KR20220037666A - Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component - Google Patents

Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component Download PDF

Info

Publication number
KR20220037666A
KR20220037666A KR1020200120410A KR20200120410A KR20220037666A KR 20220037666 A KR20220037666 A KR 20220037666A KR 1020200120410 A KR1020200120410 A KR 1020200120410A KR 20200120410 A KR20200120410 A KR 20200120410A KR 20220037666 A KR20220037666 A KR 20220037666A
Authority
KR
South Korea
Prior art keywords
fatty liver
liver disease
stem extract
preventing
composition
Prior art date
Application number
KR1020200120410A
Other languages
Korean (ko)
Inventor
김현기
신명자
박병길
손현선
Original Assignee
주식회사 유셀파마
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 유셀파마 filed Critical 주식회사 유셀파마
Priority to KR1020200120410A priority Critical patent/KR20220037666A/en
Priority to PCT/KR2021/012814 priority patent/WO2022060168A1/en
Publication of KR20220037666A publication Critical patent/KR20220037666A/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2300/00Processes
    • A23V2300/14Extraction

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Polymers & Plastics (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

The present invention relates to a composition for fatty liver disease prevention, alleviation, or treatment containing a cannabis sativa stem extract as an active ingredient. The cannabis sativa stem extract, which is the active ingredient of the present invention, inhibits lipid accumulation in liver tissue, reduces the expression of fatty acid synthesis-related genes FASN and SCD, reduces the expression of genes AKT3, SREBF1, SREBF2, and XBP1 in a fat accumulation signaling pathway, reduces the expression of inflammatory cytokine genes IL6, TNFα, and IL1β, increases the expression of hepatokine-related gene FGF21, and reduces the expression of LECT2 and SELENOP. Accordingly, the extract can be useful as health functional food or medicine for fatty liver disease prevention, alleviation, or treatment.

Description

대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방, 개선 또는 치료용 조성물{Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component}A composition for preventing, alleviating or treating fatty liver disease comprising a hemp stem extract as an active ingredient TECHNICAL FIELD

본 발명은 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.The present invention relates to a composition for preventing, improving, or treating fatty liver disease, comprising a hemp stem extract as an active ingredient.

국내 간질환 사망률은 인구 십만 명 당 23.5명으로 매우 높으며, 40대 사망원인 1위(41.1명/10만 명), 50대 사망원인 2위(72.4명/10만 명), 30대 사망원인 3위(10명/10만 명)를 차지하는 등 간질환은 한국 중년층 인구의 주요 사망원인이다. The liver disease mortality rate in Korea is very high at 23.5 per 100,000 people. Liver disease, which ranks in the stomach (100,000 people / 10,000 people), is the leading cause of death in the middle-aged population in Korea.

상기 간질환 중에서 지방간은 정상세포 내에는 존재하지 않는 중성지방이 간 세포 내에 비정상적으로 침착되어 보이는 현상이 나타난 것을 말한다. 정상 간은 약 5%가 지방조직으로 구성되어 있으며 중성지방, 지방산, 인지질, 콜레스테롤 및 콜레스테롤 에스터가 지방의 주요 성분이나, 일단 지방간이 발생하면 대부분의 성분이 중성지방으로 대체되며 중성지방의 양이 간 중량의 5% 이상이면 지방간으로 진단된다. 지방간이 악화되어 간세포 속의 지방 덩어리가 커지면 핵을 포함한 세포의 중요한 구성성분이 한쪽으로 밀려 간세포의 기능이 저하되며, 세포 내에 축적된 지방으로 인하여 팽창된 간세포들이 간세포 사이에 있는 미세 혈관과 임파선을 압박하여 간 내의 혈액과 임파액의 순환에 장애가 생기게 된다. 이렇게 되면 간세포는 산소와 영양공급을 적절히 받을 수 없어 간기능이 저하되는 것이다. Among the liver diseases, fatty liver refers to a phenomenon in which triglycerides, which do not exist in normal cells, are abnormally deposited in liver cells. About 5% of a normal liver is composed of adipose tissue, and triglycerides, fatty acids, phospholipids, cholesterol, and cholesterol esters are the main components of fat. If it is more than 5% of the liver weight, it is diagnosed as fatty liver. When the fatty liver worsens and the fat mass in the liver cells grows, important components of the cells, including the nucleus, are pushed to one side, and the function of the liver cells decreases. As a result, the circulation of blood and lymph in the liver is impaired. In this case, hepatocytes cannot receive adequate oxygen and nutrients, leading to a decrease in liver function.

비알콜성 지방간 질환(non-alcoholic fatty liver disease, NAFLD)은 지방산이 중성지방의 형태로 간의 실질세포 내에 5% 이상 축적된 경우로 정의한다. 병리학적으로는 단순 지방간(simple steatosis)과 염증을 동반한 지방간염(steatohepatitis)으로 분류되는데, 장기간 방치 시, 간염, 간 섬유, 간경변 등의 심각한 간 질환으로 이행될 수 있다. 국내에서도 생활양식의 변화로 인해 비알코올성 간질환 발생빈도가 증가하는 추세이다.Non-alcoholic fatty liver disease (NAFLD) is defined as a case in which fatty acids are accumulated in the parenchymal cells of the liver in the form of triglycerides by 5% or more. Pathologically, it is classified into simple steatosis and steatohepatitis with inflammation. If left untreated for a long time, it can progress to serious liver diseases such as hepatitis, liver fibrosis, and cirrhosis. In Korea, the incidence of nonalcoholic liver disease is increasing due to lifestyle changes.

한편, 대마는 삼과에 속하는 일년생 초본 식물로, 학명은 Cannabis sativa L.이다. 곧은 뿌리는 지하 30∼40㎝까지 뻗어 들어가지만, 곁뿌리는 왕성하게 발달하지 않으므로 잘 뽑힌다. 높이는 온대에서 3m 내외이지만 열대에서는 6m까지 자란다. 줄기는 세로로 골이 져 있고 유조직 안에 내초섬유가 형성되어 있는데, 이것이 인피섬유이다. 잎은 모양이 손바닥 같고, 5∼9개의 작은 잎으로 되어 있는데, 줄기 아래쪽에서는 마주나고 위쪽에서는 어긋난다. On the other hand, hemp is an annual herbaceous plant belonging to the family Hemp, and its scientific name is Cannabis sativa L.. Straight roots extend 30 to 40 cm underground, but side roots do not develop vigorously, so they are easily pulled out. The height is around 3m in temperate zones, but grows up to 6m in the tropics. The stem is longitudinally corrugated and the inner sheath fibers are formed in the parenchyma, which are bast fibers. The leaves are palm-like in shape and consist of 5-9 small leaves, opposite at the bottom of the stem and opposite at the top.

대마 관련 기술로는 미국등록특허 제10039724호에 무알코올성 지방간 질환 (NAFLD)의 치료에서 사용을 위한 7-수산기 칸나비디올(7-OH-CBD)이 알려져 있고, 일본공개특허 제2015-120739호에 칸나비노이드의 새로운 용도가 알려져 있으나, 본 발명의 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방, 개선 또는 치료용 조성물은 개시된 바 없다.As a cannabis-related technology, 7-hydroxyl group cannabidiol (7-OH-CBD) for use in the treatment of non-alcoholic fatty liver disease (NAFLD) is known in US Patent No. 10039724, and Japanese Patent Application Laid-Open No. 2015-120739 Although new uses of cannabinoids are known, a composition for preventing, improving or treating fatty liver disease containing the hemp stem extract of the present invention as an active ingredient has not been disclosed.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 대마 줄기 추출물을 유효성분으로 포함하는 지방간 질환의 예방, 개선 또는 치료용 조성물을 제공하고, 상기 대마 줄기 추출물은 간조직 내의 지질의 축적을 억제하며, 지방산 합성 관련 유전자 FASN 및 SCD 발현량; 지방축적 신호전달 경로에 있는 유전자 AKT3, SREBF1, SREBF2 및 XBP1 발현량; 염증성 사이토카인 유전자 IL6, TNFα 및 IL1β 발현량을 감소시키며; 헤파토카인(hepatokine) 관련 유전자 FGF21 발현량을 증가시키고, LECT2 및 SELENOP의 발현량을 감소시키는 효과가 있다는 것을 확인함으로써, 본 발명을 완성하였다.The present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating fatty liver disease, comprising a hemp stem extract as an active ingredient, and the hemp stem extract is the accumulation of lipids in liver tissue. and the expression levels of fatty acid synthesis-related genes FASN and SCD; expression levels of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; decrease the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β; By increasing the expression level of the hepatokine-related gene FGF21, and confirming that there is an effect of decreasing the expression level of LECT2 and SELENOP, the present invention was completed.

상기 목적을 달성하기 위하여, 본 발명은 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving fatty liver disease containing hemp stem extract as an active ingredient.

또한, 본 발명은 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 치료용 약학 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating fatty liver disease containing a hemp stem extract as an active ingredient.

본 발명은 대마 줄기 추출물을 유효성분으로 포함하는 지방간 질환의 예방, 개선 또는 치료용 조성물에 관한 것으로, 본 발명의 유효성분인 상기 대마 줄기 추출물은 간조직 내의 지질의 축적을 억제하며, 지방산 합성 관련 유전자 FASN 및 SCD 발현량; 지방축적 신호전달 경로에 있는 유전자 AKT3, SREBF1, SREBF2 및 XBP1 발현량; 염증성 사이토카인 유전자 IL6, TNFα 및 IL1β 발현량을 감소시키며; 헤파토카인(hepatokine) 관련 유전자 FGF21 발현량을 증가시키고, LECT2 및 SELENOP의 발현량을 감소시키는 효과가 있으므로, 지방간 질환의 예방, 개선 또는 치료용의 건강기능식품 또는 의약품으로 유용하게 사용될 수 있다.The present invention relates to a composition for preventing, improving or treating fatty liver disease, comprising a hemp stem extract as an active ingredient, wherein the hemp stem extract as an active ingredient of the present invention inhibits the accumulation of lipids in liver tissue, and relates to fatty acid synthesis gene FASN and SCD expression levels; expression levels of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; decrease the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β; Since it has the effect of increasing the expression level of hepatokine-related gene FGF21 and decreasing the expression level of LECT2 and SELENOP, it can be usefully used as a health functional food or pharmaceutical for preventing, improving or treating fatty liver disease.

도 1은 대마 줄기 추출물을 처리한 HepG2 세포 생존율을 확인한 결과이다. (A)는 고 함량의 글루코스를 포함하는 DMEM 배지 1(25mM 글루코스, 10% FBS, 1% 항생제 포함)에서 확인한 HepG2 세포 생존율이고, (B)는 저 함량의 글루코스를 포함하는 EM 배지 2(5.5mM 글루코스, 10% FBS, 1% 항생제 포함)에서 확인한 HepG2 세포 생존율이다. **, ***는 대마 줄기 추출물을 처리하지 않은 군 대비 대마 줄기 추출물을 처리한 군에서의 세포 생존율이 통계적으로 유의미하게 증가했다는 것으로, **는 p<0.01이고, ***는 p<0.001이다.
도 2는 지질 축적이 유도된 HepG2 세포에, 대마 줄기 추출물을 처리하여 지질 축적량의 변화를 확인한 오일-레드-오 염색 결과이다. ***는 대조군(지질 축적을 유도하지 않은 HepG2 세포) 대비 지질 축적이 유도된 군(fructose 20mM)의 붉은색으로 염색된 오일-레드-오 염색율(지질 축적율을 의미함)이 통계적으로 유의미하게 증가하였다는 것으로 p<0.001이고, ##은 지질 축적이 유도된 세포 대비 본 발명의 대마 줄기 추출물 또는 로바스타틴(lovastatin)을 처리한 군에서의 지질축적이 통계적으로 유의미하게 감소했다는 것으로 p<0.01이다.
도 3은 본 발명의 대마 줄기 추출물을 3일 또는 7일 동안 처리한 세포에서, 지방산 합성 관련 유전자 FASN(A) 및 SCD(B) 발현량 변화를 확인한 결과이다. ***은 지질 축적 유도 세포에서 대조군 대비 통계적으로 유의미하게 FASN 및 SCD 발현량이 증가하였다는 것으로, p<0.001이고, #, ##, ###는 지질 축적 유도 세포 대비 본 발명의 대마 줄기 추출물을 처리한 군에서의 FASN 및 SCD 발현량이 감소했다는 것으로, #은 p<0.05이고, ##은 p<0.01이며, ###은 p<0.001이다.
도 4는 본 발명의 대마 줄기 추출물을 7일 동안 처리한 세포에서, 지방축적 신호전달 경로에 있는 유전자 AKT3, SREBF1, SREBF2 및 XBP1 발현량 변화를 확인한 결과이다. *, **은 지질 축적 유도 세포에서 대조군 대비 통계적으로 유의미하게 AKT3, SREBF1, SREBF2 및 XBP1 발현량이 증가하였다는 것으로, *은 p<0.05이고, **은 p<0.01이며, #, ##는 지질 축적 유도 세포 대비 본 발명의 대마 줄기 추출물을 처리한 군에서의 AKT3, SREBF1, SREBF2 및 XBP1 발현량이 감소했다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
도 5는 본 발명의 대마 줄기 추출물을 7일 동안 처리한 세포에서, 염증성 사이토카인 유전자 IL6, TNFα 및 IL1β 발현량 변화를 확인한 결과이다. ***은 지질 축적 유도 세포에서 대조군 대비 통계적으로 유의미하게 IL6 발현량이 증가하였다는 것으로, p<0.001이고, #, ##는 지질 축적 유도 세포 대비 본 발명의 대마 줄기 추출물을 처리한 군에서의 IL6, TNFα 및 IL1β 발현량이 감소했다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
도 6은 본 발명의 대마 줄기 추출물을 7일 동안 처리한 세포에서, 헤파토카인(hepatokine) 관련 유전자 FGF21, LECT2 및 SELENOP 발현량 변화를 확인한 결과이다. ***은 헤파토카인(hepatokine) 관련 유전자 FGF21 발현량이 대조군 대비 감소하였다는 것으로, p<0.001이며, #, ##는 FGF21 유전자 발현량이 대조군 대비 통계적으로 유의미하게 증가하였거나, LECT2 및 SELENOP 발현량이 대조군 대비 통계적으로 유의미하게 감소하였다는 것으로, #은 p<0.05이고, ##은 p<0.01이다.
1 is a result confirming the survival rate of HepG2 cells treated with cannabis stem extract. (A) is the HepG2 cell viability determined in DMEM medium 1 (with 25 mM glucose, 10% FBS, and 1% antibiotics) containing high glucose content, (B) is EM medium 2 containing low glucose content (5.5 HepG2 cell viability as determined in mM glucose, 10% FBS, and 1% antibiotic). **, *** indicates that the cell viability in the group treated with the hemp stem extract compared to the group not treated with the hemp stem extract was statistically significantly increased, ** is p<0.01, *** is p< 0.001.
2 is oil-red-oh staining results confirming the change in the amount of lipid accumulation by treating HepG2 cells induced in lipid accumulation by treatment with a hemp stem extract. *** indicates that the red-stained Oil-Red-Oh staining rate (meaning the lipid accumulation rate) of the lipid accumulation induced group (fructose 20 mM) compared to the control group (HepG2 cells that did not induce lipid accumulation) was statistically Significantly increased, p < 0.001, ## indicates that lipid accumulation was statistically significantly decreased in the group treated with the hemp stem extract or lovastatin of the present invention compared to cells induced in lipid accumulation, p < 0.01.
3 is a result confirming the change in the expression levels of fatty acid synthesis-related genes FASN (A) and SCD (B) in cells treated with the hemp stem extract of the present invention for 3 or 7 days. *** indicates that the expression levels of FASN and SCD were statistically significantly increased in the lipid accumulation-inducing cells compared to the control, p<0.001, and #, ##, ### are the cannabis stem extracts of the present invention compared to the lipid accumulation-inducing cells FASN and SCD expression levels were decreased in the group treated with #, p<0.05, ##, p<0.01, and ###, p<0.001.
Figure 4 is the result of confirming the change in the expression level of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway in cells treated with the hemp stem extract of the present invention for 7 days. * and ** indicate that the expression levels of AKT3, SREBF1, SREBF2 and XBP1 were statistically significantly increased in lipid accumulation-induced cells compared to the control, * indicates p<0.05, ** indicates p <0.01, #, ## indicate The expression levels of AKT3, SREBF1, SREBF2 and XBP1 were decreased in the group treated with the hemp stem extract of the present invention compared to the lipid accumulation-induced cells, with # being p<0.05 and ## being p<0.01.
5 is a result confirming the change in the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β in cells treated with the hemp stem extract of the present invention for 7 days. *** indicates that the IL6 expression level was statistically significantly increased in the lipid accumulation-induced cells compared to the control group, p<0.001, and #, ## in the group treated with the hemp stem extract of the present invention compared to the lipid accumulation-inducing cells IL6, TNFα and IL1β expression levels were decreased, with # being p<0.05 and ## being p<0.01.
6 is a result confirming the change in the expression levels of hepatokine-related genes FGF21, LECT2 and SELENOP in cells treated with the hemp stem extract of the present invention for 7 days. *** indicates that the expression level of the hepatokine-related gene FGF21 decreased compared to the control group, p<0.001, and #, ## indicate that the expression level of the FGF21 gene increased statistically significantly compared to the control group, or the expression level of LECT2 and SELENOP It was statistically significantly decreased compared to the control group, with # being p<0.05 and ## being p<0.01.

본 발명은 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물에 관한 것이다.The present invention relates to a health functional food composition for preventing or improving fatty liver disease containing a hemp stem extract as an active ingredient.

상기 대마 줄기 추출물은 하기의 단계를 포함하는 방법에 의해 제조할 수 있으나, 이에 한정하지 않는다:The cannabis stem extract may be prepared by a method comprising the following steps, but is not limited thereto:

(1) 대마 줄기(Cannabis sativa stem)에 추출용매를 가하여 추출하는 단계;(1) extracting by adding an extraction solvent to the hemp stem ( Cannabis sativa stem);

(2) 단계 (1)의 추출물을 여과하는 단계; 및 (2) filtering the extract of step (1); and

(3) 단계 (2)의 여과한 추출물을 감압 농축하고 건조하여 추출물을 제조하는 단계. (3) Concentrating the filtered extract of step (2) under reduced pressure and drying to prepare an extract.

상기 단계 (1)에서 추출용매는 물, C1~C4의 저급 알코올 또는 이들의 혼합물 중에서 선택하는 것이 바람직하며, 더 바람직하게는 물이지만 이에 한정하지 않는다.In step (1), the extraction solvent is preferably selected from water, C 1 to C 4 lower alcohols or mixtures thereof, and more preferably water, but is not limited thereto.

본 발명에서의 대마 줄기 추출은 여과법, 열수 추출, 침지 추출, 환류 냉각 추출 및 초음파 추출 등의 당 업계에 공지된 모든 통상적인 방법을 이용할 수 있다. 상기 추출용매는 건조된 대마 줄기 중량의 1~20배 첨가하여 추출하는 것이 바람직하며, 더 바람직하게는 5~15배 첨가하는 것이다. 추출온도는 100~120℃인 것이 바람직하지만 이에 한정하지 않는다. 또한, 추출시간은 5~20시간인 것이 바람직하며, 10~14시간이 더욱 바람직하지만 이에 한정하지 않는다. 상기 방법에 있어서, 단계 (3)의 감압농축은 진공 감압 농축기 또는 진공회전증발기를 이용하는 것이 바람직하지만, 이에 한정하지 않는다. 또한, 건조는 감압건조, 진공건조, 비등건조, 분무 건조 또는 동결 건조하는 것이 바람직하지만 이에 한정하지 않는다.Hemp stem extraction in the present invention can use all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The extraction solvent is preferably extracted by adding 1 to 20 times the weight of the dried hemp stem, and more preferably adding 5 to 15 times. The extraction temperature is preferably 100 ~ 120 ℃, but is not limited thereto. In addition, the extraction time is preferably 5 to 20 hours, more preferably 10 to 14 hours, but is not limited thereto. In the above method, the vacuum concentration in step (3) is preferably, but not limited to, a vacuum vacuum concentrator or a vacuum rotary evaporator. In addition, drying under reduced pressure, vacuum drying, boiling drying, spray drying or freeze drying is preferable, but is not limited thereto.

상기 지방간 질환은 비알코올성 단순 지방간; 비알코올성 지방간염; 및 비알코올성 간경변 중에서 선택된 어느 하나일 수 있으나, 이에 제한되지 않는다.The fatty liver disease is non-alcoholic simple fatty liver; nonalcoholic steatohepatitis; And it may be any one selected from non-alcoholic cirrhosis, but is not limited thereto.

상기 대마 줄기 추출물은 간 조직 내 중성지방의 함량을 감소시키는 것을 특징으로 한다.The hemp stem extract is characterized in that it reduces the content of triglycerides in the liver tissue.

상기 대마 줄기 추출물은 음료, 환, 정제(tablet), 캡슐제(capsule) 및 산제 중에서 선택된 어느 하나의 제형으로 제조되는 것이 바람직하지만 이에 한정하지 않는다.The cannabis stem extract is preferably prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto.

본 발명의 건강기능식품 조성물은 대마 줄기 추출물을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 상기 건강기능식품 조성물의 종류에는 특별한 제한은 없다. 상기 대마 줄기 추출물을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다. 본 발명의 조성물을 포함하는 건강 음료는 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100g당 일반적으로 약 0.01~0.04g, 바람직하게는 약 0.02~0.03g이다. The health functional food composition of the present invention may be used with hemp stem extract as it is or with other foods or food ingredients, and may be appropriately used according to a conventional method. There is no particular limitation on the type of the health functional food composition. Examples of foods to which the hemp stem extract can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, There are drinks, alcoholic beverages, vitamin complexes, etc., and includes all health functional foods in the ordinary sense. A health drink including the composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional drinks. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention.

본 발명의 건강기능식품 조성물은 상기 유효성분 이외에 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 추가로 더 함유할 수 있다. 그 밖에 과일 주스 또는 야채 음료의 제조를 위한 과육을 더 함유할 수 있다. 이러한 성분은 독립적으로 또는 혼합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부에 대하여, 0.01~2 중량부의 범위에서 선택되는 것이 일반적이다.The health functional food composition of the present invention contains, in addition to the active ingredients, various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, and preservatives. , glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like may be further contained. In addition, it may further contain the pulp for the production of fruit juice or vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 2 parts by weight based on 100 parts by weight of the composition of the present invention.

또한, 본 발명은 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 치료용 약학 조성물에 관한 것이다. In addition, the present invention relates to a pharmaceutical composition for preventing or treating fatty liver disease containing a hemp stem extract as an active ingredient.

본 발명의 약학 조성물은 경구 또는 비 경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 상기 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함할 수 있는데, 일반적으로 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제 또는 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성 용제 및 현탁 용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈tween) 61, 카카오지, 라우린지, 글리세로 젤라틴 등이 사용될 수 있다.The pharmaceutical composition of the present invention may be in various oral or parenteral formulations. In the case of formulation, in addition to the active ingredient, a pharmaceutically acceptable carrier, excipient or diluent may be further included, and generally used fillers, extenders, binders, wetting agents, diluents or excipients such as disintegrants or surfactants are used. can be formulated. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. As the non-aqueous solvent and the suspending solvent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycero gelatin, and the like can be used.

본 발명의 약학 조성물은 경구 또는 비 경구로 투여될 수 있으며, 비 경구 투여 시 피부 외용 또는 복강 내, 직장, 정맥, 근육, 피하, 자궁 내 경막 또는 뇌혈관 내 주사 방식을 선택할 수 있다.The pharmaceutical composition of the present invention may be administered orally or parenterally, and when administered parenterally, external or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection may be selected.

본 발명에 따른 약학 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and drug activity of the patient. , can be determined according to factors including sensitivity to drug, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

본 발명의 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설률 및 질환의 중증도에 따라 그 범위가 다양하며, 일일 투여량은 대마 줄기 추출물의 양을 기준으로 0.01~2,000mg/kg이고, 바람직하게는 30~500mg/kg이고, 더욱 바람직하게는 50~300mg/kg이며, 하루 1~6회 투여될 수 있다. 본 발명의 약학 조성물은 단독으로 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The dosage of the composition of the present invention varies according to the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease, and the daily dosage is based on the amount of hemp stem extract It is 0.01 to 2,000 mg/kg as a standard, preferably 30 to 500 mg/kg, and more preferably 50 to 300 mg/kg, and may be administered 1 to 6 times a day. The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

이하, 실시예를 이용하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로 본 발명의 범위가 이들에 의해 제한되지 않는다는 것은 당해 기술분야에서 통상의 지식을 가진 자에게 있어 자명한 것이다. Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

실시예Example 1. 대마 줄기 추출물의 제조1. Preparation of Hemp Stem Extract

5~6월에 수확한 대마의 줄기 3kg에 물 30ℓ를 첨가한 후, 100~120℃에서 12시간 동안 열수 추출하였다. 이를 동결건조하여 108.69g의 추출물을 수득하였다. After adding 30 liters of water to 3 kg of hemp stems harvested in May and June, hot water extraction was performed at 100-120° C. for 12 hours. This was lyophilized to obtain 108.69 g of an extract.

실시예 2. 대마 줄기 추출물의 처리에 따른 세포 생존율 변화 확인Example 2. Confirmation of changes in cell viability according to treatment of cannabis stem extract

대마 줄기 추출물의 세포생존율을 확인하기 위하여, 고 함량의 글루코스를 포함하는 DMEM 배지 1(25mM 글루코스, 10% FBS, 1% 항생제 포함) 및 저 함량의 글루코스를 포함하는 DMEM 배지 2(5.5mM 글루코스, 10% FBS, 1% 항생제 포함)에서 HepG2 세포를 배양하고, 대마 줄기추출물을 농도별로 처리한 후 24시간을 더 배양한 후 CCK8(Cell Counting Kit-8) 어세이를 이용하여 570nm의 파장에서 흡광도를 측정하여 세포생존율을 확인하였다. In order to confirm the cell viability of the hemp stem extract, DMEM medium 1 containing a high content of glucose (including 25 mM glucose, 10% FBS, and 1% antibiotics) and DMEM medium containing a low content of glucose 2 (5.5 mM glucose, HepG2 cells were cultured in 10% FBS, 1% antibiotics), treated with cannabis stem extracts by concentration, and incubated for 24 hours, absorbance at a wavelength of 570 nm using CCK8 (Cell Counting Kit-8) assay was measured to confirm the cell viability.

그 결과, 도 1에 개시한 바와 같이 고 함량의 글루코스를 포함하는 배지에서는 대마 줄기 추출물을 1000㎍/㎖까지 처리하여도 세포 생존율이 유지되는 것을 확인하였으며(도 1A), 저 함량의 글루코스를 포함하는 DMEM 배지에 50~1000㎍/㎖의 대마 줄기 추출물을 처리하여 배양한 경우는 아무것도 처리하지 않은 대조군 대비 세포 생존률이 증가하는 것을 확인하였다(도 1B).As a result, as shown in FIG. 1 , it was confirmed that cell viability was maintained even when the hemp stem extract was treated up to 1000 μg/ml in a medium containing a high content of glucose ( FIG. 1A ), including a low content of glucose When cultured by treating and culturing the cannabis stem extract at a concentration of 50 to 1000 μg/ml in DMEM medium, it was confirmed that cell viability increased compared to the control group untreated (FIG. 1B).

실시예 3. 오일-레드-오 염색(Oil-red O staining) Example 3. Oil-red O staining

HepG2 cell에서의 Oil-red O 염색은 Kraus 등의 방법에 따라 수행하였다. Oil-red O staining in HepG2 cells was performed according to the method of Kraus et al.

[세포 배양][Cell Culture]

HepG2는 American Type Culture Collection (ATCC) (Baltimore, MD)에서 분양받았다. HepG2 세포는 2일마다 DMEM 배지(25mM 글루코스, 10% FBS, 1% 항생제 포함)을 이용하여 계대하여 현상을 유지하였다. 6웰 플레이트에 1×106개의 세포를 분주하였다. 24시간 후 DMEM 배지(5.5mM 글루코스, 10% FBS, 1% 항생제 포함)로 교체하고, 2시간 전배양 후, 지방간 유도 배지(DMEM 배지: 5.5mM 글루코스, 20mM 프럭토스(Fructose), 1% FBS, 1% 항생제 포함)로 배양하여 지방축적을 유도하였으며, 지방간 유도배지에 다양한 농도의 대마 줄기 추출물을 처리하였다. HepG2 was acquired from the American Type Culture Collection (ATCC) (Baltimore, MD). HepG2 cells were passaged using DMEM medium (including 25 mM glucose, 10% FBS, and 1% antibiotics) every 2 days to maintain development. 1×10 6 cells were seeded in a 6-well plate. After 24 hours, it was replaced with DMEM medium (5.5 mM glucose, 10% FBS, 1% antibiotic included), and after 2 hours of pre-culture, fatty liver induction medium (DMEM medium: 5.5 mM glucose, 20 mM Fructose, 1% FBS) , including 1% antibiotics) to induce fat accumulation, and various concentrations of hemp stem extracts were treated in a fatty liver induction medium.

이후 PBS로 2회 세척 후, 10% 파라포름알데히드(paraformaldehyde)로 고정한 후, 오일-레드-오 염색을 하였다. 지질은 오일-레드-오 염색법에 의해 붉은색으로 염색된다. After washing twice with PBS, fixed with 10% paraformaldehyde, and oil-red-oh staining. Lipids are stained red by the Oil-Red-Oh staining method.

결과는 도 2에 개시한 바와 같이, 고탄수화물(DMEM 배지: 25mM 글루코스, 20mM 프럭토스(Fructose)) 배지에서 지방 축적이 유도된 군은 대조군에 비해 붉은색으로 염색된 지질의 비율이 증가하였으며, 본 발명의 대마 줄기 추출물(MIS)을 처리한 실험군에서는 농도 의존적으로 지질 축적이 감소된 것을 확인하였다.As a result, as shown in Figure 2, in the group in which fat accumulation was induced in a high-carbohydrate (DMEM medium: 25mM glucose, 20mM fructose) medium, the ratio of lipids stained in red was increased compared to the control group, In the experimental group treated with the hemp stem extract (MIS) of the present invention, it was confirmed that lipid accumulation was reduced in a concentration-dependent manner.

실시예 4. 유전자 발현 분석Example 4. Analysis of gene expression

지방산 합성 관련 유전자 FASN 및 SCD; 지방축적 신호전달 경로에 있는 유전자 AKT3, SREBF1, SREBF2 및 XBP1; 염증성 사이토카인 유전자 IL6, TNFα 및 IL1β; 헤파토카인(hepatokine) 관련 유전자 FGF21, LECT2 및 SELENOP의 발현량 변화를 분석하였다.fatty acid synthesis-related genes FASN and SCD; genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; inflammatory cytokine genes IL6, TNFα and IL1β; Changes in expression levels of hepatokine-related genes FGF21, LECT2 and SELENOP were analyzed.

HepG2 세포에서의 RNA 추출은 Easy spin RNA 추출 키트(iNtRON, Seongnam, Korea)를 이용하여 제조사의 방법에 따라 추출하였다. 나노드랍(Nanodrop) DS-11 스펙트로미터(DeNovix, Wilmington, DE USA)로 농도를 측정하여 정량한 다음 cDNA는 iScipt cDNA 합성 키트(Bio-rad, USA)를 이용하여 합성하였으며, q-PCR은 SsoAdvanced™ Universal SYBR®Green Supermix (Bio-rad)를 이용하여 측정하였다. 증폭된 유전자의 발현 정도를 정량화하기 위해 qPCR 반응은 Rotor Gene SYBR Green PCR 키트를 이용하여 혼합한 후 바이오-래드 실시간 PCR 시스템(Bio-rad, USA)을 이용하여 수행하였다. 실시간 PCR의 조건은 40 사이클로 증폭시켜 반응을 진행하였다 (95℃, 30초; 58℃, 30초; 72℃에서 30초). 내부 표준물질로 GAPDH 를 사용하여 타겟 유전자의 정량 PCR로 계산하여 RQ(relative quantitative)를 통해 정량화하였다. 사용된 프라이머 정보는 표 1에 표시하였다. RNA extraction from HepG2 cells was extracted using Easy spin RNA extraction kit (iNtRON, Seongnam, Korea) according to the manufacturer's method. The concentration was measured and quantified with a Nanodrop DS-11 spectrometer (DeNovix, Wilmington, DE USA), and cDNA was synthesized using the iScipt cDNA synthesis kit (Bio-rad, USA), and q-PCR was performed with SsoAdvanced ™ was measured using a Universal SYBR®Green Supermix (Bio-rad). To quantify the expression level of the amplified gene, the qPCR reaction was performed using the Bio-Rad real-time PCR system (Bio-rad, USA) after mixing using the Rotor Gene SYBR Green PCR kit. The conditions of real-time PCR were amplified for 40 cycles and the reaction proceeded (95°C, 30 sec; 58°C, 30 sec; 72°C 30 sec). Using GAPDH as an internal standard, the target gene was calculated by quantitative PCR and quantified through RQ (relative quantitative). The primer information used is shown in Table 1.

유전자 명칭gene name 방향direction 서열(5'->3')sequence (5'->3') 서열번호SEQ ID NO: FASN
(Fatty Acid Synthase)
FASN
(Fatty Acid Synthase)
정방향forward TCGGAGAACTTGCAGGAGTTTCGGAGAACTTGCAGGAGTT 1One
역방향reverse CGGAGTGAATCTGGGTTGATCGGAGTGAATCTGGGTTGAT 22 SCD
(Stearoyl-CoA Desaturase)
SCD
(Stearoyl-CoA Desaturase)
정방향forward GCCCCTCTACTTGGAAGACGAGCCCCTCTACTTGGAAGACGA 33
역방향reverse AAGTGATC-CCATACAGGGCTCAAGTGATC-CCATACAGGGCTC 44 AKT3
(AKT Serine/Threonine Kinase 3)
AKT3
(AKT Serine/Threonine Kinase 3)
정방향forward CAGTAGACTGGTGGGGCCTA CAGTAGACTGGTGGGGCCTA 55
역방향reverse ATCAAGAGCCCTGAAAGCAA ATCAAGAGCCCTGAAAGCAA 66 SREBF1
(Sterol Regulatory Element Binding Transcription Factor 1)
SREBF1
(Sterol Regulatory Element Binding Transcription Factor 1)
정방향forward AGGTGGAGGACACACTGACCAGTGGAGGACACACTGACC 77
역방향reverse CAGGACAGGCAGAGGAAGACCAGGACAGGCAGAGGAAGAC 88 SREBF2
(Sterol Regulatory Element Binding Transcription Factor 2)
SREBF2
(Sterol Regulatory Element Binding Transcription Factor 2)
정방향forward CAAGCTTCTAAAGGGCATCG CAAGCTTCTAAAAGGGCATCG 99
역방향reverse GAGAGGCACAGGAAGGTGAG GAGAGGCACAGGAAGGTGAG 1010 XBP1
(X-Box Binding Protein 1)
XBP1
(X-Box Binding Protein 1)
정방향forward AATCGAGGAAGCACCTCTCAAATCGAGGAAGCACCTCTCA 1111
역방향reverse ACTGAATGGGGAAAGGGAACACTGAATGGGGAAAAGGGAAC 1212 IL6
(Interleukin 6)
IL6
(Interleukin 6)
정방향forward AGTGAGGAACAAGCCAGAGCAGTGAGGAACAAGCCAGAGC 1313
역방향reverse GAGGTGCCCATGCTACATTTGAGGTGCCCATGCTACATTT 1414 TNFα
(Tumor Necrosis Factor alpha)
TNFα
(Tumor Necrosis Factor alpha)
정방향forward CCTGTGAGGAGGACGAACATCCTGGAGGAGGACGAACAT 1515
역방향reverse AGGCCCCAGTTTGAATTCTTAGGCCCCAGTTTGAATTCTT 1616 IL1β
(Interleukin 1 Beta)
IL1β
(Interleukin 1 Beta)
정방향forward TCAGCACCTCTCAAGCAGAATCAGCACCTCTCAAGCAGAA 1717
역방향reverse AGCTGACTGTCCTGGCTGATAGCTGACTGTCCTGGCTGAT 1818 FGF21
(Fibroblast Growth Factor 21)
FGF21
(Fibroblast Growth Factor 21)
정방향forward ACTCCAGTCCTCTCCTGCAAACTCCAGTCCTCTCCTGCAA 1919
역방향reverse GCACAGGAACCTGGATGTCTGCACAGGAACCTGGATGTCT 2020 LECT2
(Leukocyte Cell Derived Chemotaxin 2)
LECT2
(Leukocyte Cell Derived Chemotaxin 2)
정방향forward TGGAACTCTATTGCCCTTGCTGGAACTCTATTTGCCCTTGC 2121
역방향reverse AATGGGGTATCCATCCCTTCAATGGGGTATCCATCCCTTC 2222 SELENOP
(Selenoprotein P)
SELENOP
(Selenoprotein P)
정방향forward CTGTGCATACTGCAGGCATCCTGTGCATACTGCAGGCATC 2323
역방향reverse CAAGACGGCCACATCTATCACAAGACGGCCACATCTATCA 2424

그 결과, 도 3에 개시한 바와 같이 지방간 유도 세포에서의 FASN 및 SCD 유전자 발현량이 통계적으로 유의미하게 증가하였으나, 본 발명의 대마 줄기 추출물(MS)을 처리한 군에서는 FASN 및 SCD 유전자 발현량이 감소한 것을 확인할 수 있었으며, 지방 축적 신호전달 관련 유전자 AKT3, SREBF1, SREBF2 및 XBP1의 발현량이 통계적으로 유의미하게 증가하였으나, 본 발명의 대마 줄기 추출물을 처리한 군에서는 지방 축적 신호전달 관련 유전자 AKT3, SREBF1, SREBF2 및 XBP1의 발현량이 유의미하게 감소한 것을 확인하였다.As a result, as shown in FIG. 3 , the expression levels of FASN and SCD genes in the fatty liver-induced cells were statistically significantly increased, but in the group treated with the hemp stem extract (MS) of the present invention, the expression levels of FASN and SCD genes decreased. The expression levels of the fat accumulation signaling genes AKT3, SREBF1, SREBF2 and XBP1 were statistically significantly increased, but in the group treated with the hemp stem extract of the present invention, the fat accumulation signaling genes AKT3, SREBF1, SREBF2 and It was confirmed that the expression level of XBP1 was significantly decreased.

또한, 대마 줄기 추출물을 처리한 HepG2 세포에서의 염증성 사이토카인 유전자 IL6, TNFα 및 IL1β의 발현량이 감소하였으며, 헤파토카인(hepatokine) 관련 유전자 FGF21의 발현량은 증가하였으며, LECT2 및 SELENOP 유전자의 발현량은 감소하였다. In addition, the expression levels of the inflammatory cytokine genes IL6, TNFα and IL1β were decreased in HepG2 cells treated with the hemp stem extract, the expression level of the hepatokine-related gene FGF21 was increased, and the expression level of the LECT2 and SELENOP genes was increased. has decreased.

<110> UCELLPHARMA <120> Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component <130> PN20245 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-f <400> 1 tcggagaact tgcaggagtt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-r <400> 2 cggagtgaat ctgggttgat 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-f <400> 3 gcccctctac ttggaagacg a 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-r <400> 4 aagtgatccc atacagggct c 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-f <400> 5 cagtagactg gtggggccta 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-r <400> 6 atcaagagcc ctgaaagcaa 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-f <400> 7 aggtggagga cacactgacc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-r <400> 8 caggacaggc agaggaagac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-f <400> 9 caagcttcta aagggcatcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-r <400> 10 gagaggcaca ggaaggtgag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-f <400> 11 aatcgaggaa gcacctctca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-r <400> 12 actgaatggg gaaagggaac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-f <400> 13 agtgaggaac aagccagagc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-r <400> 14 gaggtgccca tgctacattt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-f <400> 15 cctgtgagga ggacgaacat 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-r <400> 16 aggccccagt ttgaattctt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-f <400> 17 tcagcacctc tcaagcagaa 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-r <400> 18 agctgactgt cctggctgat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-f <400> 19 actccagtcc tctcctgcaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-r <400> 20 gcacaggaac ctggatgtct 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-f <400> 21 tggaactcta ttgcccttgc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-r <400> 22 aatggggtat ccatcccttc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-f <400> 23 ctgtgcatac tgcaggcatc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-r <400> 24 caagacggcc acatctatca 20 <110> UCELLPHARMA <120> Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component <130> PN20245 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-f <400> 1 tcggagaact tgcaggagtt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-r <400> 2 cggagtgaat ctgggttgat 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-f <400> 3 gcccctctac ttggaagacg a 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-r <400> 4 aagtgatccc atacagggct c 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-f <400> 5 cagtagactg gtggggccta 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-r <400> 6 atcaagagcc ctgaaagcaa 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-f <400> 7 aggtggagga cacactgacc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-r <400> 8 caggacaggc agaggaagac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-f <400> 9 caagcttcta aagggcatcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-r <400> 10 gagaggcaca ggaaggtgag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-f <400> 11 aatcgaggaa gcacctctca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-r <400> 12 actgaatggg gaaagggaac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-f <400> 13 agtgaggaac aagccagagc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-r <400> 14 gaggtgccca tgctacattt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-f <400> 15 cctgtgagga ggacgaacat 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-r <400> 16 aggccccagt ttgaattctt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-f <400> 17 tcagcacctc tcaagcagaa 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-r <400> 18 agctgactgt cctggctgat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-f <400> 19 actccagtcc tctcctgcaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-r <400> 20 gcacaggaac ctggatgtct 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-f <400> 21 tggaactcta ttgcccttgc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-r <400> 22 aatggggtat ccatcccttc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-f <400> 23 ctgtgcatac tgcaggcatc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-r <400> 24 caagacggcc acatctatca 20

Claims (7)

대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물.A health functional food composition for preventing or improving fatty liver disease containing hemp stem extract as an active ingredient. 제1항에 있어서, 상기 대마 줄기 추출물의 추출용매는 물, C1~C4의 저급 알코올 또는 이들의 혼합물인 것을 특징으로 하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물.According to claim 1, wherein the extraction solvent of the hemp stem extract is water, C 1 ~ C 4 Health functional food composition for preventing or improving fatty liver disease, characterized in that it is a lower alcohol or a mixture thereof. 제1항에 있어서, 상기 지방간 질환은 비알코올성 단순 지방간; 비알코올성 지방간염; 및 비알코올성 간경변 중에서 선택된 어느 하나인 것을 특징으로 하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물.According to claim 1, wherein the fatty liver disease is non-alcoholic simple fatty liver; nonalcoholic steatohepatitis; And a health functional food composition for preventing or improving fatty liver disease, characterized in that any one selected from non-alcoholic cirrhosis. 제1항에 있어서, 상기 대마 줄기 추출물은 간 조직 내 중성지방의 함량을 감소시키는 것을 특징으로 하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물. The health functional food composition for preventing or improving fatty liver disease according to claim 1, wherein the hemp stem extract reduces the content of triglycerides in liver tissue. 제1항에 있어서, 상기 대마 줄기 추출물은 음료, 환, 정제(tablet), 캡슐제(capsule) 및 산제 중에서 선택된 어느 하나의 제형으로 제조되는 것을 특징으로 하는 지방간 질환의 예방 또는 개선용 건강기능식품 조성물.The health functional food for preventing or improving fatty liver disease according to claim 1, wherein the hemp stem extract is prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders. composition. 대마 줄기 추출물을 유효성분으로 함유하는 지방간 질환의 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating fatty liver disease, comprising hemp stem extract as an active ingredient. 제6항에 있어서, 상기 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더 포함하는 것을 특징으로 하는 지방간 질환의 예방 또는 치료용 약학 조성물.

The pharmaceutical composition for preventing or treating fatty liver disease according to claim 6, further comprising a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient.

KR1020200120410A 2020-09-18 2020-09-18 Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component KR20220037666A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200120410A KR20220037666A (en) 2020-09-18 2020-09-18 Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component
PCT/KR2021/012814 WO2022060168A1 (en) 2020-09-18 2021-09-17 Composition comprising hemp stem extract as active ingredient for prevention, alleviation, or treatment of fatty liver disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200120410A KR20220037666A (en) 2020-09-18 2020-09-18 Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component

Publications (1)

Publication Number Publication Date
KR20220037666A true KR20220037666A (en) 2022-03-25

Family

ID=80776234

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200120410A KR20220037666A (en) 2020-09-18 2020-09-18 Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component

Country Status (2)

Country Link
KR (1) KR20220037666A (en)
WO (1) WO2022060168A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2726085A1 (en) * 2010-12-20 2012-06-20 Bernard Le Foll User of marihuana and compounds therein for treating obesity
KR20190098649A (en) * 2018-02-14 2019-08-22 (주)카이언바이오텍 Pharmaceutical composition containing cannabidiol extract for preventing or treating conlon cancer
WO2020092793A1 (en) * 2018-11-01 2020-05-07 Sciadonics, Inc. Formulations containing bioactive fatty acids and phytocannabinoids

Also Published As

Publication number Publication date
WO2022060168A1 (en) 2022-03-24

Similar Documents

Publication Publication Date Title
KR102110040B1 (en) Composition for preventing and treating of obesity or metabolic disease comprising Elaeagnus umbellata extracts
KR101158856B1 (en) Compositions for the prevention and treatment of obesity, hyperlipidemia, atherosclerosis, fatty liver, diabetes mellitus or metabolic syndrome comprising extracts or fractions of Glycine max leaves as an active ingredient
KR101785495B1 (en) Composition comprising Chrisanthemum indicum extract or fraction for treating, improving or preventing obesity or obesity-related disease
KR101281710B1 (en) Composition comprising an extact of cirsium japonicum and the compounds isolated thereform for the treatment and preventation of obesity
KR20160123130A (en) Composition comprising Chrisanthemum indicum extract or fraction for treating, improving or preventing obesity or obesity-related disease
KR20200104749A (en) Composition for preventing or treating muscular disease containing Salvia officinalis extract
KR20200012363A (en) Composition for preventing, ameliorating or treating obesity comprising Heracleum moellendorffii root and Torilis japonica mixed extract as effective component
JP6652653B2 (en) Composition for preventing, ameliorating or treating diseases caused by side effects of anticancer drugs containing ashi extract as an active ingredient
KR20110081760A (en) Composition for inhibiting differentiation and accumulation of fat cells comprising fermented extract of purple sweet potato as an active ingredient
KR101778227B1 (en) Composition for anti-obesity comprising extract of Morus alba as effective component
WO2022060168A1 (en) Composition comprising hemp stem extract as active ingredient for prevention, alleviation, or treatment of fatty liver disease
KR101594979B1 (en) Compositions for treating or preventing obesity containing extract or fractions of Euphorbia supina Raf.
KR20210000294A (en) Pharmaceutical composition comprising the extract of Phlomis umbrosa Turczaninow as an effective ingredient for preventing or treating of obesity
KR102246349B1 (en) Composition for Preventing or Treating Muscular disease containing Rhodiola rosea extract
KR20210038099A (en) Composition for preventing, improving or treating bone disease comprising cricket extracts
KR102149093B1 (en) Composition for Preventing or Treating Neurodegenerative Disease by extracts of Mate and Dendropanax morbifera
KR102194345B1 (en) Composition for Preventing or Treating Muscular disease containing Angelica gigas Nakai extract
KR20190106587A (en) Pharmaceutical composition comprising the extract of Phlomis umbrosa Turczaninow for preventing or treating of obesity
KR102500342B1 (en) Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component
KR102346511B1 (en) Composition for Preventing or Treating Muscular disease containing Artemisia dracunculus L. extract
KR102448274B1 (en) Composition for preventing, ameliorating or treating bone disease comprising crude polysaccharide fraction of Psoralea corylifolia extract as effective component
KR101264014B1 (en) Composition for Preventing or Treating Bone Disease Comprising of Aminocoumarins
KR102016646B1 (en) Composition for preventing, ameliorating or treating obesity comprising Rudbeckia laciniata and Torilidis Fructus mixed extract as effective component
US20230189863A1 (en) Composition comprising low temperature water extract of hibiscus manihot for anti-obesity
KR102210082B1 (en) A pharmaceutical composition comprising HM-chromanone which activates AMPK as an active ingredient

Legal Events

Date Code Title Description
A201 Request for examination