KR20220159106A - Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle - Google Patents

Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle Download PDF

Info

Publication number
KR20220159106A
KR20220159106A KR1020210067038A KR20210067038A KR20220159106A KR 20220159106 A KR20220159106 A KR 20220159106A KR 1020210067038 A KR1020210067038 A KR 1020210067038A KR 20210067038 A KR20210067038 A KR 20210067038A KR 20220159106 A KR20220159106 A KR 20220159106A
Authority
KR
South Korea
Prior art keywords
extracellular vesicles
mesenchymal stem
stem cells
present
derived mesenchymal
Prior art date
Application number
KR1020210067038A
Other languages
Korean (ko)
Inventor
이병주
김지민
김형식
Original Assignee
부산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단 filed Critical 부산대학교 산학협력단
Priority to KR1020210067038A priority Critical patent/KR20220159106A/en
Publication of KR20220159106A publication Critical patent/KR20220159106A/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/98—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin
    • A61K8/981—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution of animal origin of mammals or bird
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q11/00—Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/204—Animal extracts

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Birds (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

The present invention relates to a composition for preventing, improving, or treating dry mouth comprising extracellular vesicles isolated from tonsil-derived mesenchymal stem cells as an active ingredient. According to the present invention, extracellular vesicles isolated from tonsil-derived mesenchymal stem cells contain many anti-inflammatory or anti-fibrotic miRNAs, and when the extracellular vesicles were treated with an animal model that induced menopause, it was confirmed that the expression of inflammatory or anti-fibrotic factors increased by menopause was reduced and that the decreased salivary secretion function was recovered. Thus, the present invention can be useful in preventing, improving, or treating dry mouth of various causes, including dry mouth caused by menopause.

Description

편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증의 예방, 개선 또는 치료용 조성물{Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle}Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicles comprising extracellular vesicles isolated from tonsil-derived mesenchymal stem cells as an active ingredient

본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증의 예방 또는 치료용 조성물, 또는 타액 분비 증강용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating xerostomia, or a composition for enhancing salivary secretion, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

구강건조증(xerostomia)은 타액이 어떠한 원인에 의해서 지속적으로 분비되지 않아 입안이 마르게 되는 증상으로 타액 분비량이 분당 0.1㎖ 이하로 떨어지면 발생한다. 타액은 귀밑샘, 턱밑샘, 혀밑샘의 3개의 대타액선과 구강 내에 골고루 분보해 있는 작은 소타액선들에 의해 분비된다. 이러한 조직의 기능이 저하되면 타액의 분비가 감소되어 구강건조증의 증상이 나타나게 된다. 구강건조가 나타나면 타액성의 용액, 단백질 및 뮤신에 의한 구강 내 보호 효과가 현저히 감소하여 침샘 조직의 파괴가 나타난다. 타액의 분비가 감소되어 만성적인 구강건조증으로 발전하면 발음을 변화시키고 음식물의 저작 활동 및 목넘김을 어렵게 하며, 구강 내 작열감을 유발하고 충치 및 구강 질환의 위험을 증가시킨다.Xerostomia is a symptom in which saliva is not continuously secreted for some reason, resulting in dry mouth, and occurs when the amount of saliva secretion drops below 0.1 ml per minute. Saliva is secreted by the three major salivary glands, the parotid, submandibular, and sublingual glands, and small salivary glands distributed evenly in the oral cavity. When the function of these tissues is deteriorated, the secretion of saliva is reduced, resulting in symptoms of xerostomia. When dry mouth occurs, the protective effect in the oral cavity by salivary solutions, proteins, and mucins is significantly reduced, resulting in destruction of salivary gland tissues. If saliva secretion is reduced and develops into chronic xerostomia, it changes pronunciation, makes food masticatory activity and throat swallowing difficult, causes a burning sensation in the mouth, and increases the risk of tooth decay and oral disease.

구강건조증의 원인으로는 거대세포바이러스(Cytomegalovirus), 엡스타인-바 바이러스(Epstein-Barr virus) 및 인간 헤르페스 바이러스(Human herpes virus)등의 바이러스 감염, 당뇨병, 쇼그렌 증후군(Sjogren’syndrome), 류마티스관절염, 부신질환, 후천성면역결핍증(acquired immune deficiency syndrome), 림프상피낭종(lymphoepithelial cyst), 림프절병증(lymphadenopathy), 낭종섬유증(cystic fibrosis) 등의 질병, 방사선 치료에 의한 타액선 파괴, 항우울증, 항당뇨, 항알레르기 등 다양한 약물의 부작용이 있으며, 그 외 자연 노화인 폐경(postmenopausal)에 의해서도 유발된다.Causes of xerostomia include viral infections such as cytomegalovirus, Epstein-Barr virus and human herpes virus, diabetes, Sjogren's syndrome, rheumatoid arthritis, Diseases such as adrenal disease, acquired immune deficiency syndrome, lymphoepithelial cyst, lymphadenopathy, cystic fibrosis, salivary gland destruction by radiation therapy, antidepressants, antidiabetics, There are side effects of various drugs such as anti-allergy, and other natural aging, such as postmenopausal, is also caused.

상기 폐경(postmenopausal)은 여성의 월경이 완전히 멈추는 것으로, 이에 대한 시기인 폐경기(Menopause)때에는 감소된 여성호르몬으로 인해 신체 및 심리적으로 많은 변화가 온다. 우리나라 중년여성의 93% 중 갱년기 증상의 발생빈도는 50% 이상으로 높게 나타나며 상당한 불편감을 경험하고 있는 것으로 보고되고 있다(송애리, 2005, 갱년기 여성의 폐경 관리와 관련된 건강요인에 대한 연구, 여성건강간호학회지, 11(1):12-19 참고).Menopause (postmenopausal) is the complete stop of menstruation in women, and at the time of menopause (Menopause), many physical and psychological changes come due to reduced female hormones. Among 93% of middle-aged women in Korea, the incidence of menopausal symptoms is as high as 50%, and it is reported that they experience considerable discomfort (Song Ae-ri, 2005, A Study on Health Factors Related to Menopausal Management in Menopausal Women, Women's Health Journal of Nursing, 11(1):12-19).

폐경에 의하여 구강건조증, 안구 건조증, 질 건조증, 피부의 탄력감소와 건조감 등이 발생될 수 있으며, 이러한 증상은 폐경 이후 여성들의 삶의 질을 매우 감소시킨다.Menopause may cause dry mouth, dry eyes, vaginal dryness, loss of elasticity and dryness of the skin, and the like, and these symptoms greatly reduce the quality of life of postmenopausal women.

상기 폐경기 증상들을 예방하거나 치료하기 위해 사용되는 대표적인 방법들 중 하나는 호르몬 대체요법 치료이다. 상기 호르몬 대체요법 치료는 여성호르몬을 주기적으로 보충해주어 폐경기 증상을 호전시키는 방법이다. 그러나 장기적인 호르몬 대체요법의 사용은 유방암 또는 뇌졸증 발생 등의 부작용이 알려져 있으며, 신체 증상으로 메스꺼움, 두통, 유방통, 복부팽만감, 부종 및 자궁출혈 등이 동반되고, 정신 증상으로 불안, 초조 및 우울증 등이 나타날 수 있다. 또한 이러한 호르몬 대체요법은 에스트로겐 분비 감소로 인한 다양한 증상들을 완전히 없애지 못한다는 한계가 있으며, 빈번한 검사를 해야 하는 번거로움과 거부감이 있다. 이에, 폐경기 증상들을 예방하거나 치료에 효과적이면서 부작용이 없는 치료법의 개발이 요구되고 있다.One of the representative methods used to prevent or treat the above menopausal symptoms is hormone replacement therapy treatment. The hormone replacement therapy treatment is a method of improving menopausal symptoms by periodically replenishing female hormones. However, the use of long-term hormone replacement therapy is known to have side effects such as breast cancer or stroke, accompanied by physical symptoms such as nausea, headache, breast pain, abdominal distension, edema and uterine bleeding, and mental symptoms such as anxiety, nervousness and depression. can appear In addition, such hormone replacement therapy has a limitation in that it cannot completely eliminate various symptoms caused by a decrease in estrogen secretion, and there is a hassle and rejection of frequent examinations. Accordingly, there is a demand for the development of a treatment that is effective in preventing or treating menopausal symptoms and has no side effects.

더불어 현재 구강건조증 치료를 위해서 많은 연구가 진행되고 있으나, 이의 근본적인 치료법이 개발되지 못하여 대중적인 치료법이 주로 시행되고 있다. 수분 섭취를 늘려 입안을 촉촉하게 유지시키고, 무설탕 껌씹기, 레몬향 음료 복용, 인공타액 사용, 구연산 첨가 양치 용액 등이 사용되고, 그 이외에 새로 개발된 스프레이용 타액 제재들과 전기 자극법이 시험적으로 사용되고 있으나, 그 효과가 일시적이고 한정적이지 못한 문제점이 있다. 현재 화학적 약물로서는 타액분비 촉진제로서 무스카린 수용체 효능제로서 알려진 아네톨 트리티온, 및 세비멜린 염산염이 사용되는데, 이들은 그 효과가 불안정하고 오심, 구토, 식욕감퇴, 복부 불쾌감과 같은 소화기계의 부작용 발생 가능성이 있는 등의 단점이 제기되고 있다. In addition, many studies are currently being conducted for the treatment of xerostomia, but popular treatments are mainly implemented because a fundamental treatment has not been developed. Increasing water intake to keep the mouth moist, chewing sugar-free gum, taking lemon-flavored drinks, using artificial saliva, and citric acid-added toothbrush solutions are used. In addition, newly developed spray saliva preparations and electrical stimulation are experimentally used. However, there is a problem that the effect is temporary and not limited. Currently, as chemical drugs, anethol trithione, known as a muscarinic receptor agonist, and cevimelin hydrochloride are used as salivary secretion stimulants, but these are unstable in their effects and cause side effects of the digestive system such as nausea, vomiting, loss of appetite, and abdominal discomfort. Possible disadvantages are raised.

따라서 폐경기 등 다양한 원인에 의한 구강건조증에 대해 효과적인 치료법의 개발이 요구되고 있다.Therefore, there is a need to develop an effective treatment for xerostomia caused by various causes such as menopause.

본 발명자들은 구강건조증, 특히 폐경에 의한 구강건조증에 대하여 효과적인 치료법에 대하여 연구하던 중, 폐경을 유발한 동물 모델에 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 처리하는 경우, 폐경에 의한 증상이 완화되고 저하된 침 분비 기능이 회복됨을 확인하여 본 발명을 완성하였다.While studying an effective treatment for xerostomia, especially xerostomia caused by menopause, the present inventors treated an animal model that caused menopause with extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells, symptoms caused by menopause. The present invention was completed by confirming that the alleviated and reduced salivary secretion function was restored.

따라서 본 발명의 목적은 구강건조증 예방 또는 치료용 약학 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating xerostomia.

본 발명의 다른 목적은 구강건조증 예방 또는 개선용 의약외품을 제공하는 것이다. Another object of the present invention is to provide a quasi-drug for preventing or improving dry mouth.

본 발명의 또 다른 목적은 구강건조증 예방 또는 개선용 식품 조성물을 제공하는 것이다. Another object of the present invention is to provide a food composition for preventing or improving dry mouth.

본 발명의 또 다른 목적은 타액 분비 증강용 의약외품을 제공하는 것이다. Another object of the present invention is to provide a quasi-drug for enhancing saliva secretion.

본 발명의 또 다른 목적은 타액 분비 증강용 식품 조성물을 제공하는 것이다.Another object of the present invention is to provide a food composition for enhancing saliva secretion.

상기 목적을 달성하기 위하여, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 치료용 약학 조성물을 제공한다.In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating xerostomia containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

또한 상기 다른 목적을 달성하기 위하여, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 의약외품을 제공한다.In addition, in order to achieve the above other object, the present invention provides a quasi-drug for preventing or improving xerostomia containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 식품 조성물을 제공한다.In addition, in order to achieve the above another object, the present invention provides a food composition for preventing or improving xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 의약외품을 제공한다.In addition, in order to achieve the above another object, the present invention provides a quasi-drug for enhancing salivary secretion containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

또한 상기 또 다른 목적을 달성하기 위하여, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 식품 조성물을 제공한다.In addition, in order to achieve the above another object, the present invention provides a food composition for enhancing salivary secretion comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체의 구강건조증, 특히 폐경에 의한 구강건조증의 개선 또는 치료 효과를 확인한 것으로, 상기 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체는 항염증 또는 항섬유화 miRNA를 다수 포함하고 있으며, 폐경을 유발한 동물 모델에 상기 세포외 소포체를 처리하였을 때 폐경에 의해 증가된 염증성 또는 항섬유화 인자의 발현이 감소되었고 저하된 침 분비 기능이 회복됨이 확인된 바, 이를 폐경에 의해 유발된 구강건조증을 포함한 다양한 원인의 구강건조증의 예방, 개선 또는 치료에 유용하게 활용할 수 있다.The present invention confirms the effect of improving or treating xerostomia, particularly xerostomia caused by menopause, of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells. Or, it contains a plurality of anti-fibrotic miRNAs, and when the extracellular vesicles are treated in an animal model that induces menopause, it is confirmed that the expression of inflammatory or anti-fibrotic factors increased by menopause is reduced and the reduced salivary function is restored. Bar, it can be usefully used for the prevention, improvement or treatment of xerostomia of various causes including xerostomia caused by menopause.

도 1은 본 발명에 따른 편도 유래 중간엽 줄기세포를 확인한 결과로, 도 1 중 A는 줄기세포 마커의 발현을 확인한 것이고, 도 1 중 B는 분화능을 확인한 것이다.
도 2는 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체를 확인한 결과로, 도 2 중 A는 분리한 세포외 소포체 중 살아있는 세포외 소포체를 확인한 것이고, 도 2 중 B는 세포외 소포체 마커의 발현을 확인한 것이며, 도 2 중 C는 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체의 농도를 나타낸 것이다.
도 3은 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체에 포함된 기능 물질을 확인한 결과로, 도 3 중 A는 항염증성(Anti-inflammatory) miRNA를 확인한 결과이고, 도 3 중 B는 항섬유화(anti-fibrotic) miRNA를 확인한 결과이다.
도 4는 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체와 지방 유래 중간엽 줄기세포로부터 분리된 세포외 소포체의 기능 물질을 비교한 결과로, 도 4 중 A는 항염증성(Anti-inflammatory) miRNA를 비교한 결과이고, 도 4 중 B는 항섬유화(anti-fibrotic) miRNA를 비교한 결과이다.
도 5는 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체의 단백질 분석 결과로, 25 종의 대표 단백질의 발현을 확인한 결과이다.
도 6은 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체가 폐경에 의한 침샘의 염증성 인자에 미치는 효과를 확인한 결과이다.
도 7은 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체가 폐경에 의한 침샘의 섬유화 관련 인자에 미치는 효과를 확인한 결과로, 도 7 중 A 및 B는 섬유화 관련 인자의 단백질 발현을 확인한 결과이고, 도 7 중 C 및 D는 섬유화 관련 인자의 mRNA 발현을 확인한 결과이다.
도 8은 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체가 폐경에 의해 저하된 침 분비 기능에 미치는 효과를 확인한 결과로, 도 8 중 A 및 B는 침 분비 기능 지표의 단백질 발현을 확인한 결과이고, 도 8 중 C 및 D는 침 분비 기능 지표의 mRNA 발현을 확인한 결과이다.
도 9는 섬광조영술(scintigraphy)을 이용하여 본 발명에 따른 편도 유래 중간엽 줄기세포로부터 분리한 세포외 소포체가 폐경에 의해 저하된 침 분비 기능에 미치는 효과를 확인한 결과로, 도 9 중 A는 구강건조증 유발 동물 모델(OVX)의 결과이며, 도 9 중 B는 본 발명에 따른 세포외 소포체 투여군(OVX+EXO)의 결과이다.Figure 1 is a result of confirming tonsillar-derived mesenchymal stem cells according to the present invention. In Figure 1, A confirms the expression of stem cell markers, and in FIG. 1 B confirms their differentiation potential.
Figure 2 is a result of confirming the extracellular vesicles isolated from the tonsil-derived mesenchymal stem cells according to the present invention. Expression of ER markers was confirmed, and C in FIG. 2 shows the concentration of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells according to the present invention.
Figure 3 is a result of confirming the functional substances contained in the extracellular vesicles isolated from the tonsil-derived mesenchymal stem cells according to the present invention, A in Figure 3 is the result of confirming the anti-inflammatory (Anti-inflammatory) miRNA, B is the result of confirming anti-fibrotic miRNA.
Figure 4 is a result of comparing functional substances of extracellular vesicles isolated from tonsil-derived mesenchymal stem cells and extracellular vesicles isolated from adipose-derived mesenchymal stem cells according to the present invention. It is a result of comparing -inflammatory) miRNA, and B in FIG. 4 is a result of comparing anti-fibrotic miRNA.
5 is a result of protein analysis of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells according to the present invention, confirming the expression of 25 representative proteins.
6 is a result of confirming the effect of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells according to the present invention on inflammatory factors of the salivary glands due to menopause.
7 is a result of confirming the effect of extracellular vesicles isolated from tonsil-derived mesenchymal stem cells according to the present invention on fibrosis-related factors in the salivary glands due to menopause. In FIG. 7, A and B show protein expression of fibrosis-related factors. This is the confirmed result, and C and D in FIG. 7 are the results of confirming the mRNA expression of fibrosis-related factors.
8 is a result of confirming the effect of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells according to the present invention on salivary secretion function reduced by menopause. , and C and D in FIG. 8 are results of confirming mRNA expression of salivary secretion function indicators.
9 is a result of confirming the effect of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells according to the present invention on salivary secretion function reduced by menopause using scintigraphy. This is the result of the dryness-induced animal model (OVX), and B in FIG. 9 is the result of the extracellular vesicles-administered group (OVX+EXO) according to the present invention.

이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 치료용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

본 발명에 있어서, “편도 유래 중간엽 줄기세포(tonsil mesenchymal stem cell, t-MSC)”는 편도 조직에서 유래된 중간엽 줄기세포를 의미한다. 상기 편도 유래 중간엽 줄기세포는 타 조직 유래 중간엽 줄기세포 대비 분화 속도가 빨라 치료제로의 사용 용량에 도달하기 용이한 장점이 있다. 줄기 세포 및 이로부터 유래된 물질의 투약 효과를 위해서는 치료 효과를 보이는 특정 수만큼 세포의 증식이 필요한데 편도 유래 중간엽 줄기세포를 배양하였을 때 세포가 부착되어 자라는 수준 또한 타 조직 유래 중간엽 줄기세포 대비 우수한 바, 원료인 세포의 준비에 드는 비용이 다른 조직 유래 중간엽 줄기세포보다 낮다. In the present invention, "tonsil mesenchymal stem cells (t-MSC) derived from tonsillar" means mesenchymal stem cells derived from tonsillar tissue. The amygdala-derived mesenchymal stem cells have a high differentiation rate compared to other tissue-derived mesenchymal stem cells, and thus have the advantage of being easy to reach the dose used as a therapeutic agent. For the administration effect of stem cells and substances derived from them, the proliferation of cells by a specific number to show a therapeutic effect is required. As an excellent bar, the cost of preparing cells as a raw material is lower than that of other tissue-derived mesenchymal stem cells.

또한 예시로서 지방 유래 중간엽 줄기세포의 경우, 배양을 위한 특수한 배지가 필요한 반면, 편도 유래 중간엽 줄기세포는 배양에 있어서, 상기와 같이 특수한 배지가 필요하지 않다.Also, as an example, in the case of adipose-derived mesenchymal stem cells, a special culture medium is required, whereas tonsillar-derived mesenchymal stem cells do not require a special medium as described above for culture.

또한, 본 발명의 일실시예와 같이 편도 절제술 등을 통해 버려지는 조직을 이용한다는 점에서 줄기세포 수득이 매우 용이하다. 상기 편도 절개술은 국내에서도 매년 수만 건씩 수행되고 있으나, 이를 통해 제거된 편도 조직은 활용되지 못하고 버려지는 실정이다. 이에 있어 본 발명은 기존 버려졌던 편도 조직의 활용과 더불어 비침습적으로 줄기세포를 얻을 수 있다는 장점이 있다. 또한 편도 유래 중간엽 줄기세포의 경우 조직의 단위 면적당 이용 가능한 줄기 세포의 수가 타 유래 줄기세포와 대비하여 매우 많기 때문에, 그 이용 가능성은 더욱 높다.In addition, as in one embodiment of the present invention, it is very easy to obtain stem cells in that tissue discarded through tonsillectomy or the like is used. Although tens of thousands of tonsillectomies are performed every year in Korea, the tonsil tissue removed through this is not utilized and is discarded. In this regard, the present invention has the advantage of obtaining stem cells non-invasively together with the utilization of previously discarded tonsil tissue. In addition, in the case of tonsillar-derived mesenchymal stem cells, since the number of usable stem cells per unit area of tissue is very large compared to other stem cells, the possibility of using them is higher.

더불어 본 발명은 편도 유래 중간엽 줄기세포 자체가 아닌, 이로부터 유래된 세포외 소포체를 이용하는 것을 특징으로 한다.In addition, the present invention is characterized by using extracellular vesicles derived therefrom, rather than tonsillar-derived mesenchymal stem cells themselves.

본 발명에 있어서, “세포외 소포체(extracellular vesicle, EV)는 세포가 세포외 환경에 방출하는 다양한 막(membrane) 유형의 소포체를 의미한다. 세포외 소포체는 세포막의 구조와 동일한 이중인지질막으로 이루어진 수십 내지 수백 나노미터 크기의 소포체로서 내부에는 세포외 소포체 카고(cargo)라고 불리는 단백질, 핵산(mRNA, miRNA 등) 등이 포함되어 있다. 세포외 소포체 카고에는 광범위한 신호전달 요소들(signaling factors)이 포함되며, 이들 신호전달 요소들은 세포 타입에 특이적이고 분비세포의 환경에 따라 상이하게 조절되는 것으로 알려져 있다. In the present invention, “extracellular vesicles (EVs) refer to various membrane-type vesicles that cells release into the extracellular environment. Extracellular vesicles are tens to hundreds of nanometers in size made of a double-phospholipid membrane identical to the structure of cell membranes, and contain proteins, nucleic acids (mRNA, miRNA, etc.) called extracellular vesicle cargo inside. It is known that the extracellular endoplasmic reticulum cargo contains a wide range of signaling factors, and these signaling factors are specific to cell types and differently regulated depending on the environment of the secreting cell.

상기 세포외 소포체는 크게 엑소좀(exosomes)과 마이크로베시클(microvesicles)로 분류된다. 엑소좀은 크기가 50-150 nm로, 다중 소포 엔도좀(multi-vesicular endosomes)이 성숙하는 과정에서 엔도좀 막이 안쪽으로 들어와 생성된 내강 소낭(intraluminal vesicles)이며, 다중 소포 엔도좀이 세포 표면과 결합할 때 분비된다. 마이크로베시클은 크기가 50-1000 nm로, 원형질막(plasma membrane)이 바깥으로 솟아나와 분리되어 세포 밖으로 분비되는 소낭이다. 본 발명에 있어서, 세포외 소포체는 상기 엑소좀과 마이크로베시클을 모두 포함하는 것을 의미할 수 있다.The extracellular vesicles are largely classified into exosomes and microvesicles. Exosomes are 50-150 nm in size and are intraluminal vesicles formed by the endosome membrane coming in during the maturation process of multi-vesicular endosomes. secreted upon mating. Microvesicles are vesicles with a size of 50-1000 nm, and the plasma membrane protrudes to the outside and is separated and secreted out of the cell. In the present invention, extracellular vesicles may mean that they include both the exosomes and microvesicles.

세포외 소포체를 통해 전달된 다양한 세포 신호는 표적 세포의 활성화, 성장, 이동, 분화, 탈분화, 사멸(apoptosis), 괴사(necrosis)를 포함한 세포 행동을 조절한다고 알려져 있다. 세포외 소포체는 유래된 세포의 성질 및 상태에 따라 특이적인 유전물질과 생체활성 인자들이 포함되어 있다. 증식하는 줄기세포 유래 세포외 소포체의 경우 세포의 이동, 증식 및 분화와 같은 세포 행동을 조절하고, 조직 재생과 관련된 줄기세포의 특성이 반영되어 있다(Nature Review Immunology 2002 (2) 569-579 참고).It is known that various cell signals transmitted through extracellular endoplasmic reticulum regulate cell behavior including activation, growth, migration, differentiation, dedifferentiation, apoptosis, and necrosis of target cells. Extracellular vesicles contain specific genetic materials and bioactive factors depending on the nature and state of the derived cell. Proliferating stem cell-derived extracellular vesicles regulate cell behavior such as cell migration, proliferation, and differentiation, and reflect the characteristics of stem cells related to tissue regeneration (see Nature Review Immunology 2002 (2) 569-579). .

그러나 본 발명과 같이, 특정한 중간엽 줄기세포 즉, 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체의 구강건조증 개선 또는 치료 효과에 대해서는 보고된 바 없다.However, as in the present invention, there has been no report on the effect of improving or treating xerostomia of extracellular vesicles isolated from specific mesenchymal stem cells, that is, tonsillar-derived mesenchymal stem cells.

중간엽 줄기세포 자체를 이용하는 경우, 중간엽 줄기세포를 정맥 내 투여하면서 발생하는 색전을 포함한 물리적 장애와 동종세포를 이식할 때 발생하는 면역반응으로 인한 효능의 저하와 이상반응이 야기될 수 있다. 하지만 편도 유래 중간엽 줄기세포 자체가 아닌, 이로부터 분리된 세포외 소포체를 이용하는 본 발명은 상기와 같은 문제가 발생되지 않는다는 장점이 있다.In the case of using mesenchymal stem cells themselves, a decrease in efficacy and adverse reactions due to physical disorders including embolism occurring during intravenous administration of mesenchymal stem cells and an immune response occurring during transplantation of allogeneic cells may occur. However, the present invention using extracellular vesicles isolated from tonsil-derived mesenchymal stem cells rather than the mesenchymal stem cells themselves has the advantage that the above problems do not occur.

한편, 세포외 소포체를 활용한 치료제 개발에 있어서, 동일한 세포로부터 얻을 수 있는 세포외 소포체의 양이 치료용으로 생산하기에는 부족하다는 기술적 한계점이 있다. 이에 있어, 편도 유래 중간엽 줄기세포는 타 조직 유래 세포와 비교했을 때 세포 노화없이 20계대 이상 배양이 가능하며 증식율이 높기 때문에 세포외 소포체 수득 면에서 상기 기술적 한계점을 극복할 수 있다는 장점이 있다. 또한, 타 조직 유래 줄기세포는 대부분 고가의 배양액에서 배양을 해야 증식율이 유지되는 반면 편도 유래 중간엽 줄기세포는 기본 배양액에서도 증식율이 유지된다는 점에서 향후 경제적인 측면에서도 장점이 있을 것으로 기대된다. On the other hand, in developing a therapeutic agent using extracellular vesicles, there is a technical limitation that the amount of extracellular vesicles obtained from the same cell is insufficient to produce for treatment. In this regard, tonsillar-derived mesenchymal stem cells have the advantage of overcoming the above technical limitations in terms of obtaining extracellular vesicles because they can be cultured for more than 20 passages without cell senescence and have a high proliferation rate compared to cells derived from other tissues. In addition, stem cells derived from other tissues are mostly cultured in expensive culture medium to maintain proliferation rate, whereas tonsil-derived mesenchymal stem cells maintain proliferation rate even in basic culture medium.

본 발명의 일실시예에 따르면, 폐경을 유발한 동물 모델에 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 투여하는 경우, 침샘에서 폐경에 의해 증가된 염증 및 섬유화 관련 인자의 발현이 감소된 것을 확인하였다. According to one embodiment of the present invention, when extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells are administered to an animal model that induces menopause, the expression of factors related to inflammation and fibrosis increased by menopause in the salivary gland is reduced. confirmed that

더불어 본 발명에 또다른 실시예에 따르면, 폐경을 유발한 동물 모델에 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 투여하는 경우, 침샘에서 침 분비의 기능 지표인 α-아밀라아제(α-amylase) 및 AQP5(Aquaporin-5)의 발현이 회복되는 것을 확인하였다.In addition, according to another embodiment of the present invention, when extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells are administered to an animal model that induces menopause, α-amylase (α-amylase, a functional indicator of salivary secretion in the salivary glands) ) and expression of AQP5 (Aquaporin-5) was confirmed to be restored.

상기 α-아밀라아제는 타액에서 찾을 수 있는 대표적인 소화효소로서 초기 전분을 분해하는 역할을 한다. α-아밀라아제는 랫트의 췌장 선포세포에서 단백질 분비에 관여하는 세포 기관 또는 침샘의 선포 세포 및 선관 세포에서 발현되는 것으로 보고되었으며, 침샘의 기능을 판단할 수 있는 바람직한 표지자로서 사용될 수 있다.The α-amylase is a representative digestive enzyme found in saliva and serves to decompose initial starch. α-amylase has been reported to be expressed in organelles involved in protein secretion in rat pancreatic acinar cells or in acinar cells and glandular cells of the salivary gland, and can be used as a desirable marker for determining the function of the salivary gland.

더불어 상기 AQP5는 타액을 분비하는 선포 세포의 끝쪽막에서 발현되는 주요 수송 단백질이다. AQP5은 물을 특이적으로 수송하는 역할을 하여 타액의 99%를 차지하는 물을 분비하는데 있어 필수적인 요소로 작용한다. 구강건조증의 주요 원인으로 꼽히는 쇼그렌 증후군과 같은 자가면역질환 및 비-비만성 당뇨병 마우스에서 AQP5의 발현이 감소되는 것이 보고된 바 있다.In addition, AQP5 is a major transport protein expressed in the terminal membrane of salivary-secreting acinar cells. AQP5 plays a role in transporting water specifically and acts as an essential element in secreting water, which accounts for 99% of saliva. It has been reported that the expression of AQP5 is reduced in autoimmune diseases such as Sjogren's syndrome, which is considered a major cause of xerostomia, and in non-obese diabetic mice.

따라서 본 발명에 따르면 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체는 상기 α-아밀라아제 및 AQP5의 발현을 증가시키는 바, 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체는 폐경에 의해 유발된 구강건조증을 포함한 다양한 원인의 구강건조증의 예방, 개선 또는 치료용 조성물로 활용될 수 있다.Therefore, according to the present invention, the extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells increase the expression of α-amylase and AQP5, and the extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells increase oral vesicles induced by menopause. It can be used as a composition for preventing, improving or treating xerostomia of various causes including xerostomia.

본 발명의 약학 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. The pharmaceutical composition of the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories and sterile injection solutions according to conventional methods, respectively. . Carriers, excipients, and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, and cellulose. , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient, such as It is prepared by mixing starch, calcium carbonate, sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, solutions for oral use, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.

본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 0.1㎎/㎏/일 내지 1000㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 제한하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, and weight of the subject to be treated, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. Determination of dosage based on these factors is within the level of those skilled in the art, and generally dosages range from 0.01 mg/kg/day to approximately 2000 mg/kg/day. A more preferred dosage is 0.1 mg/kg/day to 1000 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way.

본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, and humans through various routes. All modes of administration are contemplated, eg oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine intrathecal or intracerebrovascular injection.

본 발명의 약학 조성물의 비경구 투여를 위한 형태로는 치약, 구강세정제, 국소 투여제(크림, 연고, 드레싱 용액, 분무제, 기타 도포제등) 등을 들 수 있다. 상기 국소 투여제의 제형의 일 예로는, 본 발명에 따른 구강건조증 예방 또는 치료용 약학 조성물을 수용성 고분자를 포함하는 필름 또는 패치에 고정하여 치아 및 주변부위에 부착할 수 있도록 제형화한 것일 수 있다.Forms for parenteral administration of the pharmaceutical composition of the present invention include toothpaste, mouthwash, topical administration agents (creams, ointments, dressing solutions, sprays, other coating agents, etc.). As an example of the formulation of the topical administration agent, the pharmaceutical composition for preventing or treating xerostomia according to the present invention may be fixed to a film or patch containing a water-soluble polymer and formulated to be attached to teeth and surrounding areas. .

본 발명에 있어서, 구강건조증 예방 또는 치료용 약학 조성물은 유효성분 이외에, 구강건조증 치료 효과의 상승, 보강을 위하여 구강건조증 치료 또는 타액 분비 증강, 촉진 활성을 가지며 안전성이 검증된 임의의 화합물이나 천연 추출물을 추가로 포함할 수 있다.In the present invention, the pharmaceutical composition for preventing or treating xerostomia has, in addition to the active ingredient, any compound or natural extract whose safety has been verified to have an activity to treat xerostomia or to enhance or promote saliva secretion in order to increase or reinforce the effect of xerostomia treatment. may additionally be included.

더불어 본 발명의 약학 조성물은 구강건조증의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.In addition, the pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of xerostomia.

본 발명에서 사용되는 용어 "투여"는 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.As used herein, the term "administration" means providing a given composition of the present invention to a subject by any suitable method.

본 발명에 있어서, 용어 "예방"이란, 본 발명에 따른 구강건조증 예방 또는 치료용 약학 조성물을 개체에 투여하여 구강건조증의 발병을 억제하거나 지연시키는 모든 행위를 의미할 수 있다.In the present invention, the term "prevention" may refer to any action that suppresses or delays the onset of xerostomia by administering the pharmaceutical composition for preventing or treating xerostomia according to the present invention to a subject.

본 발명에 있어서, 용어 "치료"란, 본 발명에 따른 조성물을 구강건조증 의심 개체에 투여하여 구강건조증 또는 관련 질환의 증세가 호전되도록 하거나 이롭게 되도록 하는 모든 행위를 의미할 수 있다.In the present invention, the term "treatment" may refer to any action that improves or benefits the symptoms of xerostomia or related diseases by administering the composition according to the present invention to a subject suspected of xerostomia.

본 발명에 있어서, 용어 "개선"이란, 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다.In the present invention, the term "improvement" may mean any activity that at least reduces a parameter related to a condition to be treated, for example, the severity of a symptom.

또한 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 의약외품을 제공한다.In addition, the present invention provides a quasi-drug for preventing or improving xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

본 발명에 있어서, “타액(saliva)”이란 침이라고도 하며, 입속의 침샘(타액선)에서 분비되는 무색의 점성의 소화액을 의미한다. 일반적인 경우, 정상인에서 24시간 동안 분비되는 침의 양은 약 1000 ~ 1500㎖이다. 보통, 자율신경에 의해 자극받지 않았을 경우 1 분당 0.001~0.2㎖를 생성하며, 자극을 받으면 분당 0.18~1.7㎖로 유출량이 증가하는데, 분당 평균 분비량이 1㎖ 정도이다. 약 99%가 수분이며, 다양한 무기물을 포함하고 있다.In the present invention, "saliva" is also referred to as saliva, and means a colorless viscous digestive fluid secreted from the salivary glands (salivary glands) in the mouth. In general, the amount of saliva secreted for 24 hours in a normal person is about 1000 to 1500 ml. Normally, when not stimulated by the autonomic nerve, 0.001 to 0.2 ml per minute is produced, and when stimulated, the output increases to 0.18 to 1.7 ml per minute, with an average secretion of about 1 ml per minute. It is about 99% water and contains various minerals.

본 발명에 따르면 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체는 저하된 침(타액) 분비 기능을 회복시킬 수 있는 바, 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 의약외품을 제공한다.According to the present invention, the extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells can restore the reduced function of saliva secretion. It provides a quasi-drug for enhancing salivary secretion comprising a.

상기 의약외품은 치약, 양치액, 구강 세척제, 껌, 구강 스프레이, 구강용 젤, 구강 연고제, 마스크, 습포제, 첩부제 및 경피흡수제로 이루어진 군에서 선택된 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니다. 또한 상기 의약외품은 칫솔, 치실, 치간칫솔, 혀클리너, 구강용 티슈 등의 구강 위생용품에 적용될 수 있다.The quasi-drug may be at least one selected from the group consisting of toothpaste, mouthwash, mouthwash, gum, oral spray, oral gel, oral ointment, mask, poultice, patch, and percutaneous absorbent, but is not limited thereto. In addition, the quasi-drug may be applied to oral hygiene products such as toothbrushes, dental floss, interdental brushes, tongue cleaners, and oral tissues.

본 발명에 있어서, 용어 “의약외품”은 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미한다. 예를 들어, 약사법에 따른 의약외품은 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람/동물의 질병 치료나 예방에 쓰이는 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않는 제품 등이 포함된다.In the present invention, the term “quasi-drugs” refers to articles that have a milder action than pharmaceuticals among articles used for the purpose of diagnosing, treating, improving, mitigating, treating, or preventing human or animal diseases. For example, quasi-drugs under the Pharmaceutical Affairs Act exclude items used for pharmaceutical purposes, and include products used for the treatment or prevention of human/animal diseases, products with minor or no direct action on the human body, and the like.

본 발명에 따른 상기 조성물을 의약외품 첨가물로 사용할 경우, 상기 조성물을 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합량은 사용 목적에 따라 적합하게 결정될 수 있다. 상기 의약외품은 구강건조증 치료에 보조적으로 사용될 수 있으며, 구강건조증 치료제와 함께, 동시에 또는 순차적으로 투여 가능하다.When the composition according to the present invention is used as a quasi-drug additive, the composition may be added as it is or used together with other quasi-drugs or quasi-drug ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use. The quasi-drug may be used as an adjunct to the treatment of xerostomia, and may be administered simultaneously or sequentially together with a treatment for xerostomia.

상기 본 발명의 의약외품이 치약인 경우, 유효성분으로 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 포함하는 것 외에, 연마제, 점결제, 보습제, 발포제, 감미료, 미백제 또는 향미제를 추가로 포함할 수 있다.When the quasi-drug of the present invention is toothpaste, in addition to containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient, it further contains an abrasive, binder, moisturizer, foaming agent, sweetener, whitening agent, or flavoring agent can do.

상기 연마제로는 수산화알루미늄, 무수규산, 규산알루미늄, 제2인산칼슘 2 수산화물 및 무수물, 제3인산칼슘, 탄산칼슘, 피로인산칼슘, 불용성 메타인산나트륨, 제3인산마그네슘, 탄산마그네슘, 황산칼슘, 폴리메타아크릴산메틸, 등을 단독 또는 복합적으로 사용할 수 있다. 상기 연마제의 함량은 전체 조성물을 기준으로 통상 20 중량% 내지 90 중량%일 수 있으나, 상기 함량에 의해 한정되는 것은 아니다. 상기 의약외품이 페이스트상 조성물일 경우에는 상기 점결제는 가라기닌, 각종 점증용 셀룰로오스 유도체, 잔탄검, 트라가칸트 검(tragacanth gum) 등의 검류, 폴리비닐 알콜, 폴리아크릴산 나트륨, 폴리아크릴산/말레인산 공중합체, 카르복시비닐 폴리머 등의 합성 고분자 유도체 등의 유기계 점결제와 실리카, 라포나이트 등의 무기계 점결제 등을 단독 또는 복합적으로 사용할 수 있다. 상기 점결제의 함량은 전체 조성물을 기준으로 통상 0.3 중량% 내지 5 중량%일 수 있으나, 상기 함량에 의해 제한되는 것은 아니다. The abrasive includes aluminum hydroxide, silicic anhydride, aluminum silicate, dibasic calcium phosphate dihydroxide and anhydride, tribasic calcium phosphate, calcium carbonate, calcium pyrophosphate, insoluble sodium metaphosphate, tribasic magnesium phosphate, magnesium carbonate, calcium sulfate, Polymethyl methacrylate and the like can be used alone or in combination. The content of the abrasive may be 20% by weight to 90% by weight based on the total composition, but is not limited by the content. When the quasi-drug is a paste composition, the binder is garagenin, various cellulose derivatives for thickening, gums such as xanthan gum and tragacanth gum, polyvinyl alcohol, sodium polyacrylate, polyacrylic acid/maleic acid air Organic caking agents such as polymers and synthetic polymer derivatives such as carboxyvinyl polymers and inorganic caking agents such as silica and laponite may be used alone or in combination. The content of the binder may be 0.3% to 5% by weight based on the total composition, but is not limited by the content.

또한, 상기 의약외품에는 그 제조시 보습제로 솔비톨, 글리세린, 에틸렌글리콜, 프로필렌글리콜, 폴리에테르 글리콜, 폴리프로필렌 글리콜 등을 추가로 포함할 수 있다.In addition, the quasi-drug may further include sorbitol, glycerin, ethylene glycol, propylene glycol, polyether glycol, polypropylene glycol, etc. as a moisturizing agent during its preparation.

또한, 상기 의약외품에는 향료 또는 감미제 등을 추가로 포함할 수 있다. 상기 감미제는 수크로즈, 락토오즈, 말토오즈, 솔비톨, 크실리톨, 나트륨시클라메이트, 글리세린, 사카린나트륨, 스테비오사이드, 아스파탐 등일 수 있고, 상기 향료는 페퍼민트, 멘톨, 아네톨, 오이게놀, 리모넨, 시트로네놀, 알파터피네올, 살리실메틸, 시네올, 리나롤, 에틸리나롤, 바닐린, 티몰, 스피아민트유, 세지유, 로즈마리유, 계피유 등일 수 있으며, 상기 감미제 또는 향료는 단독으로 또는 복합적으로 사용될 수 있다.In addition, the quasi-drug may further include a flavoring agent or a sweetener. The sweetening agent may be sucrose, lactose, maltose, sorbitol, xylitol, sodium cyclamate, glycerin, sodium saccharin, stevioside, aspartame, etc., and the flavoring agent may be peppermint, menthol, anethol, eugenol, It may be limonene, citronenol, alpha terpineol, salicylmethyl, cineol, linalol, ethyllinalol, vanillin, thymol, spearmint oil, seji oil, rosemary oil, cinnamon oil, etc., and the sweetener or flavoring agent is alone can be used singly or in combination.

또한, 본 발명의 의약외품에는 발포성분으로 사용되는 계면활성제나 추가 효능성분이 단독으로 또는 복합적으로 포함될 수 있으며, 상기 발포성분으로 사용되는 계면활성제는 음이온 계면활성제, 비이온 계면활성제 및 양이온 계면활성제로 이루어진 군에서 선택된 어느 하나일 수 있고, 보다 구체적으로는 음이온성 계면활성제인 라우릴황산나트륨, 비이온성 계면활성제인 폴리옥시에틸렌폴리옥시프로필렌의 공중합체(폴록사머), 폴리옥시에틸렌경화피마자유, 폴리옥시에틸렌솔비탄 지방산에스테르 등이 제한없이 사용될 수 있다.In addition, the quasi-drug of the present invention may include a surfactant used as a foaming component or an additional effective component alone or in combination, and the surfactant used as the foaming component is an anionic surfactant, a nonionic surfactant, and a cationic surfactant. It may be any one selected from the group consisting of sodium lauryl sulfate as an anionic surfactant, a copolymer of polyoxyethylene polyoxypropylene as a nonionic surfactant (poloxamer), polyoxyethylene hydrogenated castor oil, poly Oxyethylene sorbitan fatty acid esters and the like can be used without limitation.

더불어 본 발명의 의약외품이 치약인 경우에는, 유효성분으로 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 포함하는 것을 제외하고는 통상적인 치약 제조방법으로 제조될 수 있으며, 본 발명의 의약외품이 구강 세척제(세정제)인 경우에는 통상적인 용액제에 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 혼합하고 구강 세척제로 제형화하여 제조될 수 있으며, 하루 2 내지 10회 구강을 세척함으로써 구강건조증을 예방 또는 개선할 수 있다.In addition, when the quasi-drug of the present invention is a toothpaste, it can be manufactured by a conventional toothpaste manufacturing method, except that it contains extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient, and the quasi-drug of the present invention is In the case of a cleaning agent (cleaning agent), it can be prepared by mixing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells with a conventional solution and formulating it as a mouthwash, and by washing the mouth 2 to 10 times a day, dry mouth is relieved. can be prevented or improved.

또한, 본 발명의 의약외품이 구강 세척제(세정제)인 경우에는, 치약 담체, 보다 상세하게는 비독성 알콜을 추가로 포함할 수 있다. 본 발명에 있어서, 상기 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체는 조성물 총 중량 대비 0.00001 내지 10 중량%로 포함될 수 있으며, 바람직하게는 조성물 총 중량 대비 0.0005 내지 5중량%로 포함될 수 있고, 더욱 바람직하게는 조성물 총 중량 대비 0.005 내지 1중량%로 포함될 수 있으나 이에 제한되는 것은 아니다.In addition, when the quasi-drug of the present invention is a mouthwash (wash), it may further include a toothpaste carrier, more specifically, a non-toxic alcohol. In the present invention, the extracellular vesicles isolated from the tonsil-derived mesenchymal stem cells may be included in an amount of 0.00001 to 10% by weight based on the total weight of the composition, preferably 0.0005 to 5% by weight based on the total weight of the composition, More preferably, it may be included in 0.005 to 1% by weight based on the total weight of the composition, but is not limited thereto.

더불어 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for preventing or improving xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

또한 본 발명은 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for enhancing salivary secretion comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.

본 발명에 따른 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food), 건강기능식품(health functional food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다.The food composition according to the present invention includes all forms such as functional food, nutritional supplement, health food, health functional food and food additives. .

본 발명에 있어서, 용어 "건강기능식품"이란 건강보조의 목적으로 특정성분을 원료로 하거나 식품 원료에 들어있는 특정성분을 추출, 농축, 정제, 혼합 등의 방법으로 제조, 가공한 식품을 말하며, 상기 성분에 의해 생체 방어, 생체리듬의 조절, 질병의 방지와 회복 등 생체조절기능을 생체에 대하여 충분히 발휘할 수 있도록 설계되고 가공된 식품을 말하는 것으로서, 질병의 예방 또는 건강의 회복 등과 관련된 기능을 수행할 수 있는 것을 말한다.In the present invention, the term "health functional food" refers to a food prepared and processed by extracting, concentrating, refining, mixing, etc., a specific ingredient as a raw material or a specific ingredient contained in a food raw material for the purpose of health supplementation, It refers to food designed and processed to sufficiently exert biological control functions such as biological defense, regulation of biological rhythm, prevention and recovery of disease, etc. by the above components, and performs functions related to disease prevention or health recovery. say what you can do

본 발명에 따른 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.The food composition according to the present invention can be prepared in various forms according to conventional methods known in the art.

예를 들면, 건강식품으로는 본 발명의 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체 자체를 과립화, 캡슐화 및 분말화하여 섭취하거나 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 할 수 있다. 또한, 본 발명의 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 구강건조증 치료 또는 타액 분비 증강 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.For example, as a health food, the extracellular vesicles themselves isolated from the tonsil-derived mesenchymal stem cells of the present invention can be granulated, encapsulated, and powdered to be ingested, or prepared in the form of tea, juice, and drink to be consumed. . In addition, the extracellular vesicles isolated from the tonsillar-derived mesenchymal stem cells of the present invention can be mixed with a known substance or active ingredient known to have an effect of treating xerostomia or enhancing salivary secretion to prepare a composition.

또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지콘비이프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 첨가하여 제조할 수 있다.In addition, functional foods include beverages (including alcoholic beverages), fruits and their processed foods (e.g., canned fruit, bottled food, jam, marmalade, etc.), fish, meat, and their processed foods (e.g., ham, sausage corned beef, etc.) , breads and noodles (e.g. udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, retort It can be prepared by adding the extracellular vesicles isolated from the tonsil-derived mesenchymal stem cells of the present invention to food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.).

본 발명의 식품 조성물 중 본 발명의 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체의 바람직한 함유량으로는 이에 한정되지 않지만 예를 들어 최종적으로 제조된 식품 중 0.01 내지 80 중량%일 수 있으며, 바람직하게는 최종적으로 제조된 식품 중 0.01 내지 50 중량%일 수 있다.In the food composition of the present invention, the preferred content of the extracellular vesicles isolated from the tonsil-derived mesenchymal stem cells of the present invention is not limited thereto, but may be, for example, 0.01 to 80% by weight of the final food product, preferably. may be 0.01 to 50% by weight of the finally prepared food.

본 발명의 식품 조성물은 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100㎖ 당 일반적으로 약 0.01 내지 0.4g, 바람직하게는 약 0.02 내지 0.03g일 수 있다.The food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components. The aforementioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. . The proportion of the natural carbohydrate may be generally about 0.01 to 0.4 g, preferably about 0.02 to 0.03 g per 100 ml of the composition of the present invention.

상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 식품 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 본 발명의 조성물 100중량부 당 0.01 내지 0.1 중량부의 범위에서 선택되는 것이 일반적이나, 이에 제한되는 것은 아니다.In addition to the above, the food composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol , carbonation agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is generally selected from the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention, but is not limited thereto.

상술한 본 발명의 내용은 상호 모순되지 않는 한, 서로 동일하게 적용되며, 당해 기술분야의 통상의 기술자가 적절한 변경을 가해 실시하는 것 또한 본 발명의 범주에 포함된다.The contents of the present invention described above are equally applied to each other unless contradictory to each other, and implementation by adding appropriate changes by a person skilled in the art is also included in the scope of the present invention.

이하 본 발명을 실시예를 통해 상세하게 설명하나 본 발명의 범위가 하기 실시예로만 한정되는 것은 아니다. Hereinafter, the present invention will be described in detail through examples, but the scope of the present invention is not limited only to the following examples.

실시예 1. 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체 준비Example 1. Preparation of extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells

1-1. 편도 유래 중간엽 줄기세포 준비1-1. Preparation of tonsil-derived mesenchymal stem cells

편도제거 수술을 실시한 환자 2명의 편도를 사전 동의 아래 제공받아 편도 유래 중간엽 줄기세포(Tonsil-derived mesenchymal stem cells, TMSC)를 수득하였다. 보다 구체적으로, 편도 조직 샘플을 PBS(phosphate buffer saline)로 세척하고 0.075 %의 타입 I 콜라겐분해효소(type I collagenase)를 37 ℃에서 30분 동안 처리하였다. 이어서 10% FBS(Fetal Bovine Serum)를 포함하는 α-MEM을 처리한 후 1200xg에서 10분 동안 원심분리하여 세포를 수득하였다. 상기 수득한 세포를 100 U/ml의 페니실린(penicillin) 및 100 μg/ml의 스트렙토마이신(streptomycin)이 함유된 10 % FBS를 포함하는 α-MEM에 배양하여 편도 유래 중간엽 줄기세포를 수립하였다.Tonsil-derived mesenchymal stem cells (TMSCs) were obtained from the tonsils of two patients who underwent tonsillectomy under informed consent. More specifically, tonsillar tissue samples were washed with PBS (phosphate buffer saline) and treated with 0.075% type I collagenase at 37 °C for 30 minutes. Subsequently, cells were obtained by treatment with α-MEM containing 10% Fetal Bovine Serum (FBS) and centrifugation at 1200xg for 10 minutes. Tonsil-derived mesenchymal stem cells were established by culturing the obtained cells in α-MEM containing 10% FBS containing 100 U/ml of penicillin and 100 μg/ml of streptomycin.

이를 통해 수득한 편도 유래 중간엽 줄기세포를 TMSC#1 또는 TMSC#2로 각각 명명하였다. The tonsil-derived mesenchymal stem cells obtained through this were named TMSC#1 or TMSC#2, respectively.

더불어 FACS(Fluorescence activated cell sorter)를 이용하여 줄기세포의 마커인 CD73 및 CD74와 백혈구 및 면역세포 마커인 CD73과 CD74의 발현을 확인하였다. FACS는 다음과 같이 수행하였다. 0.5 % BSA(Bovine serum albumin)와 2 mmol/L EDTA(ethylenediaminetetraacetic acid)가 포함된 PBS에서 5×105 개의 편도 유래 중간엽 줄기세포와 줄기세포의 마커인 CD73 및 CD74와 백혈구 및 면역세포 마커인 CD73과 CD74의 FITC-접합 항체(BD Biosciences)를 반응시켰다. 형광표지된 세포는 FACS Caliber 유세포 분석기(BD Biosciences)를 사용하여 분석하였다.In addition, the expression of CD73 and CD74, which are markers of stem cells, and CD73 and CD74, which are markers of leukocytes and immune cells, were confirmed using FACS (Fluorescence activated cell sorter). FACS was performed as follows. In PBS containing 0.5% BSA (Bovine serum albumin) and 2 mmol/L EDTA (ethylenediaminetetraacetic acid), 5 × 10 5 tonsil-derived mesenchymal stem cells and stem cell markers CD73 and CD74 and leukocyte and immune cell markers FITC-conjugated antibodies (BD Biosciences) of CD73 and CD74 were reacted. Fluorescently labeled cells were analyzed using a FACS Caliber flow cytometer (BD Biosciences).

그 결과 도 1 중 A와 같이 줄기세포 마커인 CD73 및 CD74는 발현된 반면, CD45 및 CD31은 발현되지 않음을 확인하였다.As a result, as shown in A in FIG. 1, it was confirmed that CD73 and CD74, which are stem cell markers, were expressed, whereas CD45 and CD31 were not expressed.

또한 지방생성(adipogenesis), 골형성(osteogenesis), 연골형성(chondrogenesis) 유도용 배지를 사용하여 중배엽 세포로 분화능을 확인하였다.In addition, the differentiation ability into mesodermal cells was confirmed using a medium for inducing adipogenesis, osteogenesis, and chondrogenesis.

상기 지방생성으로의 분화능은 다음과 같이 확인하였다. 지방생성 배지 (10 % FBS, 1uM 덱사메타손(dexamethasone), 100 μg/ml 3-이소부틸-1 메틸잔틴(3-isobutyl-1 methylxanthine), 5μg/ml 인슐린(insulin), 60μM 인도메타신(indomethacin)이 포함된 α-MEM)에서 3주 동안 배양하여 지방생성을 유도하였다. 이를 세포 내 지질 축적의 지표인 오일 레드 O(Oil Red O (Sigma))로 염색하여 지방세포로 분화 여부를 확인하였다. The ability to differentiate into adipogenesis was confirmed as follows. Adipogenic medium (10% FBS, 1uM dexamethasone, 100 μg/ml 3-isobutyl-1 methylxanthine, 5 μg/ml insulin, 60 μM indomethacin Adipogenesis was induced by culturing in α-MEM) for 3 weeks. It was stained with Oil Red O (Sigma), which is an indicator of intracellular lipid accumulation, to confirm differentiation into adipocytes.

상기 골형성으로의 분화능은 다음과 같이 확인하였다. 또한 골 형성 배지 (10 % FBS, 0.1 mM 덱사메타손, 10 μM β-글리세로포스페이트(β-glycerophosphate) 및 50 μg/mL 아스코르브 산(ascorbic acid)이 포함된 α-MEM)에서 3주 동안 배양하여 골 형성을 유도하였다. 이를 알리자린 레드 S(Alizarine Red S (Sigma))로 염색하여 골세포로의 분화 여부를 확인하였다. The differentiation ability into the osteogenesis was confirmed as follows. In addition, it was cultured in osteogenic medium (α-MEM containing 10% FBS, 0.1 mM dexamethasone, 10 μM β-glycerophosphate and 50 μg/mL ascorbic acid) for 3 weeks to formation was induced. The cells were stained with Alizarine Red S (Sigma) to determine whether they were differentiated into osteocytes.

상기 연골형성으로의 분화능은 다음과 같이 확인하였다. 연골형성 배지는 마이크로 매스(micro mass) 배양 기술을 사용하여 유도하였다. 보다 구체적으로 10 μL의 농축된 편도 유래 중간엽 줄기세포 현탁액 (3 ×105 cell/mL)을 각 웰의 중앙에 분주하고 플레이트 바닥에 부착되도록 2시간 동안 37 ℃에서 배양하였다. 그 후 연골 형성 배지(1 % FBS, 0.1 mM 덱사메타손(Sigma), 50 μg/mL 아스코르브 산, 인슐린-트랜스페린-셀레늄(insulin-transferrin-selenium(ITS + 1) (Sigma)) 및 10 ng/mL TGF-β1(Transforming growth factor beta 1) 이 포함된 α-MEM)를 부착된 세포의 결절이 박리되지 않도록 분주한 후 4주 동안 배양하였다. 콜라겐 타입 II 항체(Collagen Type II antibody)를 이용한 면역 염색으로 연골 형성 여부를 확인하였다. The differentiation ability into the chondrogenesis was confirmed as follows. Chondrogenic medium was induced using a micro mass culture technique. More specifically, 10 μL of a concentrated tonsil-derived mesenchymal stem cell suspension (3 × 10 5 cell/mL) was dispensed in the center of each well and cultured at 37° C. for 2 hours to attach to the bottom of the plate. Then, chondrogenic medium (1% FBS, 0.1 mM dexamethasone (Sigma), 50 μg/mL ascorbic acid, insulin-transferrin-selenium (ITS + 1) (Sigma)) and 10 ng/mL TGF α-MEM containing -β1 (Transforming growth factor beta 1) was dispensed so that nodules of attached cells would not be peeled off, and then cultured for 4 weeks. Cartilage formation was confirmed by immunostaining using a collagen type II antibody.

그 결과 도 1 중 B와 같이, TMSC#1, TMSC#2는 모두 지방생성, 연골형성, 골형성 분화를 보여, 줄기세포로써의 기능을 가짐을 확인하였다.As a result, as shown in B in FIG. 1, both TMSC#1 and TMSC#2 showed adipogenic, chondrogenic, and osteogenic differentiation, confirming that they have functions as stem cells.

1-2. 편도 유래 중간엽 줄기세포로부터 세포외 소포체 분리1-2. Isolation of extracellular vesicles from tonsil-derived mesenchymal stem cells

상기 실시예 1-1의 3×107 cells의 편도 유래 중간엽 줄기세포로부터 세포외 소포체를 분리하였다. 상기 편도 유래 중간엽 줄기세포를 48시간 이상 배양하고 이를 2,000 xg에서 15분간 원심 분리하여 죽은 세포와 세포 파편을 제거하였다. 이어 10,000 xg에서 60분 동안 원심 분리한 후 상등액을 수득하였다. 상기 수득한 상등액을 0.22μm 기공의 필터로 여과하여 세포 파편과 큰 입자를 더 제거했다. 얻어진 상등액은 0.22μm 기공의 필터로 다시 여과한 후 Exo Quick-TC 키트(System Bioscience, MO, USA)를 사용하여 세포외 소포체를 분리하였다. 더불어 입자가 브라운 운동하에서 이동할 때 입자에서 산란된 빛을 확인하여 세포의 생존 여부를 확인하는 방법을 통해 상기 분리한 세포외 소포체 중 생존한 세포외 소포체를 확인하였다. 그 결과 도 2 중 A와 같이, TMSC#1, TMSC#2 유래 세포외 소포체에서 다수의 생존 세포외 소포체를 확인하였다. Extracellular vesicles were isolated from tonsillar-derived mesenchymal stem cells of 3×10 7 cells of Example 1-1. The tonsil-derived mesenchymal stem cells were cultured for more than 48 hours and centrifuged at 2,000 xg for 15 minutes to remove dead cells and cell debris. Subsequently, the supernatant was obtained after centrifugation at 10,000 xg for 60 minutes. The obtained supernatant was filtered through a 0.22 μm pore filter to further remove cell debris and large particles. The obtained supernatant was filtered again with a 0.22 μm pore filter, and then extracellular vesicles were isolated using the Exo Quick-TC kit (System Bioscience, MO, USA). In addition, surviving extracellular vesicles among the separated extracellular vesicles were confirmed through a method of confirming cell survival by checking light scattered from the particles when the particles moved under Brownian motion. As a result, as shown in A in FIG. 2, a number of surviving extracellular vesicles were confirmed in the extracellular vesicles derived from TMSC#1 and TMSC#2.

1-3. 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체의 특성 확인1-3. Characterization of extracellular endoplasmic reticulum isolated from tonsillar-derived mesenchymal stem cells

더불어 세포외 소포체가 발현하는 특정 단백질을 확인하기 위하여, 상기 실시예 1-2에서 수득한 세포외 소포체에 있어서 일반적인 엑소좀 표면 마커인 HSP70, CD63, CD9, CD80의 발현 여부를 웨스턴블롯((Exo AB 키트) (1 : 1000) (System Biosciences, Palo Alto, CA, USA))으로 확인하였다. 그 결과 도 2 중 B와 같이, HSP70, CD63, CD9 및 CD80 마커가 모두 발현되었으므로, 상기 실시예 1-2에서 분리한 물질이 세포외 소포체임을 확인하였다. 더불어 NanoSight NS500 기기(Malvern Instruments, Amesbury, UK)를 이용하여 세포외 소포체의 미세 구조 및 크기 분포를 분석하였다. 그 결과 도 2 중 C와 같이, T-MSC에서 분리한 세포외 소포체는 50 내지 150nm 크기의 엑소좀을 포함하고 있음을 확인하였다. T-MSC#1 유래 세포외 소포체에 대한 FTLA(finite track length adjustment) 분포 값(평균 크기/농도)은 130.4 ± 2.1 nm이었고, TMSC#2 유래 세포외 소포체는 132.3 ± 2.2 nm였다. 일반적으로 엑소좀의 크기 범위는 50 내지 150nm이므로 T-MSC 유래 세포외 소포체는 엑소좀을 포함하고 있음을 확인하였다. 또한 TMSC#1 유래 세포외 소포체에 포함된 총 엑소좀 농도는 9.22e+010 ±7.64e+008 particles/ml이었고 TMSC#2 유래 세포외 소포체에 포함된 총 엑소좀 농도는 7.40e+010 ±1.60e+009 particles/ml로 확인되었다. In addition, in order to confirm the specific protein expressed by extracellular vesicles, Western blot (Exo AB kit) (1 : 1000) (System Biosciences, Palo Alto, CA, USA)). As a result, as shown in B in FIG. 2, since HSP70, CD63, CD9, and CD80 markers were all expressed, it was confirmed that the material isolated in Example 1-2 was an extracellular vesicle. In addition, the microstructure and size distribution of extracellular vesicles were analyzed using a NanoSight NS500 instrument (Malvern Instruments, Amesbury, UK). As a result, as shown in C in FIG. 2, it was confirmed that the extracellular vesicles isolated from T-MSC contained exosomes having a size of 50 to 150 nm. The finite track length adjustment (FTLA) distribution value (average size/concentration) for T-MSC#1-derived extracellular vesicles was 130.4 ± 2.1 nm, and TMSC#2-derived extracellular vesicles were 132.3 ± 2.2 nm. In general, since the size range of exosomes is 50 to 150 nm, it was confirmed that T-MSC-derived extracellular vesicles contain exosomes. In addition, the total concentration of exosomes contained in TMSC#1-derived extracellular vesicles was 9.22e+010 ± 7.64e+008 particles/ml, and the total concentration of exosomes contained in TMSC#2-derived extracellular vesicles was 7.40e+010 ± 1.60 particles/ml. It was identified as e+009 particles/ml.

이어서 본 발명에 따른 세포외 소포체에 포함된 기능 물질을 확인하기 위하여 NGS(Next Generation Sequencing)와 단백질체학(Proteomics) 분석을 수행하였다. NGS 라이브러리는 TailorMix Micro RNA 프로토콜(SeqMatic LLC, Fremont, CA)을 사용하였다. cDNA 라이브러리는 농축 PCR을 통해 증폭한 후, 바코드화하였고 최종 RNA 라이브러리는 Illumina NextSeq 500 플랫폼에서 시퀀싱을 통해 분석하였다. 그 결과 도 3에 나타낸 바와 같이, 본 발명에 따른 T-MSC 유래 세포외 소포체에는 92a-3P, 181a-5P, 21-5P 및 181b-5P 등의 항염증(anti-filammatory) miRNA와 107, 122-5P, 26a-5P, 133a 및 26b-5p 등의 항섬유화(anti-fibrotic) miRNA가 포함되어있음을 확인하였다. 또한 T-MSC 유래 세포외 소포체와 지방 중간엽 줄기세포(AD-MSC)로부터 상기 실시예 1-2와 동일한 방법으로 분리한 세포외 소포체에 포함된 기능 물질을 비교하여 도 4에 나타내었다. 그 결과, T-MSC 유래 세포외 소포체는 AD-MSC 유래 세포외 소포체와는 다른 다양한 항염증 및 항섬유화 miRNA를 보유함을 확인하였다.Subsequently, NGS (Next Generation Sequencing) and proteomics analysis were performed to confirm functional substances included in the extracellular vesicles according to the present invention. The NGS library used the TailorMix Micro RNA protocol (SeqMatic LLC, Fremont, CA). The cDNA library was amplified by enrichment PCR, then barcoded, and the final RNA library was analyzed by sequencing on an Illumina NextSeq 500 platform. As a result, as shown in FIG. 3, the T-MSC-derived extracellular vesicles according to the present invention contain anti-filammatory miRNAs such as 92a-3P, 181a-5P, 21-5P and 181b-5P and 107, 122 It was confirmed that anti-fibrotic miRNAs such as -5P, 26a-5P, 133a and 26b-5p were included. In addition, functional substances contained in T-MSC-derived extracellular vesicles and extracellular vesicles isolated from adipose mesenchymal stem cells (AD-MSC) in the same manner as in Example 1-2 are compared and shown in FIG. 4 . As a result, it was confirmed that T-MSC-derived extracellular vesicles possessed various anti-inflammatory and anti-fibrotic miRNAs different from those of AD-MSC-derived extracellular vesicles.

더불어, T-MSC 유래 세포외 소포체의 단백질을 확인하기 위해 단백질체학 분석을 수행하였다. ThermoFisher Q Exactive에 연결된 Waters NanoAcquity HPLC 시스템을 사용하여 나노 LC-MS/MS로 분석하였다. 그 결과 도 5와 같이, T-MSC 유래 세포외 소포체는 THBS1, FN1, A2M 등 높은 수준으로 발현하는 25종의 단백질을 비롯하여 150 종류 이상의 단백질을 보유하고 있음을 확인하였다. In addition, proteomics analysis was performed to confirm the proteins of T-MSC-derived extracellular vesicles. Analysis was performed by nano LC-MS/MS using a Waters NanoAcquity HPLC system coupled to a ThermoFisher Q Exactive. As a result, as shown in FIG. 5, it was confirmed that the T-MSC-derived extracellular vesicles had more than 150 proteins, including 25 proteins expressed at high levels, such as THBS1, FN1, and A2M.

실시예 2. 생체내(in vivo) 편도 유래 중간엽 줄기세포 유래 세포외 소포체의 효과 확인Example 2. Confirmation of effect of extracellular vesicles derived from tonsil-derived mesenchymal stem cells in vivo

2-1. 폐경 유도 구강건조증 동물 모델 준비2-1. Preparation of an animal model for menopause-induced xerostomia

흡입 마취 하에서 암컷 쥐의 양측 난소를 제거하여 구강건조증 동물 모델 확립하였다. 이때 설치류의 성적성숙이 완료되는 9주령의 암컷 쥐를 사용하였다. 이를 난소를 제거하지 않은 대조군(Sham), 폐경에 의한 구강건조증 유발 실험군(OVX), 폐경 유도 후 본 발명에 따른 세포외 소포체 투여군(OVX+EXO)으로 분류하였다. 상기 폐경 유도 후 본 발명에 따른 세포외 소포체 투여군(OVX+EXO)은 다음과 같이 준비하였다. 난소절제술과 동시에 턱밑침샘이 있는 부위를 절개하여 턱밑침샘을 노출한 후 이에 상기 실시예 1-2의 3×107개 T-MSC로부터 수득한 세포외 소포체를 직접 주사하였다. 그런 후 6주동안 사육하고 각 실험을 수행하였다. 폐경의 유발 여부는 랫트 에스트라디올 ELISA 키트(Rat Estradiol(E2) ELISA Kit (MyBioSource))를 사용하여 혈중 에스트로겐 농도가 감소됨을 통해 확인하였다.An animal model for xerostomia was established by removing both ovaries of female rats under inhalational anesthesia. At this time, 9-week-old female rats, when rodent sexual maturity was completed, were used. They were classified into a control group in which the ovaries were not removed (Sham), a xerostomia induced experimental group due to menopause (OVX), and an extracellular vesicle administration group according to the present invention after menopause induction (OVX+EXO). After the induction of menopause, the extracellular vesicles-administered group (OVX+EXO) according to the present invention was prepared as follows. Simultaneously with the ovariectomy, the submandibular salivary gland was exposed by exposing the submandibular salivary gland by incising the area where the submandibular salivary gland was located, and then the extracellular vesicles obtained from 3×10 7 T-MSCs of Example 1-2 were directly injected. After that, they were reared for 6 weeks and each experiment was performed. Whether or not menopause was induced was confirmed by reducing the blood estrogen concentration using a rat estradiol (E2) ELISA Kit (MyBioSource).

2-2. 침샘의 염증에 대한 효과 확인2-2. Confirmation of effect on salivary gland inflammation

상기 실시예 2-1에서 준비한, 세포외 소포체 투여 또는 비투여 폐경 유도 동물 모델에서 침샘의 염증에 대한 효과를 확인하여 도 6에 나타내었다.The effect on inflammation of the salivary glands in the menopause-induced animal model prepared in Example 2-1 with or without administration of extracellular vesicles was confirmed and shown in FIG. 6 .

이를 위하여 IL-6(Interleukin-6)에 대한 프라이머[정방향(Forward): 5'-ATCTGCCCTTCAGGAACAGC-3' 및 역방향(Reverse): 5'-GAAGTAGGGAAGGCAGTGGC-3']와 IL-1β(Interleukin-1β)에 대한 프라이머[정방향(Forward): 5'-(CCCCACTTGAAGCAGATGACC)-3' 및 역방향(Reverse): 5'-(CCCTAAGTACTGGTAGTCCGC)-3'] 및 종양괴사인자-α(tumor necrosis factor-α, TNFα)에 대한 프라이머[정방향: 5'-GGTCAACCTGCCCAAGTACT-3'및 역방향: 5'-CTCCAAAGTAGACCTGCCCG-3']를 사용한 Real-time PCR을 수행하였다. 상기 Real-time PCR은 95 ℃에서 10 분(1 회주기); 95 ℃에서 10 초; 60 ℃에서 30 초 (40 사이클)의 조건으로 수행하였다.To this end, primers for IL-6 (Interleukin-6) [Forward: 5'-ATCTGCCCTTCAGGAACAGC-3' and Reverse: 5'-GAAGTAGGGAAGGCAGTGGC-3'] and IL-1β (Interleukin-1β) Primers for [Forward: 5'-(CCCCACTTGAAGCAGATGACC)-3' and Reverse: 5'-(CCCTAAGTACTGGTAGTCCGC)-3'] and for tumor necrosis factor-α (TNFα) Real-time PCR was performed using primers [forward: 5'-GGTCAACCTGCCCAAGTACT-3' and reverse: 5'-CTCCAAAGTAGACCTGCCCG-3']. The real-time PCR was performed at 95 ° C. for 10 minutes (one cycle); 10 sec at 95 °C; It was performed at 60 °C for 30 seconds (40 cycles).

그 결과 대조군(SHAM)에 비해 구강건조증 유발 동물 모델(OVX)의 침샘에서 염증성 싸이토카인인 IL-6, IL-1β 및 TNFα mRNA의 발현량이 증가하였으나 세포외 소포체 투여군(OVX+EXO)에서는 모두 감소하였으며, 특히 TNFα의 경우 대조군(SHAM)과 유사할 정도로 현저히 감소되었음을 확인하였다.As a result, compared to the control group (SHAM), the expression levels of inflammatory cytokines IL-6, IL-1β and TNFα mRNA increased in the salivary glands of the xerostomia induced animal model (OVX), but all decreased in the extracellular vesicles administration group (OVX+EXO). , In particular, it was confirmed that TNFα was significantly reduced to a similar extent to that of the control group (SHAM).

2-3. 침샘의 섬유화에 대한 효과 확인2-3. Confirmation of effect on salivary gland fibrosis

상기 실시예 2-1에서 준비한, 세포외 소포체 투여 또는 비투여 폐경 유도 동물 모델에서 침샘의 섬유화에 대한 효과를 확인하여 도 7에 나타내었다.The effect on salivary gland fibrosis was confirmed in the menopause-induced animal model prepared in Example 2-1 with or without administration of extracellular vesicles and is shown in FIG. 7 .

이를 위하여 공지된 방법으로 마슨삼색 염색(Masson‘trichrome stain)을 수행하였으며, 섬유화의 지표인 콜라겐(Collagen)과 TGFβI(tumor growth factor βI)의 단백질 및 mRNA 발현을 확인하였다.To this end, Masson'trichrome staining was performed by a known method, and protein and mRNA expression of collagen and TGFβI (tumor growth factor βI), which are indicators of fibrosis, were confirmed.

이를 위하여 콜라겐 I에 대한 프라이머[정방향(Forward): 5'-(CAGGATGCAGTCCCTGAAAT)-3' 및 역방향(Reverse): 5'-(GAGGTGGCCTAGGTGGTGTA)-3'], 콜라겐 III에 대한 프라이머[정방향(Forward): 5'-(GGCCCTGTGTGTACTGGTCT)-3' 및 역방향(Reverse): 5' -(AGCATCAGAGGGAGTGAGGA)-3'], TGFβI에 대한 프라이머[정방향(Forward): 5'-AAGAAGTCACCCGCGTGCTA-3' 및 역방향(Reverse): 5'-TGTGTGATGTCTTTGGTTTTGTCA-3']와 TGFβII에 대한 프라이머[정방향(Forward): 5'-ATCGATGGCACCTCCACATATG-3' 및 역방향(Reverse): 5'-GCGAAGGCAGCAATTATCCTG-3']를 이용한 Real-time PCR법으로 콜라겐I, 콜라겐 III, TGFβI 및 TGFβII mRNA의 발현을 확인하였다. 상기 Real-time PCR은 상기 실시예 2-2와 동일한 조건으로 수행하였다. To this end, a primer for collagen I [Forward: 5'-(CAGGATGCAGTCCCTGAAAT)-3' and a reverse: 5'-(GAGGTGGCCTAGGTGGTGTA)-3'], a primer for collagen III [Forward: 5'-(GGCCCTGTGTGTACTGGTCT)-3' and Reverse: 5'-(AGCATCAGAGGGAGTGAGGA)-3'], primer for TGFβI [Forward: 5'-AAGAAGTCACCCGCGTGCTA-3' and Reverse: 5 Collagen I, The expression of collagen III, TGFβI and TGFβII mRNA was confirmed. The real-time PCR was performed under the same conditions as in Example 2-2.

그 결과, 대조군 (SHAM)에 비해 구강건조증 유발 동물 모델(OVX)의 침샘에서 콜라겐과 TGFβI의 단백질이 더 증가되었음을 확인하였다. 반면, 세포외 소포체 투여군(OVX+EXO)에서는 폐경에 의하여 증가되었던 콜라겐과 TGFβI의 단백질이 유의하게 감소함을 확인하였다. 또한 콜라겐I, III와 TGFβI, TGFβII의 mRNA 역시 구강건조증 유발 동물 모델(OVX)에서 증가하였으나, 세포외 소포체 투여군(OVX+EXO)에서 폐경에 의해 증가된 콜라겐I, III와 TGFβI, TGFβII의 mRNA 발현이 감소된 것을 확인하였다. 특히 콜라겐I 및 TGFβI mRNA가 유의미하게 감소되었음을 확인하였다. As a result, it was confirmed that collagen and TGFβI protein were more increased in the salivary glands of the xerostomia induced animal model (OVX) compared to the control group (SHAM). On the other hand, in the extracellular vesicles administration group (OVX+EXO), it was confirmed that collagen and TGFβI protein, which had been increased by menopause, decreased significantly. In addition, the mRNAs of collagen I, III, TGFβI, and TGFβII were also increased in the xerostomia induced animal model (OVX), but the mRNA expression of collagen I, III, TGFβI, and TGFβII increased by menopause in the extracellular vesicles administered group (OVX+EXO). This reduction was confirmed. In particular, it was confirmed that collagen I and TGFβI mRNA were significantly reduced.

2-4. 침샘의 침 분비 기능에 대한 효과 확인2-4. Confirmation of the effect on the secretion function of the salivary glands

상기 실시예 2-1에서 준비한, 세포외 소포체 투여 또는 비투여 폐경 유도 동물 모델에서 침샘의 침 분비 기능에 대한 효과를 확인하여 도 8에 나타내었다.The effect on salivary secretion function of the salivary glands in the menopause-induced animal model prepared in Example 2-1 with or without administration of extracellular vesicles was confirmed and shown in FIG. 8 .

이를 위하여 침 분비의 기능 지표인 AQP5(Aquaporin 5)에 대한 항체(Santa Cruz) 및 α-아밀라아제(α-amylase)에 대한 항체(Santa Cruz)를 사용하여 공지된 방법으로 면역염색법을 수행하였다.To this end, an antibody (Santa Cruz) to AQP5 (Aquaporin 5), a functional indicator of salivary secretion, and an antibody to α-amylase (α-amylase) Immunostaining was performed by a known method using an antibody (Santa Cruz).

그 결과 도 8 중 A 및 B와 같이, 구강건조증 유발 동물 모델(OVX)에서 침 분비 기능의 지표인 AQP5과 α-아밀라아제 단백질 발현이 감소되었음을 확인하였다. 반면, 세포외 소포체 투여군(OVX+EXO)에서 폐경에 의해 감소되었던 AQP5과 α-아밀라아제 단백질의 발현이 유의하게 증가함을 확인하였다. As a result, as shown in A and B in FIG. 8, it was confirmed that the expression of AQP5 and α-amylase protein, which are indicators of salivary secretion function, were reduced in the xerostomia induced animal model (OVX). On the other hand, it was confirmed that the expression of AQP5 and α-amylase protein, which had been decreased by menopause, increased significantly in the extracellular vesicles administration group (OVX+EXO).

더불어 AQP5 및 침 분비의 다른 기능 지표인 AQP3의 mRNA 발현을 확인하였다. In addition, the mRNA expression of AQP5 and AQP3, another functional indicator of salivary secretion, was confirmed.

AQP5에 대한 프라이머[정방향(Forward): 5'-CATGAACCCAGCCCGATCTT-3' 및 역방향(Reverse): 5'-AGAAGACCCAGTGAGAGGGG-3'] 및 침 분비의 다른 기능 지표인 AQP3에 대한 프라이머[정방향(Forward): 5'-AATTGTCTGGAGCCCACTTG-3' 및 역방향(Reverse): 5'-CAGCTTGATCCAGGGCTCTC-3']를 이용한 Real-time PCR법으로 AQP5 및 AQP3 mRNA의 발현을 확인하였다. 상기 Real-time PCR은 상기 실시예 2-2와 동일한 조건으로 수행하였다. Primers for AQP5 [Forward: 5'-CATGAACCCAGCCCGATCTT-3' and Reverse: 5'-AGAAGACCCAGTGAGAGGGG-3'] and primers for AQP3, another functional indicator of salivary secretion [Forward: 5 The expression of AQP5 and AQP3 mRNA was confirmed by real-time PCR using '-AATTGTCTGGAGCCCACTTG-3' and reverse: 5'-CAGCTTGATCCAGGGCTCTC-3']. The real-time PCR was performed under the same conditions as in Example 2-2.

그 결과 도 8 중 C에 나타낸 바와 같이, AQP5 및 AQP3 mRNA 역시 폐경에 의하여 감소되었으나, 세포외 소포체 투여군(OVX+EXO)에서 증가됨을 확인하였다.As a result, as shown in C in FIG. 8 , AQP5 and AQP3 mRNAs were also decreased by menopause, but increased in the extracellular vesicles administration group (OVX+EXO).

더불어 섬광조영술(scintigraphy)을 이용하여 침 분비 기능에 대하여 확인하였다. 보다 구체적으로, 상기 실시예 2-1의 동물 모델을 흡입 마취시킨 후, 침 분비를 촉진하는 것으로 알려진 필로카핀(pilocarpine)을 복강 주사하였다. 그런 후 꼬리 정맥에 침샘에 흡수되는 것으로 알려진 TC99(Technetium-99)를 주사하였다. 이를 인피니아 감마(Infinia γ) 카메라로 30분동안 촬영하여 침샘의 기능을 확인하였다. 이에 있어, 귀밑샘 또는 턱밑샘에 나트륨 펙테이트(sodium pectate) Tc 99m의 흡수와 분비가 저하된 경우를 양성으로 간주하였다.In addition, the function of salivary secretion was confirmed using scintigraphy. More specifically, after the animal model of Example 2-1 was inhaled anesthetized, pilocarpine known to promote salivary secretion was intraperitoneally injected. Then, TC99 (Technetium-99) known to be absorbed by the salivary gland was injected into the tail vein. This was photographed for 30 minutes with an Infinia γ camera to confirm the function of the salivary glands. In this regard, cases in which the absorption and secretion of sodium pectate Tc 99m in the parotid or submandibular gland were decreased were considered positive.

그 결과 도 9 중 A에 나타낸 바와 같이, 구강건조증 유발 동물 모델(OVX)에서는 오른쪽 침샘 및 왼쪽 침샘의 활성화가 거의 유사하게 측정되었다. 하지만 세포외 소포체 투여군(OVX+EXO)에서는 오른쪽 침샘이 세포외 소포체를 투여하지 않은 왼쪽 침샘보다 활성화가 더 높음을 확인하였다. 즉, 본 발명에 따른 세포외 소포체 투여로 인하여 폐경에 의해 저하된 침샘의 침 분비 기능이 회복되었음을 확인하였다.As a result, as shown in A of FIG. 9, activation of the right salivary gland and the left salivary gland was measured almost similarly in the xerostomia induced animal model (OVX). However, in the extracellular vesicles administration group (OVX+EXO), activation of the right salivary gland was higher than that of the left salivary gland not receiving extracellular vesicles. That is, it was confirmed that the salivary secretion function of the salivary glands, which had been reduced due to menopause, was restored due to the administration of extracellular vesicles according to the present invention.

종합적으로 본 발명의 실시예를 통해 편도 유래 중간엽 줄기세포로부터 분리된 세포외 소포체는 항염증 또는 항섬유화 miRNA를 다수 포함하고 있으며, 폐경을 유발한 동물 모델에 상기 세포외 소포체를 처리하였을 때, 폐경에 의해 증가된 염증성 또는 항섬유화 인자의 발현이 감소되었고, 저하된 침 분비 기능이 회복됨을 확인한 바, 이를 폐경에 의해 유발된 구강건조증을 포함한 다양한 원인의 구강건조증의 예방, 개선 또는 치료에 유용하게 활용할 수 있다.Overall, the extracellular vesicles isolated from tonsil-derived mesenchymal stem cells through the examples of the present invention contain a number of anti-inflammatory or anti-fibrotic miRNAs, and when the extracellular vesicles are treated in an animal model that induces menopause, As it was confirmed that the expression of inflammatory or antifibrotic factors increased by menopause was reduced and the decreased salivary secretion function was restored, this is useful for preventing, improving or treating xerostomia of various causes including xerostomia caused by menopause. can make use of it.

Claims (7)

편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 치료용 약학 조성물.
A pharmaceutical composition for preventing or treating xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.
 제 1항에 있어서,
상기 구강건조증은 폐경에 의하여 유발된 것을 특징으로 하는, 약학 조성물.
According to claim 1,
The dry mouth is characterized in that caused by menopause, the pharmaceutical composition.
 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 의약외품.
A quasi-drug for preventing or improving xerostomia, containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.
 제 3항에 있어서,
상기 의약외품은 치약, 양치액, 구강 세척제, 껌, 구강 스프레이, 구강용 젤, 구강 연고제, 마스크, 습포제, 첩부제 및 경피흡수제로 이루어진 군에서 선택된 어느 하나 이상인 것을 특징으로 하는, 의약외품.
According to claim 3,
Characterized in that the quasi-drug is at least one selected from the group consisting of toothpaste, mouthwash, mouthwash, gum, oral spray, oral gel, oral ointment, mask, poultice, patch, and percutaneous absorbent.
 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 의약외품.
A quasi-drug for enhancing saliva secretion containing extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.
 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 구강건조증 예방 또는 개선용 식품 조성물.
A food composition for preventing or improving xerostomia, comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.
 편도 유래 중간엽 줄기세포에서 분리된 세포외 소포체를 유효성분으로 포함하는 타액 분비 증강용 식품 조성물.A food composition for enhancing salivary secretion comprising extracellular vesicles isolated from tonsillar-derived mesenchymal stem cells as an active ingredient.
KR1020210067038A 2021-05-25 2021-05-25 Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle KR20220159106A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020210067038A KR20220159106A (en) 2021-05-25 2021-05-25 Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020210067038A KR20220159106A (en) 2021-05-25 2021-05-25 Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle

Publications (1)

Publication Number Publication Date
KR20220159106A true KR20220159106A (en) 2022-12-02

Family

ID=84417837

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020210067038A KR20220159106A (en) 2021-05-25 2021-05-25 Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle

Country Status (1)

Country Link
KR (1) KR20220159106A (en)

Similar Documents

Publication Publication Date Title
KR102035273B1 (en) Composition for preventing or treating osteoporosis comprising stem cell-derived exosomes
US20100105766A1 (en) Composition for inhibition or prevention of bone density reduction
KR101855423B1 (en) A composition comprising 5,6-dichloroindirubin-3'-methoxime and 5-methoxylindirubin-3'-oxime
JP7379152B2 (en) Composition for inhibiting muscle fibrosis
KR20120010026A (en) Pharmaceutical Compositions for Preventing or Treating Arthritis Comprising Cynanchum Atratum Extracts
KR102534210B1 (en) Pharmaceutical Composition comprising Nidus vespae extract as an active ingredient for Preventing or Treating obesity
KR102409923B1 (en) Composition for prevention or treatment of Porcine epidemic diarrhea virus infection including a complex comprising a curcuminoid compound, and licorice extract or a fraction thereof
KR101824497B1 (en) Composition comprising Phytoestrogen for preventing loss of hair and promoting growth of hair
KR101193540B1 (en) Composition comprising the extract of Astragalus membranaceus BGE.,Cinnamomum cassia and Phellodendron amurensis for preventing and treating of osteoporesis and bone disease
KR20220159106A (en) Composition for preventing, improving or treating xerostomia comprising tonsil mesenchymal stem cell-derived extracellular vesicle
JP2018057301A (en) Agent for maintaining undifferentiated state of stem cell and agent for promoting proliferation of stem cell
KR101527880B1 (en) Composition for skin-regeneration, skin-whitening, anti-oxidation or wound healing comprising culture medium of adipose-derived stem cell-T cell
KR102241282B1 (en) Composition for hard tissue formation and, dentin or pulp regeneration containing Ixeris dentata extract and its active compound
JP2024533530A (en) Anti-inflammatory composition containing complex ginsenoside composition
KR20210122125A (en) Composition for preventing, improving or treating sarcopenia comprising a mealworm larvae protein or its hydrolysate
US20080050426A1 (en) Method For Preparing Extract From Wild Ginseng Showing Anticancer Activity And The Composition Comprising The Same
KR102664264B1 (en) Composition for prevention or treatment of xerostomia comprising ferrostatin-1
US20020168435A1 (en) Composition for promoting regeneration of hard tissues comprising an extract of cortex eucommiae
KR102612099B1 (en) Health functional food for ameliorating stress comprising extract of black rice aleurone
KR20140123330A (en) Pharmaceutical composition for preventing or treating viral diseases and cancers comprising extract or fraction from Ampelopsis brevipedunculata
KR20130059741A (en) Pharmaceutical compositions for preventing or treating arthritis comprising euphorbia ebracteolata extracts
US7524518B2 (en) Composition for promoting regeneration of hard tissues comprising an extract of cortex eucommiae
JP7161170B2 (en) Zinc transporter expression promoter
KR20220154441A (en) A pharmaceutical composition for prevention or treatment of obesity comprising biochanin a or pharmaceutically accepted salts thereof as an effective component
KR20240104325A (en) A composition for preventing or treating periodontal disease, comprising a culture medium of periodontal ligament stem cells containing a secretory protein cultured in a medium containing metformin

Legal Events

Date Code Title Description
E902 Notification of reason for refusal