID NO: 9: M13R: 5'-gcg gat aac aat ttc aca cag - 3'

In order to verify the introduction of the correct vector, the OsHDSTART1-pRGEB32 vector was selected, and each plasmid of the Agrobacterium was isolated and analyzed by electrophoresis.

Figure 4 shows colony PCR analysis of Agrobacteria (LBA4404) into which the OsHDSTART1-pRGEB32 vector was introduced. Referring to FIG. 4 , the recognition sequence present in the guide RNA cassette introduced into the completed OsHDSTART1-pRGEB32 vector was confirmed to confirm that the correct vector was transformed into Agrobacteria.

The transformed agrobacteria were inoculated into callus derived from the seeds of Samgwang rice, and the transformed callus was selected in a medium containing 30 μg/ml of hygromycin, and then stems and roots were induced to produce transformed rice. did

3-2. OsHDSTART1 gene editing vector insertion test for transgenic rice

After isolating genomic DNA from the leaves of OsHDSTART1 transgenic rice, OsHDSTART1 gene, vector-specific primers consisting of the nucleotide sequences of SEQ ID NOs: 8 and 9 (OsHDSTART1-R2, M13R) and Cas9-specific primers (SEQ ID NO: 10 :Cas9F, SEQ ID NO: 11: PCR was performed using Cas9R).

SEQ ID NO: 10: Cas9F: 5'-gag aac atc gtg atc gaa at-3'

SEQ ID NO: 11: Cas9R: 5'-tct cgg cct tgg tcagat tg-3'

Figure 5 shows the PCR assay of 11 strains of OsHDSTART1-pRGEB32 vector-introduced transgenic rice T0 independent lines. Referring to FIG. 5 , a 494bp PCR product corresponding to the Cas9 gene of interest in 9 lines of transgenic rice was confirmed in a photograph obtained by electrophoresis of the region amplified by the Cas9 primer (Cas9F/R) (upper image of FIG. 5). In addition, the target 453 bp PCR product was confirmed in 10 lines of transgenic rice from the electrophoresis of the region amplified by the OsHDSTART1-pRGEB32 vector and OsHDSTART1 gRNA sequence-specific primers (OsHDSTART1-R2 / M13R) (bottom image in FIG. 5). . Therefore, it was confirmed that the gene editing vector was successfully introduced in about 81% of the transgenic rice.

Example 4: Insertion of OsHDSTART1 gene editing vector Identification of edited nucleotide sequence of transgenic rice

As a result of analyzing the nucleotide sequence variation at the gene editing site for 21 independent transgenic rice lines in which introduction of the OsHDSTART1 gene editing vector was confirmed by PCR, all homozygous or heterozygous bases at the target gene location It was confirmed that sequence mutation occurred. Therefore, when using the CRISPR/Cas9 editing vector containing the gRNA represented by SEQ ID NO: 3, it was confirmed that the editing efficiency of the target gene, OsHDSTART1, reached 100%.

Figure 6 shows the nucleotide sequence mutation (A) and amino acid mutation (B) of the target gene in 4 lines of transgenic rice into which the OsHDSTART1-pRGEB32 vector was introduced.

Referring to FIG. 6A, it can be confirmed that nucleotide sequence mutations of 4 independent homozygous transgenic rice lines (oshdstart1-m11, m25, m26, m27) in which a single nucleotide insertion occurred at the sgRNA position of the OsHDSTART1 gene occurred.

In addition, as a result of analyzing the amino acids encoded by the inserted mutation gene, as shown in FIG. 6B, the wild-type OsHDSTART1 protein was composed of 784 amino acids, whereas the OsHDSTART1 gene-edited transgenic rice with the insertion mutation generated a premature stop codon of 150 It was confirmed that only protein fragments composed of amino acids were produced.

Example 5: Guide RNA sequence recognition specificity assay

In order to verify the precise nucleotide sequence specificity of the guide RNA of the OsHDSTART1 gene, a blast search was performed based on the amino acid sequence of the OsHDSTART1 gene, and Os04g53540, which had the highest homology (85%) with Os08g08820, was identified. The Os04g53540 gene has a Homeodomain and a START domain at positions similar to those of Os08g08820 (Fig. 7A). Based on the gRNA sequence (20mer), Os04g53540 showed a difference of 4 nucleotide sequences from Os08g08820, and it was confirmed that the amino acid sequence was 100% identical (FIG. 7B).

In order to verify the exact nucleotide sequence specificity of the OsHDSTART1 guide RNA of interest, genomic DNA was isolated from the leaves of three homozygous lines (oshdstart1-m25, m26, m27) in which OsHDSTART1 gene editing was confirmed, and Os04g53540 gene-specific After amplifying the gRNA homology region by PCR using a pair of primers, the base sequence was analyzed by Sanger sequencing.

SEQ ID NO: 12: Os04g53540G-2453F: 5'-CGTTCACACGTTCAACCGAAC-3'

SEQ ID NO: 13: Os04g53540G-2872R: 5'-GCACTCGCTTGCAGGTTGC-3'

As a result, as shown in FIG. 7C, the Os04g53540 gene sequence was identical to that of WT, and thus, it was confirmed that the OsHDSTART1 gRNA for gene editing did not non-specifically recognize the location of the highly homologous Os04g53540 gene. This indicates that non-specific gene editing did not occur in the homology region.

Example 6: OsHDSTART1 Gene Edited Transgenic Rice Phenotype Analysis

6-1. Analysis of leaf morphology of transgenic rice

Figure 8 shows the analysis of leaf morphology of transgenic rice homo lines in which the OsHDSTART1 gene was edited. Referring to FIG. 8A, it was confirmed that the leaves of the transgenic rice in which the OsHDSTART1 gene was edited were outwardly curled compared to wild-type Samgwang rice as a control.

In addition, flag leaves of 4 independent homo lines ( oshdstart1 -m11, m25, m26, m27) of OsHDSTART1 gene-edited transgenic rice 10 days after planting were collected and comparative analysis of leaf fragments was performed. Referring to FIG. 8B, the same leaf curling characteristics were observed in 4 lines compared to wild-type Samgwang rice as a control.

In addition, as a result of measuring the leaf rolling index (LRI) of the flag leaf, as shown in FIG. 8C, the LRI of the wild-type Samgwang rice as a control was less than 10%, whereas the OsHDSTART1 gene-edited transgenic rice homo strain 4 The LRI of the species was more than 40%, confirming that leaf curling occurred.

6-2. Cytomorphological analysis of transgenic rice leaves

Cell morphological causes associated with leaf curl sheath shape of OsHDSTART1 gene-edited transgenic rice were investigated. 9 shows cytomorphological analysis through cross-sectional PI staining of OsHDSTART1 gene-edited transgenic rice leaves.

First, transverse sections of the flag leaf were stained with propidium iodide (PI) fluorescence and observed under a confocal microscope (FIG. 9A).

Then, in order to analyze the size and number of motor cells known to play an important role in leaf curling, confocal fluorescence images were acquired and the area was measured using the Image J program. Referring to FIG. 9B, the area of bulliform cells on both sides of the large vascular bundle (LV) No. 1 and No. 2, which are closest to the main vascular bundle (MV), was about approx. It can be seen that it is 1.2 times larger.

Therefore, it was confirmed that the outward curling characteristic of OsHDSTART1 gene-edited transgenic rice was associated with an increase in the area of bulliform cells.

6-3. Water consumption rate analysis of transgenic rice leaves

In order to investigate whether the OsHDSTART1 gene-edited transgenic rice can be used for the purpose of increasing drought tolerance or water utilization efficiency, water utilization traits were measured using a real-time automatic weighing device (DroughtSpotter) in a precise environmental control room where temperature and humidity are controlled. analyzed. Specifically, the change in the weight of the flowerpot over time was measured under the condition of not watering for 3 days (None mode), and the water loss rate during the day was compared.

9 shows analysis of water utilization traits of OsHDSTART1 gene-edited transgenic rice and wild Samkwang rice. Referring to FIG. 10A, first, the phenotypes of gene-edited transgenic rice and wild Samgwang rice were compared before treatment with no watering (None mode) stress.

Then, in the stress condition without watering, the change in real-time water use for each of the three temperatures was observed and presented as an average curve. Referring to FIG. 10B, it was confirmed that soil water consumption of the OsHDSTART1 gene-edited transgenic rice was lower than that of the control at 30°C and 38°C. Therefore, it was confirmed that the leaves of the transgenic rice plants in which supermorphism (leaf curling) occurred showed a low water loss rate and high water utilization efficiency.

Therefore, the transgenic rice having the leaf curl supermorph according to the present disclosure can increase the number of leaves participating in photosynthesis and the effective area of leaves per unit area, especially during dense cultivation, and significantly improve the water utilization efficiency of rice during the breeding process. Therefore, it is expected to have high adaptability to climate change such as drought.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> OsHDSTART1 gene regulating plant ideotype and use thereof <130> DP20210293 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 2355 <212> DNA < 213> Artificial Sequence <220> <223> OsHDSTART1 <400> 1 atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60 ccgtcggcgc agctgcccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120 gcactccagc agcaatactt cgatcagatc ccggtgacga cgacggcggc ggcggacagc 180 ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240 aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cg accagac 300 cccaaccagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360 atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420 agggagctgg gtcttgaacc tctgcaggtt aaattctggt ttcaga acaa gcgcacacag 480 atgaagaacc agcacgagag gcacgagaac gcgcagctgc gggcggagaa cgacaagctg 540 cgcgcggaga acatgcgata caaggaggcc ctgagcagcg cgtcgtgccc caactgcggc 600 ggccccgccg ccctcggcga gatgtccttc gac gagcacc acctccgcgt cgagaacgcc 660 cgcctccgcg acgagatcga ccgcatctcc ggcatcgccg ccaagcacgt cggcaagccc 720 cccatcgtct ccttccccgt cctctcctcc ccgctcgccg tcgccgccgc ccgctcccct 780 ctcgacctcg ccggcgccta cggcgtcgtc acccccggcc tcgacatgtt cggcggcgcc 840 ggcgacctcc tccgcggcgt gcacccgctc gacgccgaca agcccatgat cgtgg agctc 900 gccgtcgccg ccatggacga gctcgtccag atggcccagc tcgacgagcc gctctggtcg 960 tcgtcgtcgg agccggcggc ggcgttgctc gatgaggagg agtacgcgcg catgttcccg 1020 cgcggcctcg gccccaagca gtacggcctc aagtc ggagg cgtcccgcca tggcgccgtc 1080 gtcatcatga cgcacagcaa cctcgtcgag atcctcatgg atgtgaatca attcgcgacg 1140 gtgttctcga gcatcgtgtc gagagcgtcc acgcacgagg tgttgtccac aggcgtggca 1200 ggcaactaca atggtgcact gcaagtgatg tcaatggagt ttcaagtgcc gtcgccgctg 1260 gtgccgacga gggagagcta tttcgtcagg tactgcaaga acaactccga cgggacatgg 1320 gccgtc gtcg atgtctctct cgacagcctc cgccccagcc ctgtccagaa atgccggcgc 1380 aggccgtctg gctgcctcat ccaagaaatg cccaatggct actccaaggt gacatgggtg 1440 gagcatgtgg aggtggacga cagctcggtg cacaacatct acaagccatt ggtgaactcc 1500 ggcctc gcat tcggcgcgaa acggtgggtc ggcacgctgg accggcaatg cgagcgcctc 1560 gccagcgcca tggccagcaa catccccaat ggcgaccttg gagtgattac aagcgtggag 1620 gggaggaaga gcatgttgaa gctggcggag aggatggtgg cgagcttctg cggcggcgtg 1680 acggcgtcgg tggcgcacca gtggacgacg ctgtcgggca gcggggcgga ggacgtgcgc 1740 gtcatgacga g gaagagcgt cgacgacccc ggcaggccac cgggcatcgt gctcaacgcc 1800 gccacctcct tctggctccc cgtccctccc gccgccgtct tcgacttcct ccgcgacgag 1860 acctctcgca gcgagtggga cattctgtcc aacggcggcg ccgtccaaga aatggctcac 1920 att gccaacg gccgtgacca tggcaactct gtctcgcttc ttcgtgtcaa tagtgcaaat 1980 tcaaaccaga gcaacatgct gatcctgcaa gagagctgca cggacgcgtc gggctcctac 2040 gtggtgtacg cgccggtgga catcgtggcg atgaacgtgg tgctcaacgg cggcgacccg 2100 gactacgtgg cgctgctgcc gtcggggttc gccatccttc ccgacgggcc gtcggggaac 2160 gcgcaggccg ccgtcgggga gaacggctcc ggctccggcg gggggtccct cctgacggtg 2220 gcgttccaga tcctcgtcga ctccgtgccg acggcgaagc tctcgctggg ctccgtcgcg 2280 acggtgaaca gcctcatcgc ctgcacggtg gagcgcatca aggccgccgt ctgcagggac 2340 agcaaccctc agtag 2355 <210> 2 <211> 785 < 212> PRT <213> Artificial Sequence <220> <223> OsHDSTART1 <400> 2 Met Thr Pro Ala Arg Arg Met Pro Pro Val Ile Gly Arg Asn Gly Val 1 5 10 15 Ala Tyr Glu Ser Pro Ser Ala Gln Leu Pro Leu Thr Gln Ala Asp Met 20 25 30 Leu Asp Ser His His Leu Gln Gln Ala Leu Gln Gln Gln Tyr Phe Asp 35 40 45 Gln Ile Pro Val Thr Thr Thr Ala Ala Ala Asp Ser Gly Asp Asn Met 50 55 60 Leu His Gly Arg Ala Asp Ala Gly Gly Leu Val Asp Glu Phe Glu Ser 65 70 75 80 Lys Ser Cys Ser Glu Asn Val Asp Gly Ala Gly Asp Gly Leu Ser Gly 85 90 95 Asp Asp Gln Asp Pro Asn Gln Arg Pro Arg Lys Lys Arg Tyr His Arg 100 105 110 His Thr Gln His Gln Ile Gln Glu Met Glu Ala Phe Phe Lys Glu Cys 115 120 125 Pro His Pro Asp Asp Lys Gln Arg Lys Glu Leu Ser Arg Glu Leu Gly 130 135 140 Leu Glu Pro Leu Gln Val Lys Phe Trp Phe Gln Asn Lys Arg Thr Gln 145 150 155 160 Met Lys Asn Gln His Glu Arg His Glu Asn Ala Gln Leu Arg Ala Glu 165 170 175 Asn Asp Lys Leu Arg Ala Glu Asn Met Arg Tyr Lys Glu Ala Leu Ser 180 185 190 Ser Ala Ser Cys Pro Asn Cys Gly Gly Pro Ala Ala Leu Gly Glu Met 195 200 205 Ser Phe Asp Glu His His Leu Arg Val Glu Asn Ala Arg Leu Arg Asp 210 215 220 Glu Ile Asp Arg Ile Ser Gly Ile Ala Ala Lys His Val Gly Lys Pro 225 230 235 240 Pro Ile Val Ser Phe Pro Val Leu Ser Ser Pro Leu Ala Val Ala Ala 245 250 255 Ala Arg Ser Pro Leu Asp Leu Ala Gly Ala Tyr Gly Val Val Thr Pro 260 265 270 Gly Leu Asp Met Phe Gly Gly Ala Gly Asp Leu Leu Arg Gly Val His 275 280 285 Pro Leu Asp Ala Asp Lys Pro Met Ile Val Glu Leu Ala Val Ala Ala 290 295 300 Met Asp Glu Leu Val Gln Met Ala Gln Leu Asp Glu Pro Leu Trp Ser 305 310 315 320 Ser Ser Ser Glu Pro Ala Ala Ala Leu Leu Asp Glu Glu Glu Tyr Ala 325 330 335 Arg Met Phe Pro Arg Gly Leu Gly Pro Lys Gln Tyr Gly Leu Lys Ser 340 345 350 Glu Ala Ser Arg His Gly Ala Val Val Ile Met Thr His Ser Asn Leu 355 360 365 Val Glu Ile Leu Met Asp Val Asn Gln Phe Ala Thr Val Phe Ser Ser 370 375 380 Ile Val Ser Arg Ala Ser Thr His Glu Val Leu Ser Thr Gly Val Ala 385 390 395 400 Gly Asn Tyr Asn Gly Ala Leu Gln Val Met Ser Met Glu Phe Gln Val 405 410 415 Pro Ser Pro Leu Val Pro Thr Arg Glu Ser Tyr Phe Val Arg Tyr Cys 420 425 430 Lys Asn Asn Ser Asp Gly Thr Trp Ala Val Val Asp Val Ser Leu Asp 435 440 445 Ser Leu Arg Pro Ser Pro Val Gln Lys Cys Arg Arg Arg Pro Ser Gly 450 455 460 Cys Leu Ile Gln Glu Met Pro Asn Gly Tyr Ser Lys Val Thr Trp Val 465 470 475 480 Glu His Val Glu Val Asp Asp Ser Ser Val His Asn Ile Tyr Lys Pro 485 490 495 Leu Val Asn Ser Gly Leu Ala Phe Gly Ala Lys Arg Trp Val Gly Thr 500 505 510 Leu Asp Arg Gln Cys Glu Arg Leu Ala Ser Ala Met Ala Ser Asn Ile 515 520 525 Pro Asn Gly Asp Leu Gly Val Ile Thr Ser Val Glu Gly Arg Lys Ser 530 535 540 Met Leu Lys Leu Ala Glu Arg Met Val Ala Ser Phe Cys Gly Gly Val 545 550 555 560 Thr Ala Ser Val Ala His Gln Trp Thr Thr Leu Ser Gly Ser Gly Ala 565 570 575 Glu Asp Val Arg Val Met Thr Arg Lys Ser Val Asp Asp Pro Gly Arg 580 585 590 Pro Pro Gly Ile Val Leu Asn Ala Ala Thr Ser Phe Trp Leu Pro Val 595 600 605 Pro Pro Ala Ala Val Phe Asp Phe Leu Arg Asp Glu Thr Ser Arg Ser 610 615 620 Glu Trp Asp Ile Leu Ser Asn Gly Gly Ala Val Gln Glu Met Ala His 625 630 635 640 Ile Ala Asn Gly Arg Asp His Gly Asn Ser Val Ser Leu Leu Arg Val 645 650 655 Asn Ser Ala Asn Ser Asn Gln Ser Asn Met Leu Ile Leu Gln Glu Ser 660 665 670 Cys Thr Asp Ala Ser Gly Ser Tyr Val Val Val Tyr Ala Pro Val Asp Ile 675 680 685 Val Ala Met Asn Val Val Leu Asn Gly Gly Asp Pro Asp Tyr Val Ala 690 695 700 Leu Leu Pro Ser Gly Phe Ala Ile Leu Pro Asp Gly Pro Ser Gly Asn 705 710 715 720 Ala Gln Ala Ala Val Gly Glu Asn Gly Ser Gly Ser Gly Gly Gly Ser 725 730 735 Leu Leu Thr Val Ala Phe Gln Ile Leu Val Asp Ser Val Pro Thr Ala 740 745 750 Lys Leu Ser Leu Gly Ser Val Ala Thr Val Asn Ser Leu Ile Ala Cys 755 760 765 Thr Val Glu Arg Ile Lys Ala Ala Val Cys Arg Asp Ser Asn Pro Gln 770 775 780 *** 785 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> gRNA-OsHDSTART1 <400> 3 aaccagaatt taacctgcag 20 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> OsU3-F <400> 4 aaggaatctt taaacatacg aacagatcac ttaaag 36 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence < 220> <223> PRGEB32-HDIII <400> 5 TGCCACGACGACGACTGACA ACTC 24 <210> 6 <211> 39 <212> DNA <213> Artificial sequence <220> gatta CGCAAGCTT AaggaatctT TAAACATAC 39 <210> 7 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> gRNA-OsHDSTART1-R1 <400> 7 atttctagct ctaaaacctg caggttaaat tctggtttgc cacggatcat ctgc 54 <210> 8 <211> 20 <212 > DNA <213> Artificial Sequence <220> <223> OsHDSTART1-R2 <400> 8 ctgcaggtta aattctggtt 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> M13R <400> 9 gcggataaca atttcacaca g 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cas9F <400> 10 gagaacatcg tgatcgaaat 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cas9R <400> 11 tctcggcctt ggtcagattg 20 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Os04g53540G-2453F <400> 12 cgttcacacg ttcaaccga a c 21 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Os04g53540G-2872R <400> 13 gcactcgctt gcaggttgc 19 <210> 14 <211> 2356 <212> DNA <213> Artificial Sequence <220> <223> oshdstart1-m11 <400> 14 atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60 ccgtcggcgc agctgcccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120 gcactccagc agcaat actt cgatcagatc ccggtgacga cgacggcggc ggcggacagc 180 ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240 aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cgaccaggac 300 cccaaccagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360 atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420 agggagctgg gtcttgaacc tctgacaggt taaattctgg tttcagaaca agcgcacaca 480 gatgaaga ac cagcacgaga ggcacgagaa cgcgcagctg cgggcggaga acgacaagct 540 gcgcgcggag aacatgcgat acaaggaggc cctgagcagc gcgtcgtgcc ccaactgcgg 600 cggccccgcc gccctcggcg agatgtcctt cgacgagcac cacctccgcg tcgagaacg c 660 ccgcctccgc gacgagatcg accgcatctc cggcatcgcc gccaagcacg tcggcaagcc 720 ccccatcgtc tccttccccg tcctctcctc cccgctcgcc gtcgccgccg cccgctcccc 780 tctcgacctc gccggcgcct acggcgtcgt cacccccggc ctcgacatgt tcggcggcgc 840 cggcgacctc ctccgcggcg tgcacccgct cgacgccgac aagcccatga tcgtggagct 900 cgccgtc gcc gccatggacg agctcgtcca gatggcccag ctcgacgagc cgctctggtc 960 gtcgtcgtcg gagccggcgg cggcgttgct cgatgaggag gagtacgcgc gcatgttccc 1020 gcgcggcctc ggccccaagc agtacggcct caagtcggag gcgtcccgcc atgg cgccgt 1080 cgtcatcatg acgcacagca acctcgtcga gatcctcatg gatgtgaatc aattcgcgac 1140 ggtgttctcg agcatcgtgt cgagagcgtc cacgcacgag gtgttgtcca caggcgtggc 1200 aggcaactac aatggtgcac tgcaagtgat gtcaatggag tttcaagtgc cgtcgccgct 1260 ggtgccgacg agggagct atttcgtcag gtactgcaag aacaactccg acgggacatg 1320 ggccgtcgtc gatgtctctc tcgacagcct ccgccccagc cctgtccaga aatgccggcg 1380 caggccgtct ggctgcctca tccaagaaat gcccaatggc tactccaagg tgacatgggt 1440 ggagcatgtg gaggtggacg acagctcggt gcacaacatc tacaagccat tggtgaactc 1500 cggcctcg ca ttcggcgcga aacggtgggt cggcacgctg gaccggcaat gcgagcgcct 1560 cgccagcgcc atggccagca acatccccaa tggcgacctt ggagtgatta caagcgtgga 1620 ggggaggaag agcatgttga agctggcgga gaggatggtg gcgagcttct gcggcggcgt 1680 gacggcgtcg gtggcgcacc agtggacgac gctgtcgggc agcggggcgg aggacgtgcg 1740 cgtcatgacg aggaagagcg tcgacg accc cggcaggcca ccgggcatcg tgctcaacgc 1800 cgccacctcc ttctggctcc ccgtccctcc cgccgccgtc ttcgacttcc tccgcgacga 1860 gacctctcgc agcgagtggg acattctgtc caacggcggc gccgtccaag aaatggctca 1920 cattgcca ac ggccgtgacc atggcaactc tgtctcgctt cttcgtgtca atagtgcaaa 1980 ttcaaaccag agcaacatgc tgatcctgca agagagctgc acggacgcgt cgggctccta 2040 cgtggtgtac gcgccggtgg acatcgtggc gatgaacgtg gtgctcaacg gcggcgaccc 2100 ggactacgtg gcgctgctgc cgtcggggtt cgccatcctt cccgacgggc cgtcggggaa 2160 cgcgcaggcc gccgtcgggg agaacggctc cggctccggc ggggggtccc tcctgacggt 2220 ggcgttccag atcctcgtcg actccgtgcc gacggcgaag ctctcgctgg gctccgtcgc 2280 gacggtgaac agcctcatcg cctgcacggt ggagcgcatc aaggccgccg tctgcaggga 2340 cagcaaccct cagtag 2356 <210> 15 <211> 151 <212> PRT <213> Artificial Sequence <220> <223> oshdstart1-m11 <400> 15 Met Thr Pro Ala Arg Arg Met Pro Pro Val Ile Gly Arg Asn Gly Val 1 5 10 15 Ala Tyr Glu Ser Pro Ser Ala Gln Leu Pro Leu Thr Gln Ala Asp Met 20 25 30 Leu Asp Ser His His Leu Gln Gln Ala Leu Gln Gln Gln Tyr Phe Asp 35 40 45 Gln Ile Pro Val Thr Thr Thr Ala Ala Ala Asp Ser Gly Asp Asn Met 50 55 60 Leu His Gly Arg Ala Asp Ala Gly Gly Leu Val Asp Glu Phe Glu Ser 65 70 75 80 Lys Ser Cys Ser Glu Asn Val Asp Gly Ala Gly Asp Gly Leu Ser Gly 85 90 95 Asp Asp Gln Asp Pro Asn Gln Arg Pro Arg Lys Lys Arg Tyr His Arg 100 105 110 His Thr Gln His Gln Ile Gln Glu Met Glu Ala Phe Phe Lys Glu Cys 115 120 125 Pro His Pro Asp Asp Lys Gln Arg Lys Glu Leu Ser Arg Glu Leu Gly 130 135 140 Leu Glu Pro Leu Thr Gly ** * 145 150 <210> 16 <211> 2356 <212> DNA <213> Artificial Sequence <220> <223> oshdstart1-m25 <400> 16 atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60 ccgtcggcgc agctg cccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120 gcactccagc agcaatactt cgatcagatc ccggtgacga cgacggcggc ggcggacagc 180 ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240 aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cgaccaggac 300 cccaac cagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360 atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420 agggagctgg gtcttgaacc tctgacaggt taaattctgg tttcagaaca agcgca caca 480 gatgaagaac cagcacgaga ggcacgagaa cgcgcagctg cgggcggaga acgacaagct 540 gcgcgcggag aacatgcgat acaaggaggc cctgagcagc gcgtcgtgcc ccaactgcgg 600 cggccccgcc gccctcggcg agatgtcctt cgacgagcac cacctccgcg tcgagaacgc 660 ccgcctccgc gacgagatcg accgcatctc cggcatcgcc gccaagcacg tcggcaagcc 720 ccccatcgtc tccttccccg tcctctcctc cccgctcgcc gtcgccgccg cccgctcccc 780 tctcgacctc gccggcgcct acggcgtcgt cacccccggc ctcgacatgt tcggcggcgc 840 cggcgacctc ctccgcggcg tgcacccgct cgacgccgac aagcccatga tcgtggagct 90 0 cgccgtcgcc gccatggacg agctcgtcca gatggcccag ctcgacgagc cgctctggtc 960 gtcgtcgtcg gagccggcgg cggcgttgct cgatgaggag gagtacgcgc gcatgttccc 1020 gcgcggcctc ggccccaagc agtacggcct caagtcggag gcgtcccgcc atggcgccgt 1080 cgtcatcatg acgcacagca acctcgtcga gatcctcatg gatgtgaatc aattcgcgac 1140 ggtgttctcg agcatcgtgt cgagagcgtc cacg cacgag gtgttgtcca caggcgtggc 1200 aggcaactac aatggtgcac tgcaagtgat gtcaatggag tttcaagtgc cgtcgccgct 1260 ggtgccgacg agggagagct atttcgtcag gtactgcaag aacaactccg acgggacatg 1320 ggccgtcgtc gatgtct ctc tcgacagcct ccgccccagc cctgtccaga aatgccggcg 1380 caggccgtct ggctgcctca tccaagaaat gcccaatggc tactccaagg tgacatgggt 1440 ggagcatgtg gaggtggacg acagctcggt gcacaacatc tacaagccat tggtgaactc 1500 cggcctcgca ttcggcgcga aacggtgggt cggcacgctg gaccggcaat gcgagcgcct 1560 cgccagcgcc atggccagca acatccccaa tggcgacctt g gagtgatta caagcgtgga 1620 ggggaggaag agcatgttga agctggcgga gaggatggtg gcgagcttct gcggcggcgt 1680 gacggcgtcg gtggcgcacc agtggacgac gctgtcgggc agcggggcgg aggacgtgcg 1740 cgtcatgacg aggaagagcg tc gacgaccc cggcaggcca ccgggcatcg tgctcaacgc 1800 cgccacctcc ttctggctcc ccgtccctcc cgccgccgtc ttcgacttcc tccgcgacga 1860 gacctctcgc agcgagtggg acattctgtc caacggcggc gccgtccaag aaatggctca 1920 cattgccaac ggccgtgacc atggcaactc tgtctcgctt cttcgtgtca atagtgcaaa 1980 ttcaaaccag agcaacatgc tgatcctgca agagagctgc acggacgc gt cgggctccta 2040 cgtggtgtac gcgccggtgg acatcgtggc gatgaacgtg gtgctcaacg gcggcgaccc 2100 ggactacgtg gcgctgctgc cgtcggggtt cgccatcctt cccgacgggc cgtcggggaa 2160 cgcgcaggcc gccgtcgggg agaacggctc c ggctccggc ggggggtccc tcctgacggt 2220 ggcgttccag atcctcgtcg actccgtgcc gacggcgaag ctctcgctgg gctccgtcgc 2280 gacggtgaac agcctcatcg cctgcacggt ggagcgcatc aaggccgccg tctgcaggga 2340 cagcaaccct cagtag 2356 <210> 17 <211> 151 <212> PRT <213> Artificial Sequence <220> <223> oshdstart1-m25 <400> 17 Met Thr Pro Ala Arg Arg Met Pro Pro Val Ile Gly Arg Asn Gly Val 1 5 10 15 Ala Tyr Glu Ser Pro Ser Ala Gln Leu Pro Leu Thr Gln Ala Asp Met 20 25 30 Leu Asp Ser His His Leu Gln Gln Ala Leu Gln Gln Gln Tyr Phe Asp 35 40 45 Gln Ile Pro Val Thr Thr Thr Ala Ala Ala Asp Ser Gly Asp Asn Met 50 55 60 Leu His Gly Arg Ala Asp Ala Gly Gly Leu Val Asp Glu Phe Glu Ser 65 70 75 80 Lys Ser Cys Ser Glu Asn Val Asp Gly Ala Gly Asp Gly Leu Ser Gly 85 90 95 Asp Asp Gln Asp Pro Asn Gln Arg Pro Arg Lys Lys Arg Tyr His Arg 100 105 110 His Thr Gln His Gln Ile Gln Glu Met Glu Ala Phe Phe Lys Glu Cys 115 120 125 Pro His Pro Asp Asp Lys Gln Arg Lys Glu Leu Ser Arg Glu Leu Gly 130 135 140 Leu Glu Pro Leu Thr Gly *** 145 150 <210> 18 <211> 2356 <212> DNA <213> Artificial Sequence <220> <223> oshdstart1-m26 <400> 18 atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60 ccgtcggcgc agctgcccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120 gcactccagc agcaatactt cgatcagatc ccggtgacga cgac ggcggc ggcggacagc 180 ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240 aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cgaccaggac 300 cccaaccagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360 atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420 agggagctgg gtcttgaacc tctgtcaggt taaattctgg tttcagaaca agcgcacaca 480 gatgaagaac cagcacgaga ggcacgagaa cgcgcagctg cgggcggaga acgacaagct 540 gcgcgcggag aacatgcgat acaagga ggc cctgagcagc gcgtcgtgcc ccaactgcgg 600 cggccccgcc gccctcggcg agatgtcctt cgacgagcac cacctccgcg tcgagaacgc 660 ccgcctccgc gacgagatcg accgcatctc cggcatcgcc gccaagcacg tcggcaagcc 720 ccccatcgtc tccttccccg tcctctcctc cccgctcgcc gtcgccgccg cccgctcccc 780 tctcgacctc gccggcgcct acggcgtcgt cacccccggc ctcgacatgt tcggcggcgc 840 cggcgacctc ctccgcggcg tgcacccgct cgacgccgac aagcccatga tcgtggagct 900 cgccgtcgcc gccatggacg agctcgtcca gatggcccag ctcgacgagc cgctctggtc 960 gtcgtcgtcg gagccggcgg cggcgt tgct cgatgaggag gagtacgcgc gcatgttccc 1020 gcgcggcctc ggccccaagc agtacggcct caagtcggag gcgtcccgcc atggcgccgt 1080 cgtcatcatg acgcacagca acctcgtcga gatcctcatg gatgtgaatc aattcgcgac 1140 ggtgttctcg agcatcgtgt cgagagcgtc cacgcacgag gtgttgtcca caggcgtggc 1200 aggcaactac aatggtgcac tgcaagtgat gtcaatggag tttcaagtgc cgtcgccgct 1260 ggtgccgacg agggaggct atttcgtcag gtactgcaag aacaactccg acgggacatg 1320 ggccgtcgtc gatgtctctc tcgacagcct ccgccccagc cctgtccaga aatgccggcg 1380 caggccgtct ggctgcctca tccaagaaat gcccaatggc tactcc aagg tgacatgggt 1440 ggagcatgtg gaggtggacg acagctcggt gcacaacatc tacaagccat tggtgaactc 1500 cggcctcgca ttcggcgcga aacggtgggt cggcacgctg gaccggcaat gcgagcgcct 1560 cgccagcgcc atggccagca acatccccaa tggcgacctt ggagtgatta caagcgtgga 1620 ggggaggaag agcatgttga agctggcgga gaggatggtg gcgagcttct gcggcggcgt 1680 gacggcgtcg gtggcgcacc agtggacgac gctgtcgggc agcggggcgg aggacgtgcg 1740 cgtcatgacg aggaagagcg tcgacgaccc cggcaggcca ccgggcatcg tgctcaacgc 1800 cgccacctcc ttctggctcc ccgtccctcc cgccgccgtc tt tga tcctgca agagagctgc acggacgcgt cgggctccta 2040 cgtggtgtac gcgccggtgg acatcgtggc gatgaacgtg gtgctcaacg gcggcgaccc 2100 ggactacgtg gcgctgctgc cgtcggggtt cgccatcctt cccgacgggc cgtcggggaa 2160 cgcgcaggcc gccgtcgggg agaacggctc cggctccggc ggggggtccc tcctgacggt 2220 ggcgttccag atcctcgtcg actccgtgcc gacggcgaag ctctcgctgg gctccgt cgc 2280 gacggtgaac agcctcatcg cctgcacggt ggagcgcatc aaggccgccg tctgcaggga 2340 cagcaaccct cagtag 2356 <210> 19 <211> 151 <212> PRT <213> Artificial Sequence <220> <223> oshdstart1-m26 <400> 19 Met Thr Pro Ala Arg Arg Met Pro Pro Val Ile Gly Arg Asn Gly Val 1 5 10 15 Ala Tyr Glu Ser Pro Ser Ala Gln Leu Pro Leu Thr Gln Ala Asp Met 20 25 30 Leu Asp Ser His His Leu Gln Gln Ala Leu Gln Gln Gln Tyr Phe Asp 35 40 45 Gln Ile Pro Val Thr Thr Thr Ala Ala Ala Asp Ser Gly Asp Asn Met 50 55 60 Leu His Gly Arg Ala Asp Ala Gly Gly Leu Val Asp Glu Phe Glu Ser 65 70 75 80 Lys Ser Cys Ser Glu Asn Val Asp Gly Ala Gly Asp Gly Leu Ser Gly 85 90 95 Asp Asp Gln Asp Pro Asn Gln Arg Pro Arg Lys Lys Arg Tyr His Arg 100 105 110 His Thr Gln His Gln Ile Gln Glu Met Glu Ala Phe Phe Lys Glu Cys 115 120 125 Pro His Pro Asp Asp Lys Gln Arg Lys Glu Leu Ser Arg Glu Leu Gly 130 135 140 Leu Glu Pro Leu Ser Gly *** 145 150 <210> 20 <211 > 2356 <212> DNA <213> Artificial Sequence <220> <223> oshdstart1-m27 <400> 20 atgacgccgg cgaggcgcat gccgccggtg atcggccgga acggcgtggc gtacgaatcg 60 ccgtcggcgc agctgcccct cacccaggct gatatgctgg acagccatca tctgcagcaa 120 gcactccagc agcaatactt cgatcagatc ccggtgacga cgacggcggc ggcggacagc 180 ggcgacaaca tgctgcacgg ccgcgccgac gccggcgggc tggttgacga gttcgagagc 240 aagtcgtgca gcgagaacgt cgacggcgcc ggcgacggcc tctccggcga cgaccaggac 300 cccaaccagc ggccgcgcaa gaagcgttac caccgccata cccagcacca gatccaagag 360 atggaagctt tcttcaagga gtgcccgcac ccagacgaca agcagcgcaa ggagctgagc 420 agggagctgg gtcttgaacc tctgacaggt taaattctgg tttcagaaca agcgcacaca 480 gatgaagaac cagcacgaga ggcacgagaa cgcgcagctg cgggcggaga acgacaagct 540 gcgcgcggag aacatgcgat acaaggaggc cctgagcagc gcgtcgtgcc ccaactgcgg 600 cggccccgcc gccctcggcg agatgtcctt cgacgagcac cacctccgcg tcgagaacgc 660 ccgcctccgc gacgagatcg accgcatctc cggcatcgcc gccaagcacg tcggcaagcc 720 ccccatcgtc tccttccccg tcctctcctc cccgctcgcc gtcgccgccg cccgctcccc 780 tctcgacctc gccggcgcct acggcgtcgt cacccccggc ctcgacatgt tcggcggcgc 840 cggcgacctc ctccgcggcg tgcacccgct cgacgccgac aagcccatga tcgtggagct 900 cgccgtcgcc gccatggacg agctcgtcca gatggcccag ctcgacgagc cgctctggtc 960 gtcgtcgtcg gagccggc gg cggcgttgct cgatgaggag gagtacgcgc gcatgttccc 1020 gcgcggcctc ggccccaagc agtacggcct caagtcggag gcgtcccgcc atggcgccgt 1080 cgtcatcatg acgcacagca acctcgtcga gatcctcatg gatgtgaatc aattcgcgac 1140 ggtgttctcg agcatcgtgt cgagagcgtc cacgcacgag gtgttgtcca caggcgtggc 1200 aggcaactac aatggtgcac tgcaagtgat gtcaatggag tttcaagtg c cgtcgccgct 1260 ggtgccgacg agggaggct atttcgtcag gtactgcaag aacaactccg acgggacatg 1320 ggccgtcgtc gatgtctctc tcgacagcct ccgccccagc cctgtccaga aatgccggcg 1380 caggccgtct ggctgcctca tccaagaaat gccca atggc tactccaagg tgacatgggt 1440 ggagcatgtg gaggtggacg acagctcggt gcacaacatc tacaagccat tggtgaactc 1500 cggcctcgca ttcggcgcga aacggtgggt cggcacgctg gaccggcaat gcgagcgcct 1560 cgccagcgcc atggccagca acatccccaa tggcgacctt ggaggtgatta caagcgtgga 1620 ggggaggaag agcatgttga agctggcgga gaggatggtg gcgagcttct gcggcgg cgt 1680 gacggcgtcg gtggcgcacc agtggacgac gctgtcgggc agcggggcgg aggacgtgcg 1740 cgtcatgacg aggaagagcg tcgacgaccc cggcaggcca ccgggcatcg tgctcaacgc 1800 cgccacctcc ttctggctcc ccgtccctcc cgccg ccgtc ttcgacttcc tccgcgacga 1860 gacctctcgc agcgagtggg acattctgtc caacggcggc gccgtccaag aaatggctca 1920 cattgccaac ggccgtgacc atggcaactc tgtctcgctt cttcgtgtca atagtgcaaa 1980 ttcaaaccag agcaacatgc tgatcctgca agagagctgc acggacgcgt cgggctccta 2040 cgtggtgtac gcgccggtgg acatcgtggc gatgaacgtg gtgctcaacg gcggcgaccc 210 0 ggactacgtg gcgctgctgc cgtcggggtt cgccatcctt cccgacgggc cgtcgggggaa 2160 cgcgcaggcc gccgtcgggg agaacggctc cggctccggc ggggggtccc tcctgacggt 2220 ggcgttccag atcctcgtcg actccgtgcc gacggcgaag ctctcg ctgg gctccgtcgc 2280 gacggtgaac agcctcatcg cctgcacggt ggagcgcatc aaggccgccg tctgcaggga 2340 cagcaaccct cagtag 2356 <210> 21 <211> 151 <212> PRT <213> Artificial Sequence <220> <223> oshdstart1-m27 <400> 21 Met Thr Pro Ala Arg Arg Met Pro Val Ile Gly Arg Asn Gly Val 1 5 10 15 Ala Tyr Glu Ser Pro Ser Ala Gln Leu Pro Leu Thr Gln Ala Asp Met 20 25 30 Leu Asp Ser His Leu Gln Gln Ala Leu Gln Gln Gln Tyr Phe Asp 35 40 45 Gln Ile Pro Val Thr Thr Thr Thr Ala Ala Ala Asp Ser Gly Asp Asn Met 50 55 60 Leu His Gly Arg Ala Asp Ala Gly Gly Leu Val Asp Glu Phe Glu Ser 65 70 75 80 Lys Ser Cys Ser Glu Asn Val Asp Gly Ala Gly Asp Gly Leu Ser Gly 85 90 95 Asp Asp Gln Asp Pro Asn Gln Arg Pro Arg Lys Lys Arg Tyr His Arg 100 105 110 His Thr Gln His Gln Ile Gln Glu Met Glu Ala Phe Phe Lys Glu Cys 115 120 125 Pro His Pro Asp Asp Lys Gln Arg Lys Glu Leu Ser Arg Glu Leu Gly 130 135 140Leu Glu Pro Leu Thr Gly*** 145 150

Claims (13)

A guide RNA comprising the nucleotide sequence of SEQ ID NO: 3 for inducing plant gene editing that specifically recognizes the OsHDSTART1 gene encoding the homeodomain of the OsHDSTART1 protein. According to claim 1,
The guide RNA guides the endonuclease to the target site of the OsHDSTART1 gene to induce insertion mutation of a single base. According to claim 1,
The OsHDSTART1 protein consists of the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO: 2, guide RNA. Homeo of OsHDSTART1 protein comprising a nucleic acid sequence consisting of the nucleotide sequence of SEQ ID NO: 3 encoding guide RNA specifically recognizing OsHDSTART1 gene encoding the homeodomain of OsHDSTART1 protein and a nucleic acid sequence encoding endonuclease A vector for gene editing of the OsHDSTART1 gene encoding the domain. An OsHDSTART1 gene editing composition comprising the guide RNA of claim 1 or the vector of claim 4 as an active ingredient. A transgenic plant transformed with the vector of claim 4 or the composition of claim 5. According to claim 6,
Compared to the wild type, a transgenic plant in which the supermorphic variation in which the leaves are rolled outward is increased and the water utilization efficiency of the leaves is increased. Transformed rice expressing a modified OsHDSTART1 protein that exhibits activity to enhance outward leaf curl supermorphism. According to claim 8,
The modified OsHDSTART1 protein is expressed from a gene having any one nucleotide sequence selected from SEQ ID NOs: 14, 16, 18 and 20, transformed rice. According to claim 6,
Rice ( Orizaya stavia ), transgenic plants. A transformed seed obtained from a transgenic plant according to claim 6 or a plant progeny thereof. Homeo of OsHDSTART1 protein comprising a nucleic acid sequence consisting of the nucleotide sequence of SEQ ID NO: 3 encoding guide RNA specifically recognizing OsHDSTART1 gene encoding the homeodomain of OsHDSTART1 protein and a nucleic acid sequence encoding endonuclease Preparing a vector for gene editing of the OsHDSTART1 gene encoding the domain; and
A method for producing a transgenic plant comprising the step of inducing a mutation in the OsHDSTART1 gene by transducing the vector into the plant. The transgenic rice produced by the production method of claim 12, wherein the supermorphic variation in which the leaves are rolled outward is increased and the water utilization efficiency of the leaves is increased compared to the wild type.

Images