KR20220037666A - Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component - Google Patents

Abstract

The present invention relates to a composition for fatty liver disease prevention, alleviation, or treatment containing a cannabis sativa stem extract as an active ingredient. The cannabis sativa stem extract, which is the active ingredient of the present invention, inhibits lipid accumulation in liver tissue, reduces the expression of fatty acid synthesis-related genes FASN and SCD, reduces the expression of genes AKT3, SREBF1, SREBF2, and XBP1 in a fat accumulation signaling pathway, reduces the expression of inflammatory cytokine genes IL6, TNFα, and IL1β, increases the expression of hepatokine-related gene FGF21, and reduces the expression of LECT2 and SELENOP. Accordingly, the extract can be useful as health functional food or medicine for fatty liver disease prevention, alleviation, or treatment.

Description

A composition for preventing, alleviating or treating fatty liver disease comprising a hemp stem extract as an active ingredient TECHNICAL FIELD

The present invention relates to a composition for preventing, improving, or treating fatty liver disease, comprising a hemp stem extract as an active ingredient.

The liver disease mortality rate in Korea is very high at 23.5 per 100,000 people. Liver disease, which ranks in the stomach (100,000 people / 10,000 people), is the leading cause of death in the middle-aged population in Korea.

Among the liver diseases, fatty liver refers to a phenomenon in which triglycerides, which do not exist in normal cells, are abnormally deposited in liver cells. About 5% of a normal liver is composed of adipose tissue, and triglycerides, fatty acids, phospholipids, cholesterol, and cholesterol esters are the main components of fat. If it is more than 5% of the liver weight, it is diagnosed as fatty liver. When the fatty liver worsens and the fat mass in the liver cells grows, important components of the cells, including the nucleus, are pushed to one side, and the function of the liver cells decreases. As a result, the circulation of blood and lymph in the liver is impaired. In this case, hepatocytes cannot receive adequate oxygen and nutrients, leading to a decrease in liver function.

Non-alcoholic fatty liver disease (NAFLD) is defined as a case in which fatty acids are accumulated in the parenchymal cells of the liver in the form of triglycerides by 5% or more. Pathologically, it is classified into simple steatosis and steatohepatitis with inflammation. If left untreated for a long time, it can progress to serious liver diseases such as hepatitis, liver fibrosis, and cirrhosis. In Korea, the incidence of nonalcoholic liver disease is increasing due to lifestyle changes.

On the other hand, hemp is an annual herbaceous plant belonging to the family Hemp, and its scientific name is Cannabis sativa L.. Straight roots extend 30 to 40 cm underground, but side roots do not develop vigorously, so they are easily pulled out. The height is around 3m in temperate zones, but grows up to 6m in the tropics. The stem is longitudinally corrugated and the inner sheath fibers are formed in the parenchyma, which are bast fibers. The leaves are palm-like in shape and consist of 5-9 small leaves, opposite at the bottom of the stem and opposite at the top.

As a cannabis-related technology, 7-hydroxyl group cannabidiol (7-OH-CBD) for use in the treatment of non-alcoholic fatty liver disease (NAFLD) is known in US Patent No. 10039724, and Japanese Patent Application Laid-Open No. 2015-120739 Although new uses of cannabinoids are known, a composition for preventing, improving or treating fatty liver disease containing the hemp stem extract of the present invention as an active ingredient has not been disclosed.

The present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating fatty liver disease, comprising a hemp stem extract as an active ingredient, and the hemp stem extract is the accumulation of lipids in liver tissue. and the expression levels of fatty acid synthesis-related genes FASN and SCD; expression levels of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; decrease the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β; By increasing the expression level of the hepatokine-related gene FGF21, and confirming that there is an effect of decreasing the expression level of LECT2 and SELENOP, the present invention was completed.

In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving fatty liver disease containing hemp stem extract as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating fatty liver disease containing a hemp stem extract as an active ingredient.

The present invention relates to a composition for preventing, improving or treating fatty liver disease, comprising a hemp stem extract as an active ingredient, wherein the hemp stem extract as an active ingredient of the present invention inhibits the accumulation of lipids in liver tissue, and relates to fatty acid synthesis gene FASN and SCD expression levels; expression levels of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; decrease the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β; Since it has the effect of increasing the expression level of hepatokine-related gene FGF21 and decreasing the expression level of LECT2 and SELENOP, it can be usefully used as a health functional food or pharmaceutical for preventing, improving or treating fatty liver disease.

1 is a result confirming the survival rate of HepG2 cells treated with cannabis stem extract. (A) is the HepG2 cell viability determined in DMEM medium 1 (with 25 mM glucose, 10% FBS, and 1% antibiotics) containing high glucose content, (B) is EM medium 2 containing low glucose content (5.5 HepG2 cell viability as determined in mM glucose, 10% FBS, and 1% antibiotic). **, *** indicates that the cell viability in the group treated with the hemp stem extract compared to the group not treated with the hemp stem extract was statistically significantly increased, ** is p<0.01, *** is p< 0.001.
2 is oil-red-oh staining results confirming the change in the amount of lipid accumulation by treating HepG2 cells induced in lipid accumulation by treatment with a hemp stem extract. *** indicates that the red-stained Oil-Red-Oh staining rate (meaning the lipid accumulation rate) of the lipid accumulation induced group (fructose 20 mM) compared to the control group (HepG2 cells that did not induce lipid accumulation) was statistically Significantly increased, p < 0.001, ## indicates that lipid accumulation was statistically significantly decreased in the group treated with the hemp stem extract or lovastatin of the present invention compared to cells induced in lipid accumulation, p < 0.01.
3 is a result confirming the change in the expression levels of fatty acid synthesis-related genes FASN (A) and SCD (B) in cells treated with the hemp stem extract of the present invention for 3 or 7 days. *** indicates that the expression levels of FASN and SCD were statistically significantly increased in the lipid accumulation-inducing cells compared to the control, p<0.001, and #, ##, ### are the cannabis stem extracts of the present invention compared to the lipid accumulation-inducing cells FASN and SCD expression levels were decreased in the group treated with #, p<0.05, ##, p<0.01, and ###, p<0.001.
Figure 4 is the result of confirming the change in the expression level of genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway in cells treated with the hemp stem extract of the present invention for 7 days. * and ** indicate that the expression levels of AKT3, SREBF1, SREBF2 and XBP1 were statistically significantly increased in lipid accumulation-induced cells compared to the control, * indicates p<0.05, ** indicates p <0.01, #, ## indicate The expression levels of AKT3, SREBF1, SREBF2 and XBP1 were decreased in the group treated with the hemp stem extract of the present invention compared to the lipid accumulation-induced cells, with # being p<0.05 and ## being p<0.01.
5 is a result confirming the change in the expression levels of inflammatory cytokine genes IL6, TNFα and IL1β in cells treated with the hemp stem extract of the present invention for 7 days. *** indicates that the IL6 expression level was statistically significantly increased in the lipid accumulation-induced cells compared to the control group, p<0.001, and #, ## in the group treated with the hemp stem extract of the present invention compared to the lipid accumulation-inducing cells IL6, TNFα and IL1β expression levels were decreased, with # being p<0.05 and ## being p<0.01.
6 is a result confirming the change in the expression levels of hepatokine-related genes FGF21, LECT2 and SELENOP in cells treated with the hemp stem extract of the present invention for 7 days. *** indicates that the expression level of the hepatokine-related gene FGF21 decreased compared to the control group, p<0.001, and #, ## indicate that the expression level of the FGF21 gene increased statistically significantly compared to the control group, or the expression level of LECT2 and SELENOP It was statistically significantly decreased compared to the control group, with # being p<0.05 and ## being p<0.01.

The present invention relates to a health functional food composition for preventing or improving fatty liver disease containing a hemp stem extract as an active ingredient.

The cannabis stem extract may be prepared by a method comprising the following steps, but is not limited thereto:

(1) extracting by adding an extraction solvent to the hemp stem ( Cannabis sativa stem);

(2) filtering the extract of step (1); and

(3) Concentrating the filtered extract of step (2) under reduced pressure and drying to prepare an extract.

In step (1), the extraction solvent is preferably selected from water, C ₁ to C ₄ lower alcohols or mixtures thereof, and more preferably water, but is not limited thereto.

Hemp stem extraction in the present invention can use all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction. The extraction solvent is preferably extracted by adding 1 to 20 times the weight of the dried hemp stem, and more preferably adding 5 to 15 times. The extraction temperature is preferably 100 ~ 120 ℃, but is not limited thereto. In addition, the extraction time is preferably 5 to 20 hours, more preferably 10 to 14 hours, but is not limited thereto. In the above method, the vacuum concentration in step (3) is preferably, but not limited to, a vacuum vacuum concentrator or a vacuum rotary evaporator. In addition, drying under reduced pressure, vacuum drying, boiling drying, spray drying or freeze drying is preferable, but is not limited thereto.

The fatty liver disease is non-alcoholic simple fatty liver; nonalcoholic steatohepatitis; And it may be any one selected from non-alcoholic cirrhosis, but is not limited thereto.

The hemp stem extract is characterized in that it reduces the content of triglycerides in the liver tissue.

The cannabis stem extract is preferably prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto.

The health functional food composition of the present invention may be used with hemp stem extract as it is or with other foods or food ingredients, and may be appropriately used according to a conventional method. There is no particular limitation on the type of the health functional food composition. Examples of foods to which the hemp stem extract can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, There are drinks, alcoholic beverages, vitamin complexes, etc., and includes all health functional foods in the ordinary sense. A health drink including the composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional drinks. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention.

The health functional food composition of the present invention contains, in addition to the active ingredients, various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, and preservatives. , glycerin, alcohol, a carbonation agent used in carbonated beverages, and the like may be further contained. In addition, it may further contain the pulp for the production of fruit juice or vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not very important, but is generally selected in the range of 0.01 to 2 parts by weight based on 100 parts by weight of the composition of the present invention.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating fatty liver disease containing a hemp stem extract as an active ingredient.

The pharmaceutical composition of the present invention may be in various oral or parenteral formulations. In the case of formulation, in addition to the active ingredient, a pharmaceutically acceptable carrier, excipient or diluent may be further included, and generally used fillers, extenders, binders, wetting agents, diluents or excipients such as disintegrants or surfactants are used. can be formulated. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in one or more compounds, for example, starch, calcium carbonate, sucrose or lactose ( lactose), gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. As the non-aqueous solvent and the suspending solvent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycero gelatin, and the like can be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally, and when administered parenterally, external or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection may be selected.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type, severity, and drug activity of the patient. , can be determined according to factors including sensitivity to drug, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the composition of the present invention varies according to the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and severity of disease, and the daily dosage is based on the amount of hemp stem extract It is 0.01 to 2,000 mg/kg as a standard, preferably 30 to 500 mg/kg, and more preferably 50 to 300 mg/kg, and may be administered 1 to 6 times a day. The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

Example 1. Preparation of Hemp Stem Extract

After adding 30 liters of water to 3 kg of hemp stems harvested in May and June, hot water extraction was performed at 100-120° C. for 12 hours. This was lyophilized to obtain 108.69 g of an extract.

Example 2. Confirmation of changes in cell viability according to treatment of cannabis stem extract

In order to confirm the cell viability of the hemp stem extract, DMEM medium 1 containing a high content of glucose (including 25 mM glucose, 10% FBS, and 1% antibiotics) and DMEM medium containing a low content of glucose 2 (5.5 mM glucose, HepG2 cells were cultured in 10% FBS, 1% antibiotics), treated with cannabis stem extracts by concentration, and incubated for 24 hours, absorbance at a wavelength of 570 nm using CCK8 (Cell Counting Kit-8) assay was measured to confirm the cell viability.

As a result, as shown in FIG. 1 , it was confirmed that cell viability was maintained even when the hemp stem extract was treated up to 1000 μg/ml in a medium containing a high content of glucose ( FIG. 1A ), including a low content of glucose When cultured by treating and culturing the cannabis stem extract at a concentration of 50 to 1000 μg/ml in DMEM medium, it was confirmed that cell viability increased compared to the control group untreated (FIG. 1B).

Example 3. Oil-red O staining

Oil-red O staining in HepG2 cells was performed according to the method of Kraus et al.

[Cell Culture]

HepG2 was acquired from the American Type Culture Collection (ATCC) (Baltimore, MD). HepG2 cells were passaged using DMEM medium (including 25 mM glucose, 10% FBS, and 1% antibiotics) every 2 days to maintain development. 1×10 ⁶ cells were seeded in a 6-well plate. After 24 hours, it was replaced with DMEM medium (5.5 mM glucose, 10% FBS, 1% antibiotic included), and after 2 hours of pre-culture, fatty liver induction medium (DMEM medium: 5.5 mM glucose, 20 mM Fructose, 1% FBS) , including 1% antibiotics) to induce fat accumulation, and various concentrations of hemp stem extracts were treated in a fatty liver induction medium.

After washing twice with PBS, fixed with 10% paraformaldehyde, and oil-red-oh staining. Lipids are stained red by the Oil-Red-Oh staining method.

As a result, as shown in Figure 2, in the group in which fat accumulation was induced in a high-carbohydrate (DMEM medium: 25mM glucose, 20mM fructose) medium, the ratio of lipids stained in red was increased compared to the control group, In the experimental group treated with the hemp stem extract (MIS) of the present invention, it was confirmed that lipid accumulation was reduced in a concentration-dependent manner.

Example 4. Analysis of gene expression

fatty acid synthesis-related genes FASN and SCD; genes AKT3, SREBF1, SREBF2 and XBP1 in the fat accumulation signaling pathway; inflammatory cytokine genes IL6, TNFα and IL1β; Changes in expression levels of hepatokine-related genes FGF21, LECT2 and SELENOP were analyzed.

RNA extraction from HepG2 cells was extracted using Easy spin RNA extraction kit (iNtRON, Seongnam, Korea) according to the manufacturer's method. The concentration was measured and quantified with a Nanodrop DS-11 spectrometer (DeNovix, Wilmington, DE USA), and cDNA was synthesized using the iScipt cDNA synthesis kit (Bio-rad, USA), and q-PCR was performed with SsoAdvanced ™ was measured using a Universal SYBR®Green Supermix (Bio-rad). To quantify the expression level of the amplified gene, the qPCR reaction was performed using the Bio-Rad real-time PCR system (Bio-rad, USA) after mixing using the Rotor Gene SYBR Green PCR kit. The conditions of real-time PCR were amplified for 40 cycles and the reaction proceeded (95°C, 30 sec; 58°C, 30 sec; 72°C 30 sec). Using GAPDH as an internal standard, the target gene was calculated by quantitative PCR and quantified through RQ (relative quantitative). The primer information used is shown in Table 1.

gene name direction sequence (5'->3') SEQ ID NO: FASN
(Fatty Acid Synthase) forward TCGGAGAACTTGCAGGAGTT One reverse CGGAGTGAATCTGGGTTGAT 2 SCD
(Stearoyl-CoA Desaturase) forward GCCCCTCTACTTGGAAGACGA 3 reverse AAGTGATC-CCATACAGGGCTC 4 AKT3
(AKT Serine/Threonine Kinase 3) forward CAGTAGACTGGTGGGGCCTA 5 reverse ATCAAGAGCCCTGAAAGCAA 6 SREBF1
(Sterol Regulatory Element Binding Transcription Factor 1) forward AGTGGAGGACACACTGACC 7 reverse CAGGACAGGCAGAGGAAGAC 8 SREBF2
(Sterol Regulatory Element Binding Transcription Factor 2) forward CAAGCTTCTAAAAGGGCATCG 9 reverse GAGAGGCACAGGAAGGTGAG 10 XBP1
(X-Box Binding Protein 1) forward AATCGAGGAAGCACCTCTCA 11 reverse ACTGAATGGGGAAAAGGGAAC 12 IL6
(Interleukin 6) forward AGTGAGGAACAAGCCAGAGC 13 reverse GAGGTGCCCATGCTACATTT 14 TNFα
(Tumor Necrosis Factor alpha) forward CCTGGAGGAGGACGAACAT 15 reverse AGGCCCCAGTTTGAATTCTT 16 IL1β
(Interleukin 1 Beta) forward TCAGCACCTCTCAAGCAGAA 17 reverse AGCTGACTGTCCTGGCTGAT 18 FGF21
(Fibroblast Growth Factor 21) forward ACTCCAGTCCTCTCCTGCAA 19 reverse GCACAGGAACCTGGATGTCT 20 LECT2
(Leukocyte Cell Derived Chemotaxin 2) forward TGGAACTCTATTTGCCCTTGC 21 reverse AATGGGGTATCCATCCCTTC 22 SELENOP
(Selenoprotein P)
forward CTGTGCATACTGCAGGCATC 23 reverse CAAGACGGCCACATCTATCA 24

As a result, as shown in FIG. 3 , the expression levels of FASN and SCD genes in the fatty liver-induced cells were statistically significantly increased, but in the group treated with the hemp stem extract (MS) of the present invention, the expression levels of FASN and SCD genes decreased. The expression levels of the fat accumulation signaling genes AKT3, SREBF1, SREBF2 and XBP1 were statistically significantly increased, but in the group treated with the hemp stem extract of the present invention, the fat accumulation signaling genes AKT3, SREBF1, SREBF2 and It was confirmed that the expression level of XBP1 was significantly decreased.

In addition, the expression levels of the inflammatory cytokine genes IL6, TNFα and IL1β were decreased in HepG2 cells treated with the hemp stem extract, the expression level of the hepatokine-related gene FGF21 was increased, and the expression level of the LECT2 and SELENOP genes was increased. has decreased.

<110> UCELLPHARMA <120> Composition for preventing, alleviating or treating fatty liver disease comprising Cannabis sativa stem extract as effective component <130> PN20245 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-f <400> 1 tcggagaact tgcaggagtt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FASN-r <400> 2 cggagtgaat ctgggttgat 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-f <400> 3 gcccctctac ttggaagacg a 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SCD-r <400> 4 aagtgatccc atacagggct c 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-f <400> 5 cagtagactg gtggggccta 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AKT3-r <400> 6 atcaagagcc ctgaaagcaa 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-f <400> 7 aggtggagga cacactgacc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF1-r <400> 8 caggacaggc agaggaagac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-f <400> 9 caagcttcta aagggcatcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SREBF2-r <400> 10 gagaggcaca ggaaggtgag 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-f <400> 11 aatcgaggaa gcacctctca 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> XBP1-r <400> 12 actgaatggg gaaagggaac 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-f <400> 13 agtgaggaac aagccagagc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL6-r <400> 14 gaggtgccca tgctacattt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-f <400> 15 cctgtgagga ggacgaacat 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFa-r <400> 16 aggccccagt ttgaattctt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-f <400> 17 tcagcacctc tcaagcagaa 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL1b-r <400> 18 agctgactgt cctggctgat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-f <400> 19 actccagtcc tctcctgcaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FGF21-r <400> 20 gcacaggaac ctggatgtct 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-f <400> 21 tggaactcta ttgcccttgc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LECT2-r <400> 22 aatggggtat ccatcccttc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-f <400> 23 ctgtgcatac tgcaggcatc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SELENOP-r <400> 24 caagacggcc acatctatca 20

Claims (7)

A health functional food composition for preventing or improving fatty liver disease containing hemp stem extract as an active ingredient. According to claim 1, wherein the extraction solvent of the hemp stem extract is water, C ₁ ~ C ₄ Health functional food composition for preventing or improving fatty liver disease, characterized in that it is a lower alcohol or a mixture thereof. According to claim 1, wherein the fatty liver disease is non-alcoholic simple fatty liver; nonalcoholic steatohepatitis; And a health functional food composition for preventing or improving fatty liver disease, characterized in that any one selected from non-alcoholic cirrhosis. The health functional food composition for preventing or improving fatty liver disease according to claim 1, wherein the hemp stem extract reduces the content of triglycerides in liver tissue. The health functional food for preventing or improving fatty liver disease according to claim 1, wherein the hemp stem extract is prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders. composition. A pharmaceutical composition for preventing or treating fatty liver disease, comprising hemp stem extract as an active ingredient. The pharmaceutical composition for preventing or treating fatty liver disease according to claim 6, further comprising a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient.

Images