KR102500342B1 - Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component - Google Patents

Abstract

The present invention relates to a composition for preventing, improving or treating hypercholesterolemia containing a cannabis stem extract as an active ingredient. It also reduces the expression level and has the effect of lowering the cholesterol content in the blood without a significant change in body weight in animal models. Therefore, the composition of the present invention can be usefully used in health functional foods and pharmaceuticals related to hypercholesterolemia.

Description

Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component}

The present invention relates to a composition for preventing, improving or treating hypercholesterolemia, containing a cannabis stem extract as an active ingredient.

Cholesterol is absorbed through food, but it is also synthesized in our body. Cholesterol is found in high concentrations in organs with many membranes, such as the liver, spinal cord and brain, and is a major component of blood clots. Cholesterol plays an important role in many physiological and biochemical reactions and is closely related to cardiovascular disease.

Cholesterol is mainly produced in the liver, and lipoprotein (lipoprotein) present in the blood plays a role in transporting cholesterol throughout the body. There are two types of lipoproteins, low density lipoprotein (LDL) and high density lipoprotein (HDL). Since HDL transports cholesterol from other tissues to the liver, when HDL is high, cholesterol in blood vessels is reduced. Removed. LDL is mainly produced in the liver and transported to other tissues in the body, so if there is a lot of LDL, a lot of cholesterol accumulates in the blood vessels. Specifically, the cholesterol is an essential component for maintaining normal functions of the human body, an essential nutrient for making biological membranes and cells, a component for various hormones such as adrenal cortical hormones and sex hormones, and a material for making bile. do.

Cholesterol levels in the blood vary according to race, sex, and age. In Korea, it is usually considered normal when cholesterol is less than 240 mg per 1 dL of blood, and hypercholesterolemia is when cholesterol in the blood is 240 mg / dL or more. High cholesterol can be caused by genetic factors, and occurs when saturated fat and cholesterol are consumed through foods such as meat. When cholesterol is excessively accumulated in the body and becomes hypercholesterolemia, it can cause fatal diseases such as cardiovascular diseases as well as neurodegenerative diseases.

On the other hand, as hemp-related technology, Korean Patent No. 2041875 discloses a pharmaceutical composition for preventing or treating colorectal cancer containing a cannabidiol extract and trail extracted from hemp, and Korean Patent No. 1198017 discloses hemp fiber However, a composition for preventing, improving or treating hypercholesterolemia containing the hemp stem extract of the present invention as an active ingredient has not been disclosed.

The present invention has been derived from the above needs, and the present invention provides a composition for preventing, improving or treating hypercholesterolemia containing a cannabis stem extract as an active ingredient, and the cannabis stem extract of the present invention is not cytotoxic. The present invention was completed by confirming that there is no effect, lowers the cholesterol content in hepatocytes, reduces the expression level of the cholesterol synthesis gene, and lowers the blood cholesterol content without a significant change in body weight in an animal model.

In order to achieve the above object, the present invention provides a health functional food composition for preventing or improving hypercholesterolemia containing hemp stem extract as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating hypercholesterolemia comprising a cannabis stem extract as an active ingredient.

The present invention relates to a composition for preventing, improving or treating hypercholesterolemia containing a cannabis stem extract as an active ingredient. It also reduces the expression level and has the effect of lowering the cholesterol content in the blood without a significant change in body weight in animal models.

Figure 1 confirms the survival rate of HepG ₂ cells according to the treatment of cannabis stem extract. (A) is the cell survival rate under normal carbohydrate metabolism conditions and (B) is under abnormal carbohydrate metabolism conditions with low glucose content. **, *** indicates that the cell viability was statistically significantly increased compared to the control group not treated with the cannabis stem extract, ** is p<0.01, and *** is p<0.001.
Figure 2 is a result of confirming the total cholesterol content in hepatocytes according to the treatment of hemp stem extract, ## is the cholesterol content in the group inducing high cholesterol by treating fructose compared to the control group in which high cholesterol was not induced increased, p <0.01, *, *** means that the cholesterol content was statistically significantly reduced by treatment with hemp stem extract or Lovastatin, * is p <0.05, *** is p <0.001.
Figure 3 is the result of confirming the change in the expression level of cholesterol synthesis-related genes according to the treatment of the cannabis stem extract of the present invention. # indicates that the expression level of cholesterol synthesis-related genes increased in the high cholesterol group (Fructose 20mM) compared to the normal group (Control), p<0.05, and * in the hemp stem extract treatment group of the present invention compared to the high cholesterol induction group This means that the expression level of genes related to cholesterol synthesis was statistically significantly decreased, p<0.05.
Figure 4 is the result of confirming the weight change of the animal model according to the treatment of the cannabis stem extract of the present invention.
Figure 5 confirms the change in cholesterol content in hepatocytes of animal models according to the treatment of the cannabis stem extract of the present invention. (A) shows the total cholesterol content, and (B) confirms the ratio of total cholesterol/HDL-cholesterol. #### indicates a statistically significant increase in the total cholesterol content or total cholesterol/HDL-cholesterol ratio of the high-cholesterol group induced by fructose compared to the normal group, p<0.0001, *, ***, **** indicates that the total cholesterol content or the total cholesterol/HDL-cholesterol ratio of the group treated with the hemp stem extract of the present invention compared to the total cholesterol content or total cholesterol/HDL-cholesterol ratio of the high cholesterol group was statistically significant It means that * is p<0.05, *** is p<0.001, and **** is p<0.0001.

The present invention relates to a health functional food composition for preventing or improving hypercholesterolemia containing hemp stem extract as an active ingredient.

The hemp stem extract may be prepared by a method comprising the following steps, but is not limited thereto:

(1) extracting by adding an extraction solvent to hemp stem ( Cannabis sativa stem);

(2) filtering the extract of step (1); and

(3) preparing an extract by concentrating the filtered extract of step (2) under reduced pressure and drying.

In the step (1), the extraction solvent is preferably selected from water, C ₁ ~ C ₄ lower alcohol, or mixtures thereof, more preferably water, but is not limited thereto.

Hemp stem extraction in the present invention can use all conventional methods known in the art, such as filtration, hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction. The extraction solvent is preferably extracted by adding 1 to 20 times the weight of the dried hemp stem, more preferably 5 to 15 times. The extraction temperature is preferably 50 to 150 ° C, but is not limited thereto. In addition, the extraction time is preferably 6 to 24 hours, more preferably 10 to 14 hours, but is not limited thereto. In the above method, the vacuum concentration in step (3) is preferably performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, but is not limited thereto.

The hemp stem extract is characterized by reducing low-density lipoprotein (LDL)-cholesterol and increasing high-density lipoprotein (HDL)-cholesterol.

The hemp stem extract is preferably prepared in any one formulation selected from beverages, pills, tablets, capsules, and powders, but is not limited thereto.

The health functional food composition of the present invention may be added with hemp stem extract as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods. There is no particular limitation on the type of health functional food composition. Examples of foods to which the hemp stem extract can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, There are drinks, alcoholic beverages, and vitamin complexes, and includes all health functional foods in a conventional sense. A health drink containing the composition of the present invention may contain various flavoring agents or natural carbohydrates as additional components like conventional drinks. The aforementioned natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 g of the composition of the present invention.

In addition to the above active ingredients, the health functional food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, and preservatives. , glycerin, alcohol, a carbonating agent used in carbonated beverages, and the like may be further contained. In addition, it may further contain fruit flesh for the manufacture of fruit juice or vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not very important, but is generally selected in the range of 0.01 to 2 parts by weight based on 100 parts by weight of the composition of the present invention.

In addition, the present invention relates to a pharmaceutical composition for preventing or treating hypercholesterolemia comprising a cannabis stem extract as an active ingredient.

The pharmaceutical composition of the present invention may be in various oral or parenteral dosage forms. In the case of formulation, it may further include a pharmaceutically acceptable carrier, excipient or diluent in addition to the above active ingredients, using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants or surfactants. can be formulated. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose ( lactose) and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending solvents. As the base of the suppository, witepsol, macrogol, tween) 61, cacao butter, laurin paper, glycerogelatin, etc. may be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it is preferable to select an external skin or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine epidural or intracerebrovascular injection method.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is based on the type, severity, and activity of the drug in the patient. , sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the composition of the present invention varies in its range depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of the disease, and the daily dosage is based on the amount of cannabis stem extract. 0.01 to 2,000 mg/kg as a standard, preferably 30 to 500 mg/kg, and more preferably 50 to 300 mg/kg, and may be administered 1 to 6 times a day. The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

Hereinafter, the present invention will be described in more detail using examples. These examples are only for explaining the present invention in more detail, and it is obvious to those skilled in the art that the scope of the present invention is not limited thereto.

[Cell culture]

HepG ₂ carcinoma cells were purchased from ATCC (American Type Culture Collection, Seoul, Korea). HepG ₂ cells were subcultured every 2 days using ^DMEM medium (including 25 mM glucose, 10% FBS, and 1% antibiotics) to maintain the status quo. -myristate 13-acetate) was seeded together.

Example 1. Preparation of Hemp Stem Hot Water Extract

After adding 30 liters of water to 3 kg of cannabis stems grown for about 2 months, hot water extraction was performed at 100-120 ° C for 12 hours. This was lyophilized to obtain 108.69 g of extract.

Example 2. Hepatocytotoxicity confirmation of hemp stem hot water extract

In order to confirm hepatocellular toxicity of the cannabis stem hot water extract, HepG ₂ cells were spread on a 96-well plate, and the cannabis stem hot water extract was added at concentrations of 50, 100, 200, 400, 600, 800 and 1000 μg/ml. treatment, DMEM medium containing 25 mM glucose (25 mM glucose, 10% FBS, 1% penicillin/streptomycin mixture) and DMEM medium containing 5.5 mM glucose (5.5 mM glucose, 1% FBS, 1% penicillin) /streptomycin mixture), respectively. After 24 hours, CCK-8 was added to the medium at a concentration of 10%, followed by reaction at 37 ° C for 2 hours, and then absorbance was measured at 450 nm using a microplate spectrometer. Relative cell viability (%) was confirmed through comparison.

As a result, as shown in FIG. 1, it was confirmed that almost no cytotoxicity was observed even when the hot-water cannabis stem extract was treated at a concentration of 50 to 1000 μg/ml regardless of the glucose content contained in the medium. When the cannabis stem hot-water extract was treated in a medium containing a low concentration of glucose, it was confirmed that the cell viability was statistically significantly improved.

Cell viability according to the change in glucose content in a high-cholesterol cell model under conditions in which the glucose content was adjusted to maintain the glucose content constant when the medium condition containing low concentrations of glucose was treated with fructose to induce high cholesterol. is to check

Example 3. Confirmation of Changes in Total Cholesterol Content in Hepatocytes According to Treatment of Hemp Stem Hot Water Extract

HepG ₂ cells were treated with the hot water extract of cannabis stem, and 3 days later, the total cholesterol content was measured using the Cholesterol Cell-Based Detection Assay Kit (Cayman Chemical) according to the manufacturer's method.

As a result, as shown in FIG. 2, it was confirmed that the total cholesterol content increased by the treatment with fructose, and the total cholesterol content was statistically significant when 400 μg/ml of the cannabis stem extract of the present invention was treated. It was confirmed that the decrease

Example 4. Confirmation of Expression Changes in Cholesterol Synthesis Related Genes by Treatment of Hemp Stem Hot Water Extract

RNA isolation was performed according to the Trizol method, and separated according to the manufacturer's method using the Easy spid-RNA extraction kit (Intron, Seoul, Korea). After measuring and quantifying the concentration with a Nanodrop DS-11 spectrometer (DeNovix, Wilmington, DE USA), cDNA was synthesized from each RNA using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA), and each gene Expression of each gene was compared by q-PCR using a CFX96 Real Time PCR machine (BioRad, Hercules, CA, USA) and SsoAdvenced ^™ universal Sybrgreen supermix (BioRad, Hercules, CA, USA). The primer information used is shown in Table 1, and the conditions of real-time PCR were amplified by 40 cycles (95 ° C, 30 seconds; 58 ° C, 30 seconds; 72 ° C, 30 seconds). Relative quantification was performed by qPCR of the target group using GAPDH or 18S rRNA as an internal standard.

Primer information of gene gene directional Sequence (5'->3') sequence number HMGCR forward TGCTTTGGCTGCATGTCAGT SEQ ID NO: 1 reverse GCTATCCAGCGACTGTGAGC SEQ ID NO: 2 HMGCS1 forward CCTGGTAGTTGCAGGAGATA SEQ ID NO: 3 reverse CTAATGCACTGAGGTAGCAC SEQ ID NO: 4 ACAT2 forward TGGCTCCGGAAGATGTGTCT SEQ ID NO: 5 reverse CCTCCTGCAACCACAATGCT SEQ ID NO: 6 MVD forward CGAGTCACACTGGCCTGAAC SEQ ID NO: 7 reverse GGATGATGCGCCAGGAGATG SEQ ID NO: 8 LSS forward ACTTCGCCAGCATTGACTGG SEQ ID NO: 9 reverse GTCCACATACCAGCGCACAA SEQ ID NO: 10 SQLE forward CTTTGGCCAACAGGGAGGTC SEQ ID NO: 11 reverse TGGTTCCTTTTCTGCGCCTC SEQ ID NO: 12 DHCR7 forward ACCTTGTGGGTCACCTTCCA SEQ ID NO: 13 reverse GCAGTGGGATCCAGTTGTCG SEQ ID NO: 14 CYP51A1 forward GTAGCAGGGATGCTTATTGG SEQ ID NO: 15 reverse GATGTCCTGGAGGAATGGTA SEQ ID NO: 16 GAPDH forward GAGTCAACGGATTTGGTCGT SEQ ID NO: 17 reverse GTTGTCATGGATGACCTTGG SEQ ID NO: 18

In order to confirm the effect of hemp stem extract on inhibiting intracellular cholesterol metabolism, HMGCR (HMG-CoA reductase), HMGCS1 (3-hydroxy-3-methylglutaryl-CoA synthase 1), ACAT2 (acetyl-CoA) involved in cholesterol biosynthesis acetyltransferase 2), MVD (mevalonate diphosphate decarboxylase), LSS (lanosterol synthase), SQLE (squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase), and CYP51A1 (cytochrome P450 family 51 subfamily A member1) gene expression changes were confirmed. As shown in FIG. 3, it was confirmed that the expression level of cholesterol synthesis related genes was increased by the fructose treatment, and in contrast, when the cannabis stem hot water extract of the present invention was treated, the expression level of cholesterol synthesis related genes was decreased.

Example 5. Confirmation of changes in body weight and cholesterol content in high-cholesterol animal models following the administration of hot-water extract of cannabis stem

C57BL/6 mice (male, 5 weeks old) were purchased from Orient Bio (Seongnam, Korea) and used for testing after acclimatization for 1 week.

Breeding environment is SPF breeding area, temperature range: 20.1 ~ 22.1 ℃, relative humidity: 46.8 ~ 52.9%, ventilation frequency: 10 ~ 15 times / hr, lighting time and light-dark cycle: 12 hours light-dark cycle illuminance: 175 lux environment Two cage changes were performed, and 2 to 4 mice were housed per cage. Purified water, general feed (Harlan Co., Ltd.) and high-cholesterol feed (D12336, Research diets) were freely consumed through a feeder. Before the start of the experiment, blood was collected by orbital bleed and divided into groups based on total cholesterol. After dividing into groups, a high-cholesterol feed was supplied and oral administration of 100, 300, and 500 mg/kg of cannabis stem extract and 30 mg/kg of comparative drug simvastatin was administered once a day for 12 weeks. did Weight and feed intake were measured once a week, and serum was separated through orbital blood sampling once every 4 weeks and analyzed using a serum analyzer (Toshiba, Accute).

Composition of Efficacy Test Group of Hemp Stem Extract Using Animal Model test group Dietary feed administration substance Dosage concentration
(mg/kg) number of animals G1 general feed Vehicle (0.5% CMC) 10 8 G2 high cholesterol feed Vehicle (0.5% CMC) 10 8 G3 high cholesterol feed Simvastatin 30 8 G4 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 100 8 G5 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 300 8 G6 high cholesterol feed Hemp Stem Hot Water Extract (CSE) 500 8

As a result, although the weight gradually increased for 12 weeks, there was little change in body weight between groups (FIG. 4), and after 12 weeks, the total cholesterol content and total cholesterol / HDL ratio of the group that ate cholesterol feed were In contrast, it was confirmed that the total cholesterol content and total cholesterol/HDL ratio decreased statistically significantly in the groups (G4-G6) fed with the cannabis stem extract of the present invention (FIG. 5).

[Statistical Processing]

In the present invention, statistical significance was tested through the ANOVA test, and the statistical method used the GraphPad Prism 5.01 program, a statistical package widely used commercially.

<110> UCELLPHARMA <120> Composition for preventing, ameliorating or treating hypercholesterinemia containing Cannabis sativa stem extract as effective component <130> PN22384 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCR-f <400> 1 tgctttggct gcatgtcagt 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCR-r <400> 2 gctatccagc gactgtgagc 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCS1-f <400> 3 cctggtagtt gcaggagata 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> HMGCS1-r <400> 4 ctaatgcact gaggtagcac 20 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> ACAT2-f <400> 5 tggctccgga agatgtgtct 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> ACAT2-r <400> 6 ccctcctgcaa ccacaatgct 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> MVD-f <400> 7 cgagtcacac tggcctgaac 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> MVD-r <400> 8 ggatgatgcg ccaggagatg 20 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> LSS-f <400> 9 acttcgccag cattgactgg 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> LSS-r <400> 10 gtccacatac cagcgcacaa 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> SQLE-f <400> 11 ctttggccaa cagggaggtc 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> SQLE-r <400> 12 tggttccttt tctgcgcctc 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> DHCR7-f <400> 13 accttgtggg tcaccttcca 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> DHCR7-r <400> 14 gcagtgggat ccagttgtcg 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> CYP51A1-f <400> 15 gtagcaggga tgcttattgg 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> CYP51A1-r <400> 16 gatgtcctgg aggaatggta 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH-f <400> 17 gagtcaacgg atttggtcgt 20 <210> 18 <211> 20 <212> DNA <213> artificial sequence <220> <223> GAPDH-r <400> 18 gttgtcatgg atgaccttgg 20

Claims (4)

Contains hemp stem water extract as an active ingredient, reduces low-density lipoprotein (LDL)-cholesterol, increases high-density lipoprotein (HDL)-cholesterol, and is involved in cholesterol biosynthesis, HMGCS1 (3-hydroxy-3-methylglutaryl- CoA synthase 1), ACAT2 (acetyl-CoA acetyltransferase 2), SQLE (squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase), and CYP51A1 (cytochrome P450 family 51 subfamily A member1) expression levels were reduced, and the dose was 1 A health functional food composition for preventing or improving hypercholesterolemia, characterized in that it is administered in an amount of 300 to 500 mg per 1 kg of mouse body weight on a daily basis. The method of claim 1, wherein the cannabis stem water extract is prepared in any one formulation selected from beverages, pills, tablets, capsules and powders for preventing or improving health for hypercholesterolemia. Nutraceutical composition. Contains hemp stem water extract as an active ingredient, reduces low-density lipoprotein (LDL)-cholesterol, increases high-density lipoprotein (HDL)-cholesterol, and is involved in cholesterol biosynthesis, HMGCS1 (3-hydroxy-3-methylglutaryl- CoA synthase 1), ACAT2 (acetyl-CoA acetyltransferase 2), SQLE (squalene epoxidase), DHCR7 (7-dehydroxholesterol reductase), and CYP51A1 (cytochrome P450 family 51 subfamily A member1) expression levels were reduced, and the dose was 1 A pharmaceutical composition for preventing or treating hypercholesterolemia, characterized in that it is administered in an amount of 300 to 500 mg per 1 kg of body weight of a mouse on a daily basis. The pharmaceutical composition for preventing or treating hypercholesterolemia according to claim 3, further comprising a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredient.

Images