KR20220144788A - Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component - Google Patents

Abstract

The present invention relates to a composition for preventing, ameliorating or treating hypercholesterinemia containing a cannabis sativa stem extract as an effective component. According to the present invention, the cannabis sativa stem extract has no cytotoxicity and has effects of lowering a cholesterol content in hepatocytes, reducing an expression amount of a cholesterol synthesis gene, and lowering a blood cholesterol content without a significant change in a body weight in an animal model. Therefore, the composition of the present invention can be usefully used in health functional foods and pharmaceuticals related to hypercholesterolemia.

Description

A composition for preventing, improving or treating hypercholesterolemia containing a hemp stem extract as an active ingredient TECHNICAL FIELD

The present invention relates to a composition for preventing, improving or treating hypercholesterolemia containing a hemp stem extract as an active ingredient.

Cholesterol is absorbed through food, but it is also synthesized by the body. Cholesterol is found in high concentrations in organs with many membranes, such as the liver, spinal cord, and brain, and is also a major component of blood clots. Cholesterol plays an important role in many physiological and biochemical reactions and is closely related to cardiovascular disease.

Cholesterol is mainly produced in the liver, and lipoproteins present in the blood play a role in transporting cholesterol to various parts of the body. There are two types of lipoproteins, low density lipoprotein (LDL) and high density lipoprotein (HDL), and HDL transports cholesterol from other tissues to the liver. is removed LDL is mainly produced in the liver and transported to other tissues of the body, so if there is a lot of LDL, cholesterol accumulates in the blood vessels. Specifically, the cholesterol is an essential component for maintaining normal functions of the human body, a nutrient essential for making biological membranes and cells, a component that is a material for various hormones such as adrenocortical hormones and sex hormones, and a material for making bile do.

Cholesterol in the blood varies according to race, gender, and age. In Korea, when cholesterol is less than 240 mg per 1 dL of blood, it is considered normal, and when cholesterol in the blood is more than 240 mg/dL, it is called hypercholesterolemia. High cholesterol can be caused by genetic factors and occurs when saturated fat and cholesterol are consumed through foods such as meat. When cholesterol is excessively accumulated in the body and becomes hypercholesterolemia, it can cause fatal diseases such as cardiovascular diseases as well as degenerative neurological diseases.

On the other hand, as a cannabis-related technology, Korea Patent No. 2041875 discloses a pharmaceutical composition for the prevention or treatment of colon cancer containing cannabidiol extract and trail extracted from hemp, and Korean Patent No. 1198017 discloses hemp fiber Although a composition for blocking ultraviolet rays and/or oily skin comprising a composition is disclosed, a composition for preventing, improving or treating hypercholesterolemia containing the hemp stem extract of the present invention as an active ingredient has not been disclosed.

The present invention has been derived by the above needs, and the present invention provides a composition for preventing, improving or treating hypercholesterolemia containing a hemp stem extract as an active ingredient, and the hemp stem extract of the present invention is cytotoxic. The present invention was completed by confirming that there is no, lowering the cholesterol content in hepatocytes, reducing the expression level of the cholesterol synthesis gene, and lowering the blood cholesterol content without significant change in body weight in an animal model.

In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving hypercholesterolemia containing hemp stem extract as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating hypercholesterolemia comprising a hemp stem extract as an active ingredient.

The present invention relates to a composition for preventing, improving or treating hypercholesterolemia containing a hemp stem extract as an active ingredient, and the hemp stem extract of the present invention has no cytotoxicity, lowers cholesterol content in hepatocytes, It also reduces the expression level and has the effect of lowering blood cholesterol content in animal models without significant change in body weight.

1 is a graph showing the cell viability of HepG ₂ according to the treatment of cannabis stem extract, (A) is a normal carbohydrate metabolic condition, (B) is a cell viability in an abnormal carbohydrate metabolic condition in which the glucose content is lowered. ** and *** indicate a statistically significant increase in cell viability compared to the control group not treated with cannabis stem extract. ** is p<0.01, and *** is p<0.001.
Figure 2 is the result of confirming the total cholesterol content in hepatocytes according to the treatment of hemp stem extract, ## is the cholesterol content in the group inducing high cholesterol by treatment with fructose compared to the control group that did not induce high cholesterol increased, p<0.01, *, *** indicates a statistically significant decrease in cholesterol content by treatment with hemp stem extract or lovastatin (Lovastatin), * is p <0.05, *** is p <0.001.
3 is a result confirming the change in the expression level of cholesterol synthesis-related genes according to the treatment of the hemp stem extract of the present invention. # indicates that the expression level of the cholesterol synthesis-related gene was increased in the high cholesterol group (Fructose 20mM) compared to the normal group (Control), p <0.05, * is the hemp stem extract treatment group of the present invention compared to the high cholesterol induction group The expression level of the cholesterol synthesis-related gene was significantly decreased, p<0.05.
4 is a result confirming the change in body weight of the animal model according to the treatment of the hemp stem extract of the present invention.
Figure 5 confirms the change in cholesterol content in hepatocytes of the animal model according to the treatment of the hemp stem extract of the present invention. (A) shows the total cholesterol content, (B) confirms the ratio of total cholesterol / HDL- cholesterol. #### indicates that the total cholesterol content or the total cholesterol/HDL-cholesterol ratio increased statistically significantly in the fructose-induced high cholesterol group compared to the normal group, p <0.0001, *, ***, **** indicates that the total cholesterol content or total cholesterol/HDL-cholesterol ratio of the group treated with the hemp stem extract of the present invention compared to the total cholesterol content or total cholesterol/HDL-cholesterol ratio of the high cholesterol group is statistically significant As a decrease, * is p<0.05, *** is p<0.001, and **** is p<0.0001.

The present invention relates to a health functional food composition for preventing or improving hypercholesterolemia containing a hemp stem extract as an active ingredient.

The cannabis stem extract may be prepared by a method comprising the following steps, but is not limited thereto:

(1) extracting by adding an extraction solvent to cannabis sativa stem;

(2) filtering the extract of step (1); and

(3) Concentrating the filtered extract of step (2) under reduced pressure and drying to prepare an extract.

In step (1), the extraction solvent is preferably selected from water, C ₁ to C ₄ lower alcohols or mixtures thereof, and more preferably water, but is not limited thereto.

Cannabis stem extraction in the present invention can use all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction. The extraction solvent is preferably extracted by adding 1 to 20 times the weight of the dried hemp stem, and more preferably adding 5 to 15 times. The extraction temperature is preferably 50 ~ 150 ℃, but is not limited thereto. In addition, the extraction time is preferably 6 to 24 hours, more preferably 10 to 14 hours, but is not limited thereto. In the method, it is preferable to use a vacuum vacuum concentrator or a vacuum rotary evaporator for the concentration under reduced pressure in step (3), but is not limited thereto. In addition, drying under reduced pressure, vacuum drying, boiling drying, spray drying or freeze drying is preferable, but is not limited thereto.

The hemp stem extract is characterized by reducing low-density lipoprotein (LDL)-cholesterol and increasing high-density lipoprotein (HDL)-cholesterol.

The hemp stem extract is preferably prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto.

The health functional food composition of the present invention may be used as it is, or may be used with other foods or food ingredients, and may be appropriately used according to a conventional method. There is no particular limitation on the type of the health functional food composition. Examples of foods to which the hemp stem extract can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, There are drinks, alcoholic beverages, vitamin complexes, etc., and includes all health functional foods in the ordinary sense. A health drink including the composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional drinks. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumatine and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention.

The health functional food composition of the present invention includes, in addition to the active ingredients, various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, and preservatives. , glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like may be further contained. In addition, it may further contain the pulp for the production of fruit juice or vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 2 parts by weight based on 100 parts by weight of the composition of the present invention.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating hypercholesterolemia comprising a hemp stem extract as an active ingredient.

The pharmaceutical composition of the present invention may be in various oral or parenteral formulations. In the case of formulation, in addition to the active ingredient, a pharmaceutically acceptable carrier, excipient or diluent may be further included, and generally used fillers, extenders, binders, wetting agents, diluents or excipients such as disintegrants or surfactants are used. can be formulated. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycero gelatin, etc. may be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally, and it is preferable to select an external skin or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine intrauterine or intracerebrovascular injection method for parenteral administration.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and drug activity of the patient. , sensitivity to the drug, administration time, administration route and excretion rate, duration of treatment, factors including concurrent drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease, and the daily dosage is based on the amount of hemp stem extract Based on 0.01 to 2,000 mg/kg, preferably 30 to 500 mg/kg, more preferably 50 to 300 mg/kg, and may be administered 1 to 6 times a day. The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

[Cell Culture]

HepG ₂ carcinoma cells were purchased from ATCC (American Type Culture Collection, Seoul, Korea). HepG ₂ cells were subcultured using DMEM medium (including 25 mM glucose, 10% FBS, and 1% antibiotics) every 2 days to maintain development, and 1×10 ⁶ cells were placed in a 6-well plate at 100 ng/ml PMA (phorbol 12). -myristate 13-acetate) was seeded.

Example 1. Preparation of Hemp Stem Hot Water Extract

After 30 liters of water was added to 3 kg of hemp stems grown for about 2 months, hot water extraction was performed at 100-120° C. for 12 hours. This was lyophilized to obtain 108.69 g of extract.

Example 2. Confirmation of hepatocytotoxicity of hemp stem hot water extract

In order to check the hepatocellular toxicity of the hot water extract of hemp stem, HepG ₂ cells were laid in a 96 well plate, and the hot water extract of hemp stem was added at a concentration of 50, 100, 200, 400, 600, 800 and 1000 μg/ml. DMEM medium containing 25 mM glucose (including 25 mM glucose, 10% FBS, 1% penicillin/streptomycin mixture) and 5.5 mM glucose (5.5 mM glucose, 1% FBS, 1% penicillin) /streptomycin mixture) respectively. After 24 hours, CCK-8 was added to the medium at a concentration of 10%, followed by reaction at 37° C. for 2 hours, and absorbance was measured at 450 nm using a microplate spectrometer. The relative cell viability (%) was confirmed through comparison.

As a result, as shown in FIG. 1 , it was confirmed that cytotoxicity was hardly observed even when the cannabis stem hot water extract was treated at a concentration of 50 to 1000 μg/ml regardless of the glucose content contained in the medium. When the hot water extract of cannabis stems was treated in a medium containing a low concentration of glucose, it was confirmed that the cell viability was statistically significantly improved.

Cell viability according to glucose content change in a high-cholesterol cell model under the condition that the glucose content is controlled in order to keep the glucose content constant when high cholesterol is induced by treatment with fructose in a medium condition containing a low concentration of glucose. is to check

Example 3. Confirmation of changes in total cholesterol content in hepatocytes according to the treatment of cannabis stem hot water extract

HepG ₂ cells were treated with cannabis stem hot water extract and 3 days later, total cholesterol content was measured using the Cholesterol Cell-Based Detection Assay Kit (Cayman Chemical) according to the manufacturer's method.

As a result, as shown in FIG. 2, it was confirmed that the total cholesterol content was increased by the treatment of fructose, and when 400 μg/ml of the hemp stem extract of the present invention was treated, the total cholesterol content was statistically significant. It was confirmed that it decreased significantly.

Example 4. Confirmation of changes in the expression of cholesterol synthesis-related genes according to the treatment of cannabis stem hot water extract

RNA isolation was performed according to the Trizol method, and was isolated using the Easy spid-RNA extraction kit (Intron, Seoul, Korea) according to the manufacturer's method. The concentration was measured and quantified with a Nanodrop DS-11 spectrometer (DeNovix, Wilmington, DE USA), and cDNA was synthesized from each RNA using an iScript cDNA synthesis kit (BioRad, Hercules, CA, USA), and each gene Expression of each gene was compared by q-PCR method using CFX96 Real Time PCR instrument (BioRad, Hercules, CA, USA) and SsoAdvenced ^TM universal Sybrgreen supermix (BioRad, Hercules, CA, USA). The primer information used is shown in Table 1, and the conditions of Realtime PCR were amplified in 40 cycles and the reaction proceeded (95°C, 30 seconds; 58°C, 30 seconds; 72°C for 30 seconds). The relative quantification was calculated by qPCR of the target group using GAPDH or 18S rRNA as an internal standard.

gene primer information gene directional sequence (5'->3') SEQ ID NO: HMGCR forward TGCTTTGGCTGCATGTCAGT SEQ ID NO: 1 reverse GCTATCCAGCGACTGTGAGC SEQ ID NO: 2 HMGCS1 forward CCTGGTAGTTGCAGGAGATA SEQ ID NO: 3 reverse CTAATGCACTGAGGTAGCAC SEQ ID NO: 4 ACAT2 forward TGGCTCCGGAAGATGTGTCT SEQ ID NO: 5 reverse CCTCCTGCAACCACAATGCT SEQ ID NO: 6 MVD forward CGAGTCACACTGGCCTGAAC SEQ ID NO: 7 reverse GGATGATGCGCCAGGAGATG SEQ ID NO: 8 LSS forward ACTTCGCCAGCATTGACTGG SEQ ID NO: 9 reverse GTCCACATACCAGCGCACAA SEQ ID NO: 10 SQLE forward CTTTGGCCAACAGGGAGGTC SEQ ID NO: 11 reverse TGGTTCCTTTTCTGCGCCTC SEQ ID NO: 12 DHCR7 forward ACCTTTGTGGGTCACCTTCCA SEQ ID NO: 13 reverse GCAGTGGGATCCAGTTGTCG SEQ ID NO: 14 CYP51A1 forward GTAGCAGGGATGCTTATTGG SEQ ID NO: 15 reverse GATGTCCTGGAGGAATGGTA SEQ ID NO: 16 GAPDH forward GAGTCAACGGATTTGGTCGT SEQ ID NO: 17 reverse GTTGCATGGATGACCTTGG SEQ ID NO: 18

In order to confirm the effect of hemp stem extract on inhibiting intracellular cholesterol metabolism, HMGCR (HMG-CoA reductase), HMGCS1 (3-hydroxy-3-methylglutaryl-CoA synthase 1), ACAT2 (acetyl-CoA) involved in cholesterol biosynthesis Expression changes of acetyltransferase 2), MVD (Mevalonate Diphosphate Decarboxylase), LSS (Lanosterol Synthase), SQLE (Squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase) and CYP51A1 (cytochrome P450 family 51 subfamily A member1) genes were confirmed. As shown in FIG. 3 , the expression level of the cholesterol synthesis-related gene was increased by fructose treatment. In contrast, when the hot water extract of the hemp stem of the present invention was treated, it was confirmed that the expression level of the cholesterol synthesis-related gene was decreased.

Example 5. Changes in body weight and cholesterol content in high cholesterol animal models following administration of hemp stem hot water extract

C57BL/6 mice (male, 5 weeks old) were purchased from Orient Bio (Seongnam, Korea), acclimatized for 1 week, and then used for testing.

Breeding environment is SPF breeding area, temperature range: 20.1~22.1℃, relative humidity: 46.8~52.9%, number of ventilation: 10~15 times/hr, lighting time and light/dark cycle: 12 hours Two cage changes were performed, and 2-4 mice were housed per cage. Purified water through the purification process, general feed (Harlan Co., Ltd.) and high cholesterol feed (D12336, Research diets) were allowed to be freely consumed through the feeding period. Before the start of the experiment, blood was collected by orbital blood sampling and divided into groups based on total cholesterol. After dividing the group, high-cholesterol feed was supplied, and at the same time, 100, 300, and 500 mg/kg of cannabis stem extract and 30 mg/kg of simvastatin, a comparative drug, were administered orally once a day for 12 weeks. did. Body weight and feed intake were measured once a week, and serum was separated through orbital blood sampling once every 4 weeks, and analysis was performed using a serological analyzer (Toshiba, Accute).

Composition of Efficacy Test Group of Hemp Stem Extract Using Animal Model test group food feed dosing substance Dosing Concentration
(mg/kg) number of animals G1 general feed Vehicle (0.5% CMC) 10 8 G2 high cholesterol feed Vehicle (0.5% CMC) 10 8 G3 high cholesterol feed Simvastatin 30 8 G4 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 100 8 G5 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 300 8 G6 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 500 8

As a result, body weight gradually increased during 12 weeks, but there was little change in body weight between the groups (FIG. 4). After 12 weeks, the group fed the cholesterol diet showed a decrease in total cholesterol content and total cholesterol/HDL ratio. In contrast to this, it was confirmed that the total cholesterol content and the total cholesterol/HDL ratio decreased statistically significantly in the group (G4 to G6) fed the hemp stem extract of the present invention (FIG. 5).

[Statistics processing]

In the present invention, statistical significance was tested through an ANOVA test, and the GraphPad Prism 5.01 program, a statistical package widely used commercially, was used as a statistical method.

<110> UCELLPHARMA <120> Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component <130> PN22384 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HMGCR-f <400> 1 tgctttggct gcatgtcagt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HMGCR-r <400> 2 gctatccagc gactgtgagc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HMGCS1-f <400> 3 cctggtagtt gcaggagata 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HMGCS1-r <400> 4 ctaatgcact gaggtagcac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACAT2-f <400> 5 tggctccgga agatgtgtct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACAT2-r <400> 6 cctcctgcaa ccacaatgct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MVD-f <400> 7 cgagtcacac tggcctgaac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MVD-r <400> 8 ggatgatgcg ccaggagatg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LSS-f <400> 9 acttcgccag cattgactgg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LSS-r <400> 10 gtccacatac cagcgcacaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SQLE-f <400> 11 ctttggccaa cagggaggtc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SQLE-r <400> 12 tggttccttt tctgcgcctc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHCR7-f <400> 13 accttgtggg tcaccttcca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DHCR7-r <400> 14 gcagtgggat ccagttgtcg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYP51A1-f <400> 15 gtagcaggga tgcttattgg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CYP51A1-r <400> 16 gatgtcctgg aggaatggta 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-f <400> 17 gagtcaacgg atttggtcgt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-r <400> 18 gttgtcatgg atgaccttgg 20

Claims (4)

Contains hemp stem water extract as an active ingredient, reduces low-density lipoprotein (LDL)-cholesterol, increases high-density lipoprotein (HDL)-cholesterol, and is involved in cholesterol biosynthesis (HMGCS1 (3-hydroxy-3-methylglutaryl-) CoA synthase 1), ACAT2 (acetyl-CoA acetyltransferase 2), SQLE (Squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase) and CYP51A1 (cytochrome P450 family 51 subfamily A member1) gene expression levels are decreased, and the dose is 1 A health functional food composition for the prevention or improvement of hypercholesterolemia, characterized in that it is administered in an amount of 300 to 500 mg per 1 kg of mouse body weight on a daily basis. The health for preventing or improving hypercholesterolemia according to claim 1, wherein the cannabis stem water extract is prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders. Nutraceutical composition. Contains hemp stem water extract as an active ingredient, reduces low-density lipoprotein (LDL)-cholesterol, increases high-density lipoprotein (HDL)-cholesterol, and is involved in cholesterol biosynthesis (HMGCS1 (3-hydroxy-3-methylglutaryl-) Reduces the expression levels of CoA synthase 1), ACAT2 (acetyl-CoA acetyltransferase 2), SQLE (Squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase) and CYP51A1 (cytochrome P450 family 51 subfamily A member1) genes, and the dose is 1 A pharmaceutical composition for preventing or treating hypercholesterolemia, characterized in that it is administered in an amount of 300 to 500 mg per 1 kg of mouse body weight on a daily basis. The pharmaceutical composition for preventing or treating hypercholesterolemia according to claim 3, further comprising a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient.

Images