KR20230040663A - Marker composition for identification of cucurbita spp. and identification method using the same - Google Patents

Abstract

The present invention relates to a SNP marker composition for identifying pumpkin varieties, a composition for identifying the pumpkin varieties comprising an agent capable of detecting or amplifying the marker, a kit for identifying the pumpkin varieties and a method for identifying the pumpkin varieties comprising the composition for identification. Using the SNP marker for pumpkin variety identification according to the present invention, the variety identification can be performed quickly and accurately in the early stage of pumpkin cultivation, and integrated classification can be used as the marker for the assurance of the pumpkin varieties.

Description

Marker composition for pumpkin variety identification and identification method using the same {MARKER COMPOSITION FOR IDENTIFICATION OF CUCURBITA SPP. AND IDENTIFICATION METHOD USING THE SAME}

The present invention relates to a SNP marker composition for identifying pumpkin varieties, a composition for identifying pumpkin varieties comprising an agent capable of detecting or amplifying the marker, a kit for identifying pumpkin varieties including the composition for identification, and a method for identifying pumpkin varieties .

In most of the crops used for breeding, a large amount of genetic resources are collected every year, and it is necessary to classify the collected genetic resources within species or within subspecies for accurate management of genetic resources, and to promptly identify the varieties to be applied for as new varieties. very important for protection. In addition, as Korea joined the International Union for the Protection of New Varieties of Plants (UPOV) and the Seed Industry Act came into force, the need to scientifically classify domestic and foreign agricultural product varieties to protect the rights of breeders and increase farm household income has increased. is emerging

Currently, breed distinction is made by biochemical characteristics such as phenotype-oriented morphological traits and enzyme or protein mutations applying the traditional Mendel's law. However, this method has a low frequency of mutation, has limitations in application to all crops, and can lead to different results depending on the producer's cultivation conditions, making it difficult to accurately identify varieties. being studied

Pumpkin ( Cucurbita spp. ) is a climbing plant of the Cucurbitaceae family and is native to the tropics and South America.

The domestic pumpkin seed market is expected to continue growing in the future, increasing by more than 1.5 times compared to 2014 to 11.7 billion won in 2018. As the economic importance of pumpkins increases, the cultivation of new varieties is being actively carried out, and the importance of strengthening intellectual property right to protect varieties and blocking the development of similar cloned varieties is being emphasized.

However, pumpkin species can be identified by their external form in the cultivation environment, but some species are difficult to accurately classify at an early stage, so an integrated classification is required through the cultivation process. analysis should be supported.

Under this background, the present inventors made diligent research efforts to develop markers for classifying Cucurbita species, and as a result, Cucurbita species were classified by Cucurbita species-specific SNP sequences of rbc L, psb A- trnH and mat K genes. The present invention was completed by confirming that it is possible.

Republic of Korea Patent No. 10-1883117

The present invention aims to solve the above problems and other problems related thereto.

An exemplary object of the present invention is a polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the base sequence represented by SEQ ID NOs: 1 to 5, or a polynucleotide complementary thereto ; A polynucleotide comprising a SNP located at the 2nd, 107th, 113th and 260th bases of the nucleotide sequence represented by SEQ ID NOs: 6 to 10 or a polynucleotide complementary thereto; And a polynucleotide comprising a SNP located at the 30th, 37th, 38th, 51st, 53rd and 160th bases of the nucleotide sequence represented by SEQ ID NOs: 11 to 15, or a polynucleotide complementary thereto selected from the group consisting of ,

To provide a SNP marker composition for cultivar identification of pumpkin ( Cucurvita spp.) comprising a polynucleotide consisting of 10 to 500 consecutive bases or a nucleotide complementary thereto.

Another exemplary object of the present invention is to provide a composition for identifying pumpkin varieties, including an agent capable of detecting or amplifying the SNP marker.

Another exemplary object of the present invention is to provide a kit for identifying pumpkin varieties including the composition for identifying pumpkin varieties.

Another exemplary object of the present invention is to provide a pumpkin variety identification method comprising the following steps.

(a) isolating nucleic acids from the amber sample;

(b) detecting the SNP marker from the isolated nucleic acid.

The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the problems mentioned above, and another problem not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not to be construed as being limited by the specific descriptions described below.

As one aspect for achieving the above object, the present invention provides a polynucleotide comprising a single nucleotide polymorphism (SNP) located at 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NOs: 1 to 5, or As its complementary polynucleotide, it provides a SNP marker composition for cultivar identification of pumpkin ( Cucurvita spp.) comprising a polynucleotide consisting of 10 to 500 consecutive bases or its complementary nucleotide.

In addition, the present invention is a polynucleotide comprising a SNP located at the 2nd, 107th, 113th and 260th bases of the nucleotide sequence represented by SEQ ID NOs: 6 to 10 or a polynucleotide complementary thereto, wherein 10 to 500 consecutive Provided is a SNP marker composition for cultivar identification of amber ( Cucurvita spp.) comprising a polynucleotide consisting of a base or a nucleotide complementary thereto.

In addition, the present invention is a polynucleotide comprising a SNP located at the 30th, 37th, 38th, 51st, 53rd and 160th bases of the nucleotide sequence represented by SEQ ID NOs: 11 to 15, or a polynucleotide complementary thereto, Provided is a SNP marker composition for cultivar identification of pumpkin ( Cucurvita spp.) comprising a polynucleotide consisting of 10 to 500 consecutive bases or a nucleotide complementary thereto.

The term "SNP marker" of the present invention means a base pair of a single base polymorphism allele on a DNA sequence used to identify an individual or species. Since SNPs have a relatively high frequency, are stable, and are distributed throughout the genome, resulting in genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers usually include phenotypic changes accompanying single nucleotide polymorphisms, but may not in some cases.

The term "polymorphism" of the present invention refers to the case where two or more alleles exist in one locus, and among the polymorphic sites, only a single base differs depending on the individual in a single base. is called polymorphism. Preferred polymorphic markers have two or more alleles that exhibit a frequency of greater than 1%, more preferably greater than 5% or 10% in a selected population.

The term "allele" of the present invention refers to several types of one gene present at the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

In the present invention, pumpkin is a vine plant of the Cucurbitaceae family, and its fruit is referred to as pumpkin . ) and green pumpkin ( Cucurbita argyrosperma ), but may be at least one selected from the group consisting of, but is not limited thereto.

In the present invention, the 399th, 552nd, 857th, and 859th bases of the nucleotide sequence represented by SEQ ID NOs: 1 to 5, respectively, the 399th base is A or G, and the 552nd base is T or C, The 857th base may be G or A, and the 859th base may be G or T.

In the present invention, the polynucleotide containing a single nucleotide polymorphism (SNP) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NOs: 1 to 5,

It may further include an SNP located at any one or more bases of positions 312, 807, 825, 903, 919, and 920.

In the present invention, in the 312th, 807th, 825th, 903rd, 919th, and 920th bases, respectively, the 312th base is T or C, the 807th base is A or G, and the 825th base is T Or G, the 903rd base may be C or T, the 919th base may be T or G, and the 920th base may be C or A.

In the present invention, the polynucleotide containing the SNP (single nucleotide polymorphism) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NO: 1, the 399th base is G, the 552nd base If the base is T, the 857th base is G, and the 859th base is G, it may be identified as Western amber.

In the present invention, the polynucleotide containing a single nucleotide polymorphism (SNP) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NO: 2, the 399th base is A, the 552nd base When the base is T, the 857th base is G, and the 859th base is G, it may be identified as pepo species.

In the present invention, the polynucleotide containing the SNP (single nucleotide polymorphism) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NO: 3, the 399th base is G, the 552nd base If the base is C, the 857th base is G, and the 859th base is G, it may be identified as black amber.

In the present invention, the polynucleotide containing the SNP (single nucleotide polymorphism) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NO: 4, the 399th base is G, the 552nd base If the base is T, the 857th base is A, and the 859th base is T, it may be identified as an oriental pumpkin.

In the present invention, the polynucleotide containing the SNP (single nucleotide polymorphism) located at the 399th, 552nd, 857th and 859th bases of the base sequence represented by SEQ ID NO: 5, the 399th base is G, the 552nd base When the base is T, the 857th base is A, and the 859th base is G, it may be identified as a green amber.

In the present invention, the polynucleotides containing the SNPs located at the 2nd, 107th, 113th and 260th bases of the nucleotide sequence represented by SEQ ID NOs: 6 to 10, the 2nd base is A or G, respectively, and 107 The th base may be A or G, the 113th base may be C or T, and the 260th base may be T or C.

In the present invention, the polynucleotides containing the SNPs located at the 30th, 37th, 38th, 51st, 53rd and 160th bases of the nucleotide sequence represented by SEQ ID NOs: 11 to 15 are each at the 30th base C or G, base 37 is A or T, base 38 is G or T, base 51 is A or T, base 53 is A or T, base 160 is A or C there is.

Specifically, in an embodiment of the present invention, the 312th, 399th, 552nd, 807th, 825th, 857th, 859th, 903rd, 919th, and 920th bases of the mat K barcode section are pumpkin species-specific SNPs It was confirmed that it was a base sequence, and it was confirmed that it was possible to distinguish amber varieties of pepo species, oriental species, western species, black species, and green species by SNPs located at the 399th, 552nd, 857th, and 859th bases among them, and the rbc L barcode It was confirmed that pumpkin varieties of pepo, western, and black varieties could be identified by the SNPs located at the 2nd, 107th, 113th, and 260th bases of the section, and the 30th, 37th , 37th, 37th, It was confirmed that the SNPs located at the 38th, 51st, 53rd, and 160th bases could discriminate the pumpkin varieties of Pepo, Western, and Black varieties.

As another aspect for achieving the above object, the present invention provides a composition for identifying pumpkin varieties, including an agent capable of detecting or amplifying the SNP marker.

The term "agent capable of detecting or amplifying a SNP marker" of the present invention refers to an agent capable of specifically binding to and recognizing a SNP included in the SNP marker for identifying the pumpkin variety or amplifying the SNP, As the SNP marker, it may be a primer capable of specifically amplifying the polynucleotide containing the SNP marker or its complementary polynucleotide, or a probe capable of specifically binding to a polymorphic site containing the SNP.

In the present invention, the agent may be a primer set or probe capable of detecting or amplifying a SNP marker.

In the present invention, the primer set is selected from a primer set represented by SEQ ID NOs: 23, 24, 27, 28 and 29, a primer set represented by SEQ ID NOs: 34 to 38, and a primer set represented by SEQ ID NOs: 39 to 46 can be more than one.

In the present invention, the primer set may additionally include primer sets represented by SEQ ID NOs: 22, 25, 26, 30, 31, 32 and 33.

The term "primer" of the present invention refers to a base sequence having a short free 3' terminal hydroxyl group, which can form a base pair with a complementary template and is a starting point for template strand copying. It refers to a short sequence that functions as a point, and is mainly used in the form of a primer set that amplifies a specific section. A primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. At this time, PCR conditions and lengths of sense and antisense primers may be modified based on those known in the art.

In the present invention, the primers used for the amplification of the SNP marker are prepared in appropriate conditions (eg, four different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and a template under an appropriate temperature. -It can be a single-stranded oligonucleotide that can act as a starting point for directing DNA synthesis. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence does not have to be perfectly complementary to the SNP marker, but is preferably sufficiently complementary to hybridize with the SNP marker.

The term "probe" of the present invention refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to several hundreds of bases as short as possible to achieve specific binding with mRNA, and is labeled. The presence or absence of a specific mRNA can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

As another aspect of the present invention, the present invention provides a kit for identifying pumpkin varieties, including the composition for identifying pumpkin varieties.

In the present invention, a “kit” may be a kit including a composition including an agent capable of detecting or amplifying a marker, a reagent for the detection or amplification, and a restriction enzyme. Reagents for the amplification may include dNTPs, DNA polymerase and buffer, but are not limited thereto. The dNTPs include dATP, dCTP, dGTP, and dTTP, and the DNA polymerase is a thermostable DNA polymerase, and commercially available polymerases such as Taq DNA polymerase and Tth DNA polymerase can be used. The restriction enzyme may be one or more of BfaI or BsaAI, but is not limited thereto.

The kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide may be a printed matter explaining how to use the kit, for example, a method for preparing a PCR buffer, suggested reaction conditions, and the like. The guide may include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide may include information disclosed or provided through an electronic medium such as the Internet.

In the present invention, the kit may further include a reagent for amplifying the SNP marker.

In the present invention, the reagent for amplification may include DNA polymerase, dNTPs, and a buffer.

As another aspect of the present invention, the present invention provides a pumpkin variety identification method comprising the following steps.

(a) isolating nucleic acids from the amber sample;

(b) detecting the SNP marker according to claim 1 from the isolated nucleic acid.

In the present invention, the step (b) is performed by adding a SNP marker located at one or more bases among the 312th, 807th, 825th, 903rd, 919th and 920th bases of the base sequence represented by SEQ ID NOs: 1 to 5 detection may be included.

In the present invention, the step (b)

(i) using the separated nucleic acid as a template and performing PCR using the pumpkin variety identification composition;

(ii) detecting the PCR product amplified in the performing of the PCR.

In the present invention, step (i) may include performing an amplification reaction using a primer set for amplifying the SNP marker.

In the present invention, the primer set is selected from a primer set represented by SEQ ID NOs: 23, 24, 27, 28 and 29, a primer set represented by SEQ ID NOs: 34 to 38, and a primer set represented by SEQ ID NOs: 39 to 46 can be more than one.

In the present invention, the primer set may additionally include primer sets represented by SEQ ID NOs: 22, 25, 26, 30, 31, 32 and 33.

복제효소(replicase)를 통한 증폭을 포함할 수 있으나, 이에 제한되지 않는다. In the present invention, as a method for isolating nucleic acids from the sample, a method known in the art may be used, and an ethanol precipitation method followed by phenol:chloroform extraction may be used. A target sequence may be amplified by performing an amplification reaction using the isolated nucleic acid as a template and adding a DNA polymerase using a primer according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or Q

It may include, but is not limited to, amplification through a replicase.

Using the SNP marker for pumpkin variety identification according to the present invention, variety identification can be performed quickly and accurately in the early stage of pumpkin cultivation, and it can be used as a marker factor for guaranteeing pumpkin breeding varieties through integrated classification.

Figure 1 shows a Neighbor-Joining tree phylogeny of mat K, rbc L, and psb A- trn H for five pumpkin species.
Figure 2 is the result of phylogenetic analysis of five pumpkin species based on the mat K nucleotide sequence.
Figure 3 is the result of phylogenetic analysis of five pumpkin species based on the rbc L nucleotide sequence.
Figure 4 shows the results of phylogenetic analysis of five pumpkin species based on the psb A- trnH nucleotide sequence.
5 is a result of confirming SNPs in the mat K barcode section by electropherogram.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

Example 1: Selection of DNA barcode section for pumpkin species identification

An experiment was conducted to determine whether rbc L, mat K, and psb A- trn H barcode sections are useful for species identification of Cucurbita plants.

Specifically, using the primers shown in Table 1 from the cDNAs of western pumpkins ( Cucurbita maxima ), pepo pumpkins ( Cucurbita pepo ), black pumpkins ( Cucurbita ficifolia ), oriental pumpkins ( Cucurbita moschata ) and green pumpkins ( Cucurbita argyrosperma ) After PCR amplification of rbc L, mat K, and psb A- trn H barcode sections, respectively, the nucleotide sequence was sequenced by ABI Prism 3730xl DNA Analyzer (Applied Biosystems, FosterCity, CA) by requesting Bionics Inc. (Jeonju, Korea). analyzed. Using the nucleotide sequences (Table 2) of each of rbc L, mat K, and psb A- trn H of 5 species of pumpkin obtained from this, a Neighbor-Joining tree tree was created and the analysis was repeated 1,000 times by the booststrap value analysis method. did Booststrap values of all diverging points were marked on the tree as more than 60%, and most of them showed high booststrap value support.

division primer Sequence (5' → 3') sequence number matK F ATGTCACCACAAACAGAGACTAAAGC 16 R GAAACGGTCTCTCCAACGCAT 17 rbcL F TAATCCCCTATCCCTTCATCTG 18 R TCATTGCACACGGCTTTACCTAT 19 psbA-trnH F CGCGCATGGTGGATTCACAATCC 20 R GTTATGCATGAACGTAATGCTC 21

division bp kind sequence number mat K 935 Western squash ( Cucurbita maxima ) One Pepo species pumpkin ( Cucurbita pepo ) 2 Black pumpkin ( Cucurbita ficifolia ) 3 Oriental squash ( Cucurbita moschata ) 4 Green pumpkin ( Cucurbita argyrosperma ) 5 rbc L 541 Western squash ( Cucurbita maxima ) 6 Pepo species pumpkin ( Cucurbita pepo ) 7 Black pumpkin ( Cucurbita ficifolia ) 8 Oriental squash ( Cucurbita moschata ) 9 Green pumpkin ( Cucurbita argyrosperma ) 10 psb A- trn H 187 Western squash ( Cucurbita maxima ) 11 Pepo species pumpkin ( Cucurbita pepo ) 12 Black pumpkin ( Cucurbita ficifolia ) 13 Oriental squash ( Cucurbita moschata ) 14 Green pumpkin ( Cucurbita argyrosperma ) 15

As a result, as shown in FIG. 1, in the case of the mat K barcode section, Western pumpkins were excluded from the group, and Pepo pumpkins and black pumpkins were recruited while forming one demarcation line with 88% booststrap reliability, 86% and 96, respectively. With a high reliability of %, a subdivision gradation was formed. The Asian species Amber and Green Control Amber were recruited with a booststrap reliability of 89% and showed a reliability of 87%. It was confirmed that it was clearly identified.

In the case of the rbc L barcode section, western pumpkins were the outgroup, and pepo and black pumpkins formed a monotonic group with booststrap reliability of 79% and 90%, respectively. Afterwards, oriental pumpkins and green pumpkins were introduced with 63% booststrap reliability. It was confirmed that pepo pumpkins, western pumpkins, and black pumpkins were well identified while being divided into individual species, but it was confirmed that the oriental pumpkins and green pumpkins formed one group.

In the case of the psb A- trn H barcode section, Western pumpkins were taken as outgroups, and Pepo, Western pumpkins, and Black pumpkins formed a monotonic group with booststrap reliability of 67%, 86%, and 94%, respectively, and were classified as individual species. It was well identified while forming a demarcation line, but it was confirmed that the oriental pumpkin and the green-type pumpkin form one group.

Through these results, it was confirmed that three barcode sections, mat K, rbc L, and psb A- trn H, were useful for cultivar identification of Cucurbita.

Example 2: Selection of species-specific SNP sequences within the DNA barcode section

2-1. Phylogenetic tree analysis

Mat K, rbc L and psb A- trn H In order to secure pumpkin species-specific SNP sequences in the three barcode sections, the BioEdit (ver. 7.2) program was used with the base sequences of mat K, rbc L and psb A- trn H. (http://bioedit.software.informer.com) was used to perform phylogenetic tree analysis.

Specifically, after aligning the bidirectional sequencing results using the pair wise alignment of the BioEdit (ver. 7.2) program (http://bioedit.software.informer.com) for each base sequence, the Consensus Sequence result was got it Then, final alignment was performed using MEGA-X (Molecular Evolutionary Genetics Analysis version 10.1.8), and Nucleotid diversity (π) and Tajima's test (D) values were obtained using DnaSP (ver. 5.10.01) program. Neighbor joining phylogenetic tree creation using nucleotide sequences was performed using MEGA X (ver 10.1.8), and bootstrap values were repeated 1,000 times to determine the support of the phylogenetic tree. A phylogenetic tree was independently prepared for the base sequence of each barcode section, and a Neighbor-Joining tree was constructed from the aligned base sequences of each section using the Kimura-2-Parameter (K2P) model.

As a result, the pumpkin species-specific SNPs of mat K were located at positions 312, 399, 552, 807, 825, 857, 859, 903, 919, and 920 of the 935 bp-long aligned mat K base sequence, as shown in FIG. confirmed that there is

As shown in FIG. 3, the rbcL species-specific SNPs were confirmed to be located at positions 2, 107, 113, and 260 of the 541 bp aligned rbc L sequence.

As shown in FIG . 4, it was confirmed that the pumpkin species-specific SNPs of psb A- trn H were located at positions 30, 37, 38, 51, 53, and 160 of the aligned psb A- trn H sequence of 187 bp.

Each of the nucleotide sequences of the pumpkin species-specific SNPs of the three barcode segments mat K, rbc L and psb A- trn H is as follows (Table 3).

2-2. Multiplex snapshot assay

In order to confirm whether pumpkin varieties can be identified by the obtained SNP sequences, multiplex snapshot assay was performed. The SNaPshot reaction is completed when a single ddNTP with a fluorescent label of a different color for each nucleotide sequence is polymerized in each SNaPshot Primer. Since each SNaPshot Primer has a different bp length and a different fluorescent labeling color at the species-specific SNP location, it is possible to classify the species of the genus Amber by reading different combinations of species-specific SNPs.

To perform SNaPshot, SNPs-specific primers were prepared for three barcode sections: mat K, rbc L, and psb A- trn H (Table 4).

marker primer Sequence (5' → 3') sequence number mat K matK_312 TGAATAAGTGGAAATATTACCTTGT 22 matK_399 TATCCAAGCGTTCTCTTGACTTTTT 23 matK_552 ATTGGCTAAAGCGAAATTTTGTAA 24 matK_807 TATTGGAAGAATTCTTTACGGAGCA 25 matK_825 GAGCAAGAACAGGTTCTTTCTTT 26 matK_857 CTTCCCAAGAGCTTCTTTTACTTTACAGA 27 matK_859 CTTCCCAAGAGCTTCTTTTACTTTACAGAA G 28 matK_859_2 CTTCCCAAGAGCTTCTTTTACTTTACAGAG G 29 matK_903 TTTGGATATTATTTGCATCAA 30 matK_919 GATTTGGCCAATCAT 31 matK_920 GATTTGGCCAATCATG 32 matK_920_2 GATTTGGCCAATCATT 33 rbc L rbcL_2 GCTGGGATCAAGCTGGTGTTA 34 rbcL_107 CCGGGAGTCCACCCGAGGAAGC 35 rbcL_113 ACCCGAGGAAGCGGGGGC 36 rbcL_113_2 ACCCGAGGAAGCAGGGGC 37 rbcL_260 AATATATTGCTTATGTAGCTATCC 38 psb A- trn H psb A- trn H_30 CCCTATATATAAGTATATATTA 39 psb A- trn H_37 AAGTATATATTAGAAAAAT 40 psb A- trn H_38 AAGTATATATTAGAAAAAT 41 psb A- trn H_38_2 AAGTATATATTAGAAAAATA 42 psb A- trn H_51 AAGTATAAATTA 43 psb A- trn H_53 AAGTATAAATTATA 44 psb A- trn H_53 AAGTATAAATTAAA 45 psb A- trn H_160 TTCAAGAACTTGTATACACTAAGAC 46

2U exonuclease (BioLabs.Inc) and 5U shrimp alkaline phosphatase (SAP; BioLabs.Inc) were added to each 15 μl of DNA barcode section PCR product of amplified matK, rbcL and psb A- trn H, followed by vortexing and incubation at 37 ° C. Remaining dNTPs and primers were inactivated by reacting at 75 ° C for 15 minutes. Then, in the multiplex minisequencing reaction reaction in which six SNP loci are analyzed simultaneously, 3 μl of PCR product, 1 μl of SNPs-specific primer mix, 5 μl of SNaPshot Multiplex Ready Reaction Mix (Applied Biosystems, CA, USA), and 1 μl of distilled water were added. The total volume was 10 μl. The PCR reaction conditions consisted of predenaturation at 96 ° C for 2 minutes, denaturation at 96 ° C for 10 seconds, annealing at 50 ° C for 5 ° C, and extension at 60 ° C for 30 seconds. After repeating 25 cycles, final extension was performed at 60 ° C for 1 minute. . SAP was added to the multiplex minisequencing reaction product and reacted at 37℃ for 1 hour and 75℃ for 15 minutes to remove fluorescently labeled dideoxynucleoside triphosphates (ddNTPs). 0.5 μl of 9 μl of Hi-Di formamide and 0.5 μl of GeneScan-120 LIZ size standard (Applied Biosystems, CA, USA) were added to 0.5 μl of the multiplex minisequencing product, followed by light vortexing and centrifugation. The reaction product was denatured at 95 ° C for 5 minutes, and then analyzed using a 3500 DNA sequencer (Applied Biosystems and Hitachi, Foster City, CA, USA) using a 50 cm capillary array and POP-7 polymer, and data analysis was performed using GeneMapper software (version 5.0; Applied Biosystems).

As a result, as shown in FIG. 5, in the case of the mat K gene, using species-specific SNPs of sequences 399, 552, 857, and 859, five pumpkin varieties of pepo species, oriental species, western species, black species, and green species were identified It was confirmed that this is possible.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without changing its technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later and equivalent concepts rather than the detailed description above are included in the scope of the present invention.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> MARKER COMPOSITION FOR IDENTIFICATION OF CUCURBITA SPP. AND IDENTIFICATION METHOD USING THE SAME <130> KPA2021-178 <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 935 <212> DNA <213> Cucurbita maxima <400> 1 ttttcctttt tctacgtaac caatcttctc atatacgatt aacttcttat 120 aggggccttt ttgaacgaat atatttctat ggaaaaatcg aacatcttgt caaagtgttt 180 gctaattatt tttcggctat cttacgggtc ttcaaggatc ctttcataca ttatgttaga 240 tatcaaggaa aattgattct ggtttcaaaa gatacgccac ttctgatgaa taagtggaaa 300 tattaccttg ttaatttatg gcaatgtcat ttttatgtgt ggtcacaacc agaaaggatc 360 catataaacc aattatccaa gcgttctctt gactttttgg gctatatttc aagtgtgcga 420 ttaaatcctt cagtggtatg gagtcagatg ctagaaaatt catttctaat agataatgct 480 accaagaaaa tcgatacact agttcctatt attactctgc ttggatcatt ggctaaagcg 540 aaattttgta atgtgttagg gcatcccatt agtaagccga cctggatcga ttcgtcggat 600 ttttctatta ttgatcgatt tgtgcgtata tccagaaatc tttctcatta ttacagagga 660 tcctcaaaaa aaaagaattt gtatcgaatc cagtatatac ttcgcctttc ttgtcttaaa 720 actttggctc gt aaacacaa aagtactgta cgcgttcttt ttaaaaggtt aaattcgcaa 780 ttattggaag aattctttac ggagcaagaa caggttcttt ctttgatctt cccaagagct 840 tcttttactt tacagagggt atataggggg aaaatttggt atttggatat tatttgcatc 900 aacgatttgg ccaatcatga atgattggtt ctgac 935 <210> 2 <211> 935 <212> DNA <213> Cucurbita pepo <400> 2 tttttttcaa aaagaaatca aagattagtc ttgttcctat acaattctta tgtatgtgaa 60 tacgaatcca ttttcctttt tctacgtaac caatcttctc atatacgatt aacttcttat 120 aggggccttt ttgaacgaat atatttctat ggaaaaatcg aacatcttgt caaagtgttt 180 gctaattatt tttcggctat cttacgggtc ttcaaggatc ctttcataca ttatgttaga 240 tatcaaggaa aattgattct ggtttcaaaa gatacgccac ttctgatgaa taagtggaaa 300 tattaccttg ttaatttatg gcaatgtcat ttttatgtgt ggtcacaacc agaaaggatc 360 catataaacc aattatccaa gcgttctctt gactttttag gctatatttc aagtgtgcga 420 tcctcaaaaa aaaagaattt gtatcgaatc cagtatatac ttcgcctttc ttgtcttaaa 480 ttaaatcctt cagtggtatg gagtcagatg ctagaaaatt catttctaat agataatgct 540 accaagaaaa ttgatacact agttcctatt attactctgc ttggatcatt ggctaaagcg 600 aaat tttgta atgtgttagg gcatcccatt agtaagccga cctggatcga ttcgtcggat 660 ttttctatta ttgatcgatt tgtgcgtata tccagaaatc tttctcatta ttacagagga 720 actttggctc gtaaacacaa aagtactgta cgcgttcttt ttaaaaggtt aaattcgcaa 780 ttattggaag aattctttac ggagcaagaa caggttcttt cttttatctt cccaagagct 840 tcttttactt tacagagggt atataggggg aaaatttggt atttggatat tatttgcatc 900 aacgatttgg ccaatcattc atgattggtt ctgac 935 <210> 3 <211> 935 <212 > DNA <213> Cucurbita ficifolia <400> 3 tttttttcaa aaagaaatca aagattagtc ttgttcctat acaattctta tgtatgtgaa 60 tacgaatcca ttttcctttt tctacgtaac caatcttctc atatacgatt aacttcttat 120 aggggccttt ttgaacgaat atatttctat ggaaaaatcg aacatcttgt caaagtgttt 180 gctaattatt tttcggctat cttacgggtc ttcaaggatc ctttcataca ttatgttaga 240 tatcaaggaa aattgattct ggtttcaaaa gatacgccac ttctgatgaa taagtggaaa 300 tattaccttg tcaatttatg gcaatgtcat ttttatgtgt ggtcacaacc agaaaggatc 360 catataaacc aattatccaa gcgttctctt gactttttgg gctatatttc aagtgtgcga 420 ttaaatcctt cagtggtatg gagtcagatg ctagaaaatt catttctaat agata atgct 480 accaagaaaa tcgatacact agttcctatt attactctgc ttggatcatt ggctaaagcg 540 aaattttgta acgtgttagg gcatcccatt agtaagccga cctggatcga ttcgtcggat 600 ttttctatta ttgatcgatt tgtgcgtata tccagaaatc tttctcatta ttacagagga 660 tcctcaaaaa aaaagaattt gtatcgaatc cagtatatac ttcgcctttc ttgtcttaaa 720 actttggctc gtaaacacaa aagtactgta cgcgttcttt ttaaaaggtt aaattcgcaa 780 ttattggaag aattctttac ggagcaagaa caggttcttt ctttgatctt cccaagagct 840 tcttttactt tacagagggt atataggggg aaaatttggt atttggatat tatttgcatc 900 aatgatttgg ccaatcattc atgattggtt ctgac 935 <210> 4 <211> 935 <212> DNA <213> Cucurbita moschata <400> 4 tttttttcaa aaagaaatca aagattagtc ttgttcctat acaattctta tgtatgtgaa 60 tacgaatcca ttttcctttt tctacgtaac caatcttctc atatacgatt aacttcttat 120 aggggccttt ttgaacgaat atatttctat ggaaaaatcg aacatcttgt caaagtgttt 180 gctaattatt tttcggctat cttacgggtc ttcaaggatc ctttcataca ttatgttaga 240 tatcaaggaa aattgattct ggtttcaaaa gatacgccac ttctgatgaa taagtggaaa 300 tattaccttg ttaatttatg gcaatgtcat ttttatgtgt ggt cacaacc agaaaggatc 360 catataaacc aattatccaa gcgttctctt gactttttgg gctatatttc aagtgtgcga 420 ttaaatcctt cagtggtatg gagtcagatg ctagaaaatt catttctaat agataatgct 480 accaagaaaa tcgatacact agttcctatt attactctgc ttggatcatt ggctaaagcg 540 aaattttgta atgtgttagg gcatcccatt agtaagccga cctggatcga ttcgtcggat 600 ttttctatta ttgatcgatt tgtgcgtata tccagaaatc tttctcatta ttacagagga 660 tcctcaaaaa aaaagaattt gtatcgaatc cagtatatac ttcgcctttc ttgtcttaaa 720 actttggctc gtaaacacaa aagtactgta cgcgttcttt ttaaaaggtt aaattcgcaa 780 ttattggaag aattctttac ggagcaggaa caggttcttt ctttgatctt cccaagagct 840 tcttttactt tacagaagtt atataggggg aaaatttggt atttggatat tatttgcatc 900 aacgatttgg ccaatcatga atgattggtt ctgac 935 <210> 5 <211> 935 <212> DNA <213> Cucurbita argyrosperma <400> 5 tttttttcaa aaagaaatca aagattagtc ttgttcctat acaattctta tgtatgtgaa 60 tacgaatcca ttttcctttt tctacgtaac caatcttctc atatacgatt aacttcttat 120 aggggccttt ttgaacgaat atatttctat ggaaaaatcg aacatcttgt caaagtgttt 180 gctaattatt tttcggctat cttacggg tc ttcaaggatc ctttcataca ttatgttaga 240 tatcaaggaa aattgattct ggtttcaaaa gatacgccac ttctgatgaa taagtggaaa 300 tattaccttg ttaatttatg gcaatgtcat ttttatgtgt ggtcacaacc agaaaggatc 360 catataaacc aattatccaa gcgttctctt gactttttgg gctatatttc aagtgtgcga 420 ttaaatcctt cagtggtatg gagtcagatg ctagaaaatt catttctaat agataatgct 480 accaagaaaa tcgatacact agttcctatt attactctgc ttggatcatt ggctaaagcg 540 aaattttgta atgtgttagg gcatcccatt agtaagccga cctggatcga ttcgtcggat 600 ttttctatta ttgatcgatt tgtgcgtata tccagaaatc tttctcatta ttacagagga 660 tcctcaaaaa aaaagaattt gtatcgaatc cagtatatac ttcgcctttc ttgtcttaaa 720 actttggctc gtaaacacaa aagtactgta cgcgttcttt ttaaaaggtt aaattcgcaa 780 ttattggaag aattctttac ggagcaagaa caggttcttt ctttgatctt cccaagagct 840 tcttttactt tacagaaggt atataggggg aaaatttggt atttggatat tatttgcatc 900 aacgatttgg ccaatcatga atgattggtt ctgac 935 <210> 6 <211> 541 <212> DNA < 213> Cucurbita maxima <400> 6 aagattataa attgacttat tatactcctg aatatgaaac caaagatact gatatcttgg 60 cagcattccg agtaactc ct caaccgggag ttccacccga ggaagcaggg gccgctgtag 120 ctgctgaatc ttctactggt acatggacaa ctgtgtggac cgatgggctt accagtcttg 180 atcgttacaa aggacgatgc tatggaatcg agcctgttcc tggagaagaa aatcaatata 240 ttgcttatgt agcttatccc ctagaccttt ttgaagaagg ttctgttact aacatgttta 300 cttccattgt gggtaatgta tttggattca aggctctgcg tgctctacgt ctggaggatt 360 tgcgaatccc tactgcttat attaaaactt tccaaggccc gcctcatggt atccaggttg 420 aaagagataa attgaacaag tatggtcgcc ctctattggg atgtactatt aaaccaaaat 480 tgggattatc cgctaagaat tatggtagag cagtttatga atgtctacgc ggtggacttg 540 a 541 <210> 7 <211> 541 <212> DNA <213> Cucurbita pepo <400> 7 aagattataa attgacttat tatactcctg aatatgaaac caaagatact gatatcttgg 60 cagcattccg agtaactcct caaccgggag ttccacccga ggaagcaggg gccgctgtag 120 ctgctgaatc ttctactggt acatggacaa ctgtgtggac cgatgggctt accagtcttg 180 atcgttacaa aggacgatgc tatggaatcg agcctgttcc tggagaagaa aatcaatata 240 ttgctttgt agcttatcct ctagaccttt ttgaagaagg ttctgttact aacatgttta 300 cttccattgt gggtaatgta tttggattca aggctctgcg tgc tctacgt ctggaggatt 360 tgcgaatccc tactgcttat attaaaactt tccaaggccc gcctcatggt atccaggttg 420 aaagagataa attgaacaag tatggtcgcc ctctattggg atgtactatt aaaccaaaat 480 tgggattatc cgctaagaat tatggtagag cagtttatga atgtctacgc ggtggacttg 540 a 541 <210> 8 <211> 541 <212> DNA <213> Cucurbita ficifolia <400> 8 aggattataa attgacttat tatactcctg aatatgaaac caaagatact gatatcttgg 60 cagcattccg agtaactcct caaccgggag ttccacccga ggaagcaggg gctgctgtag 120 ctgctgaatc ttctactggt acatggacaa ctgtgtggac cgatgggctt accagtcttg 180 atcgttacaa aggacgatgc tatggaatcg agcctgttcc tggagaagaa aatcaatata 240 ttgcttatgt agcttatccc ctagaccttt ttgaagaagg ttctgttact aacatgttta 300 cttccattgt gggtaatgta tttggattca aggctctgcg tgctctacgt ctggaggatt 360 tgcgaatccc tactgcttat attaaaactt tccaaggccc gcctcatggt atccaggttg 420 aaagagataa attgaacaag tatggtcgcc ctctattggg atgtactatt aaaccaaaat 480 tgggattatc cgctaagaat tatggtagag cagttatga atgtctacgc ggtggacttg 540 a 541 <210> 9 <211> 541 <212> DNA <213> Cucurbita moschata <400> 9 aag attataa attgacttat tatactcctg aatatgaaac caaagatact gatatcttgg 60 cagcattccg agtaactcct caaccgggag ttccacccga ggaagcgggg gccgctgtag 120 ctgctgaatc ttctactggt acatggacaa ctgtgtggac cgatgggctt accagtcttg 180 atcgttacaa aggacgatgc tatggaatcg agcctgttcc tggagaagaa aatcaatata 240 ttgcttatgt agcttatccc ctagaccttt ttgaagaagg ttctgttact aacatgttta 300 cttccattgt gggtaatgta tttggattca aggctctgcg tgctctacgt ctggaggatt 360 tgcgaatccc tactgcttat attaaaactt tccaaggccc gcctcatggt atccaggttg 420 aaagagataa attgaacaag tatggtcgcc ctctattggg atgtactatt aaaccaaaat 480 tgggattatc cgctaagaat tatggtagag cagtttatga atgtctacgc ggtggacttg 540 a 541 <210> 10 <211> 541 <212> DNA <213> Cucurbita argyrosperma <400> 10 aagattataa attgacttat tatactcctg aatatgaaac caaagatact gatatcttgg 60 cagcattccg agtaactcct caaccgggag ttccacccga ggaagcgggg gccgctgtag 120 ctgctgaatc ttctactggt acatggacaa ctgtgtggac cgatgggctt accagtcttg 180 atcgttacaa aggacgatgc tatggaatcg agcctgttcc tggagaagaa aatcaatata 240 ttgcttatgt agctttccc ctagaccttt ttgaagaagg ttctgttact aacatgttta 300 cttccattgt gggtaatgta tttggattca aggctctgcg tgctctacgt ctggaggatt 360 tgcgaatccc tactgcttat attaaaactt tccaaggccc gcctcatggt atccaggttg 420 aaagagataa attgaacaag tatggtcgcc ctctattggg atgtactatt aaaccaaaat 480 tgggattatc cgctaagaat tatggtagag cagtttatga atgtctacgc ggtggacttg 540 a 541 <210> 11 <211> 187 <212> DNA <213> Cucurbita maxima <400> 11 ccccctaccc tatatataag tatatattag aaaaatttaa gtataaatta aaaagttatg 60 taaaattttt taataaaaaa ggagcaatac caatcctctt gagaaaacaa gaaattggtt 120 attgctcctt tactttcaag aacttgtata cactaagaca gaagtcttat ccattgatag 180 atggaac 187 <210> 12 <211> 187 <212> DNA <213> Cucurbita pepo <400> 12 ccccctaccc tatatataag tatatattag aaaaatagaa gtataaatta aaaagttatg 60 taaaattttt taataaaaaa ggagcaatac caatcctctt gagaaaacaa gaaattggtt 120 attgctcctt tactttcaag aacttgtata cactaagacc gaagtcttat ccattgatag 180 atggaac 187 <210> 13 <211> 187 <212> DNA <213> Cucurbita ficifolia <400> 13 ccccctaccc tatatataag tatatattac aaaaata gaa gtataaatta tatagttatg 60 taaaattttt taataaaaaa ggagcaatac caatcctctt gagaaaacaa gaaattggtt 120 attgctcctt tactttcaag aacttgtata cactaagaca gaagtcttat ccattgatag 180 atggaac 187 <210> 14 <211> 187 <212> DNA <213> Cucurbita moschata <400> 14 ccccctaccc tatatataag tatatattag aaaaatagaa gtataaatta aaaagttatg 60 taaaattttt taataaaaaa ggagcaatac caatcctctt gagaaaacaa gaaattggtt 120 attgctcctt tactttcaag aacttgtata cactaagaca gaagtcttat ccattgatag 180 atggaac 187 <210> 15 <211> 187 <212> DNA <213> Cucurbita argyrosperma <400> 15 ccccctaccc tatatataag tatatattag aaaaatagaa gtataaatta aaaagttatg 60 taaaattttt taataaaaaa ggagcaatac caatcctctt gagaaaacaa gaaattggtt 120 attgctcctt tactttcaag aacttgtata cactaagaca gaagtcttat ccattgatag 180 atggaac 187 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 atgtcaccac aaacagagac taaagc 26 <210> 17 <211> 21 < 212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 17 gaaacggtct ctccaacgca t 2 1 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 taatccccta tccccttcat ctg 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 19 tcattgcaca cggctttacc tat 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 20 cgcgcatggt ggattcacaa tcc 23 <210> 21 <211> 22 <212> DNA < 213> Artificial Sequence <220> <223> Artificial sequence <400> 21 gttatgcatg aacgtaatgc tc 22 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 22 tgaataagtg gaaatattac cttgt 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 23 tatccaagcg ttctcttgac ttttt 25 <210> 24 <211> 24 <212> DNA <213 > Artificial Sequence <220> <223> Artificial sequence <400> 24 attggctaaa gcgaaatttt gtaa 24 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 25 tattggaaga attctttacg gagca 25 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 26 gagcaagaac aggttctttc ttt 23 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 27 ct DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 29 cttcccaaga gcttctttta ctttacagag g 31 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 30 tttggatatt atttgcatca a 21 <210> 31 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 31 gatttggcca atcat 15 <210> 32 <211> 16 <212> DNA < 213> Artificial Sequence <220> <223> Artificial sequence <400> 32 gatttggcca atcatg 16 <210> 33 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 33 gatttggcca atcatt 16 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 34 gctgggatca agctggtgtt a 21 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 35 ccgggagttc cacccgagga agc 23 <210> 36 <211> 18 <212> DNA < 213> Artificial Sequence <220> <223> Artificial sequence <400> 36 acccgaggaa gcgggggc 18 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 37 acccgaggaa gcaggggc 18 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 38 aatatattgc ttatgtagct tatcc 25 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 39 ccctatatat aagtatatat ta 22 <210> 40 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 40 aagtatatat tagaaaaat 19 < 210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 41 aagtatatat tagaaaaatt 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220 > <223> Artificial sequence <400> 42 aagtatatat tagaaaaata 20 <210> 43 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 43 aagtataaat ta 12 <210> 44 <211> 14 <212> DNA <213> Artificial Sequence <220> < 223> Artificial sequence <400> 44 aagtataaat tata 14 <210> 45 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 45 aagtataaat taaa 14 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence<400> 46 ttcaagaact tgtatacact aagac 25

Claims (28)

A polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the nucleotide sequences represented by SEQ ID NOs: 1 to 5, or a polynucleotide complementary thereto; A polynucleotide comprising a SNP located at the 2nd, 107th, 113th and 260th bases of the nucleotide sequence represented by SEQ ID NOs: 6 to 10 or a polynucleotide complementary thereto; And a polynucleotide comprising a SNP located at the 30th, 37th, 38th, 51st, 53rd and 160th bases of the nucleotide sequence represented by SEQ ID NOs: 11 to 15, or a polynucleotide complementary thereto selected from the group consisting of ,
A SNP marker composition for cultivar identification of amber ( Cucurvita spp ) comprising a polynucleotide consisting of 10 to 500 consecutive bases or a nucleotide complementary thereto.
According to claim 1,
The pumpkin is at least one selected from the group consisting of Western pumpkins ( Cucurbita maxima ), Pepo pumpkins ( Cucurbita pepo ), Black pumpkins ( Cucurbita ficifolia ), Oriental pumpkins ( Cucurbita moschata ), and green pumpkins ( Cucurbita argyrosperma ) Pumpkin SNP marker composition for cultivar identification.
According to claim 1,
In the 399th, 552nd, 857th, and 859th bases of the base sequence represented by SEQ ID NOs: 1 to 5, the 399th base is A or G, the 552nd base is T or C, and the 857th base is G, respectively. Or A, and the 859th base is G or T, a SNP marker composition for identifying pumpkin varieties.
According to claim 1,
A polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the base sequence represented by SEQ ID NOs: 1 to 5,
312th, 807th, 825th, 903rd, 919th, and further comprising a SNP located at any one or more bases of 920th, SNP marker composition for identifying pumpkin varieties.
According to claim 4,
In the 312th, 807th, 825th, 903rd, 919th, and 920th bases, the 312th base is T or C, the 807th base is A or G, the 825th base is T or G, and 903 A SNP marker composition for identifying pumpkin varieties, wherein the th base is C or T, the 919th base is T or G, and the 920th base is C or A.
According to claim 1,
In the polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the base sequence represented by SEQ ID NO: 1, the 399th base is G, the 552nd base is T, 857 SNP marker composition for identifying pumpkin varieties, which is identified as Western pumpkin when the th base is G and the 859th base is G.
According to claim 1,
A polynucleotide containing a single nucleotide polymorphism (SNP) located at 399th, 552nd, 857th and 859th bases of the nucleotide sequence represented by SEQ ID NO: 2, 399th base is A, 552nd base is T, 857 When the th base is G and the 859th base is G, the SNP marker composition for identifying pumpkin varieties is identified as pepo species.
According to claim 1,
In the polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the base sequence represented by SEQ ID NO: 3, the 399th base is G, the 552nd base is C, 857 SNP marker composition for identifying pumpkin variety, which is identified as black pumpkin when the th base is G and the 859th base is G.
According to claim 1,
In the polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857, and 859 of the base sequence represented by SEQ ID NO: 4, the 399th base is G, the 552nd base is T, 857 If the th base is A and the 859th base is T, it is identified as an oriental pumpkin, a SNP marker composition for identifying pumpkin varieties.
According to claim 1,
In the polynucleotide containing a single nucleotide polymorphism (SNP) located at bases 399, 552, 857 and 859 of the base sequence represented by SEQ ID NO: 5, base 399 is G, base 552 is T, 857 SNP marker composition for identifying pumpkin varieties, which is identified as green control pumpkin when the th base is A and the 859th base is G.
According to claim 1,
In the polynucleotide containing the SNP located at the 2nd, 107th, 113th and 260th bases of the base sequence represented by SEQ ID NOs: 6 to 10, the 2nd base is A or G, and the 107th base is A or G, the 113th base is C or T, and the 260th base is T or C, a SNP marker composition for identifying pumpkin varieties.
According to claim 1,
In the polynucleotides containing the SNPs located at the 30th, 37th, 38th, 51st, 53rd and 160th bases of the base sequence represented by SEQ ID NOs: 11 to 15, the 30th base is C or G, A SNP for identifying pumpkin cultivars in which the 37th base is A or T, the 38th base is G or T, the 51st base is A or T, the 53rd base is A or T, and the 160th base is A or C. marker composition.
A composition for identifying pumpkin varieties, comprising an agent capable of detecting or amplifying the SNP marker of claim 1.
According to claim 13,
The agent is a primer set or probe capable of detecting or amplifying a SNP marker, a composition for identifying pumpkin varieties.
According to claim 13,
The pumpkin is at least one selected from the group consisting of Western pumpkins ( Cucurbita maxima ), Pepo pumpkins ( Cucurbita pepo ), Black pumpkins ( Cucurbita ficifolia ), Oriental pumpkins ( Cucurbita moschata ), and green pumpkins ( Cucurbita argyrosperma ) Pumpkin A composition for cultivar identification.
According to claim 14,
The primer set is any one or more selected from the primer sets represented by SEQ ID NOs: 23, 24, 27, 28 and 29, the primer sets represented by SEQ ID NOs: 34 to 38, and the primer sets represented by SEQ ID NOs: 39 to 46, amber A composition for cultivar identification.
According to claim 16,
The primer set further comprises a primer set represented by SEQ ID NOs: 22, 25, 26, 30, 31, 32 and 33, a composition for identifying pumpkin varieties.
A kit for identifying pumpkin varieties, comprising the composition for identifying pumpkin varieties according to any one of claims 13 to 17.
According to claim 18,
The pumpkin is at least one selected from the group consisting of Western pumpkins ( Cucurbita maxima ), Pepo pumpkins ( Cucurbita pepo ), Black pumpkins ( Cucurbita ficifolia ), Oriental pumpkins ( Cucurbita moschata ), and green pumpkins ( Cucurbita argyrosperma ) Pumpkin Kit for breed identification.
According to claim 18,
The kit further comprises a reagent for amplifying the SNP marker of claim 1, a kit for identifying pumpkin varieties.
According to claim 20,
The reagent for amplification is a kit for identifying pumpkin varieties comprising DNA polymerase, dNTPs and a buffer.
A method for identifying pumpkin varieties, comprising the steps of:
(a) isolating nucleic acids from the amber sample;
(b) detecting the SNP marker according to claim 1 from the isolated nucleic acid.
The method of claim 22,
The step (b) is additionally detecting a SNP marker located at one or more of bases 312, 807, 825, 903, 919, and 920 of the base sequence represented by SEQ ID NOs: 1 to 5 of claim 1. A pumpkin variety identification method comprising a.
The method of claim 22,
In step (b),
(i) performing PCR using the isolated nucleic acid as a template and using the composition for identifying pumpkin varieties according to claim 13;
(ii) a pumpkin variety identification method comprising the step of detecting the PCR product amplified in the step of performing the PCR.
According to claim 24,
Step (i) comprises the step of performing an amplification reaction using a primer set for amplifying the SNP marker, pumpkin variety identification method.
According to claim 25,
The primer set is any one or more selected from the primer sets represented by SEQ ID NOs: 23, 24, 27, 28 and 29, the primer sets represented by SEQ ID NOs: 34 to 38, and the primer sets represented by SEQ ID NOs: 39 to 46, amber Breed identification method.
The method of claim 26,
The primer set further comprises a primer set represented by SEQ ID NOs: 22, 25, 26, 30, 31, 32 and 33, pumpkin variety identification method.
The method of claim 22,
The pumpkin is at least one selected from the group consisting of Western pumpkins ( Cucurbita maxima ), Pepo pumpkins ( Cucurbita pepo ), Black pumpkins ( Cucurbita ficifolia ), Oriental pumpkins ( Cucurbita moschata ), and green pumpkins ( Cucurbita argyrosperma ) Pumpkin Breed identification method.

Images