KR20220141248A - Primer set for loop-mediated isothermal amplification reaction for diagnosing infectious respiratory diseases - Google Patents

Abstract

The present invention relates to a LAMP primer set for diagnosis of respiratory diseases that can be tested on-site, and has the advantage of detecting a genetic material of a pathogen and presenting diagnostic results at an early stage of infection, and does not require expensive equipment and highly skilled personnel. As an embodiment of the present invention, the pathogen can be Mycobacterium tuberculosis (TB), nontuberculous mycobacteria (NTM), SARS-CoV-2, and/or influenza virus.

Description

Primer set for loop-mediated isothermal amplification reaction for diagnosing infectious respiratory diseases

The present invention relates to a LAMP primer set for diagnosing an infectious respiratory disease, and more particularly, to a LAMP primer set for amplifying a target gene of a pathogen in order to be provided in a Nucleic Acid Lateral Flow (NALF) method.

Since it is difficult to identify the exact cause of an infectious respiratory disease only with symptoms and signs, it is necessary to develop a diagnostic method that can accurately identify the causative pathogen. Standard diagnostic methods for infectious respiratory diseases known to date include identification of bacteria through culture, serological testing, and genetic testing through polymerase reaction (PCR). In the case of the identification of bacteria through culture, it takes 7 to 21 days to identify the bacteria, and since only 40 to 90% of the bacteria are cultured, there is a limit to practical use in the clinical field. And although serological diagnosis is the most widely used method, it takes a long time and has problems such as low sensitivity. In addition, real-time PCR is very expensive equipment and reagents, requires a skilled technician, and takes about 2 hours to test, so there is a limit to applying it to the field.

Recently, a loop-mediated isothermal amplification reaction (LAMP) that amplifies a gene at a constant temperature without temperature change has been developed. The LAMP method uses six primers complementary to the template to recognize eight different sites and proceed with gene amplification. Compared with the conventional PCR method, the test time can be shortened in that amplification can be performed without temperature change, and the test can be performed without expensive equipment for temperature change.

On the other hand, Lateral Flow Immuno Assay (LFA) is an analysis technology that can detect a sample (target material) in an unknown sample through a sandwich immunoassay technique using nanoparticles and a sample flow using a membrane. The lateral flow immunoassay method can be used for diagnosis in various medical/environmental fields or for non-medical self-testing because the analysis principle is simple, the analysis time is short, and the production cost is low.

The present inventors developed a Nucleic Acid Lateral Flow (NALF) system that amplifies the viral genome using LAMP and detects the amplified product using LFA to enable Point-Of-Care Testing (POCT) of infectious respiratory diseases. The present invention was completed by intensive research for this purpose.

The technical problem to be achieved by the present invention is to provide an optimized NALF system for detecting the causative agent of an infectious respiratory disease.

Another object of the present invention is to provide a LAMP primer set applied to the NALF system for diagnosing infectious respiratory diseases.

Another object of the present invention is to provide a kit for detecting a pathogen causing an infectious respiratory disease, including the LAMP primer set.

Another object of the present invention is to provide a method for detecting a pathogen causing an infectious respiratory disease by mixing the LAMP primer set and a biological sample.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention provides a primer set for an isothermal amplification reaction (LAMP) for detecting a pathogen causing an infectious respiratory disease.

In one embodiment of the present invention, the pathogen is Mycobacterium tuberculosis (TB), nontuberculous mycobacteria (NTM), SARS-CoV-2 and / or influenza virus (influenza virus) ) can be

As another embodiment of the present invention, the primer set for LAMP consists of Corona19-orf1ab_LAMP primer set, Corona19-N gene_LAMP primer set, TB-IS6110_LAMP primer set, and NTM-RpoB_LAMP primer set shown in Tables 1 and 6 below. It may be at least one selected from the group.

In another embodiment of the present invention, the probe of the primer set for LAMP may have a fluorescent material or biotin attached to the end.

In another embodiment of the present invention, the fluorescent material is FAM (6-carboxyfluorescein), DIG (Digoxigenin), FITC (fluorescein isothiocyanate), Texas red (texas red), fluorescein (fluorescein), HEX (2', 4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetra methyl rhodamine, oregon green, alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6- Carboxyl-XRhodamine), TET (Tetrachloro-Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, cyanine It may be thiadicarbocyanine and the like, but is not limited thereto. The fluorescent material may be attached to the 5' end of the probe.

In addition, the present invention is composed of Mycobacterium tuberculosis (TB), and Mycobacterium tuberculosis (NTM), and SARS-CoV-2 (SARS-CoV-2), including the LAMP primer set and reagents for performing the amplification reaction. A kit for detecting any one or more pathogens selected from the group may be provided.

In one embodiment of the present invention, the reagent for performing the amplification reaction may include any one or more selected from the group consisting of DNA polymerase, dNTPs, and a buffer, but is not limited thereto.

In addition, the present invention provides a sample dropper for introducing the LAMP primer set and reagents for performing the amplification reaction; And from the group consisting of Mycobacterium tuberculosis (TB), and Mycobacterium tuberculosis (NTM), and SARS-CoV-2, including; A rapid kit for detecting any one or more selected pathogens may be provided.

In one embodiment of the present invention, the strip includes a sample pad (sample pad) for absorbing the sample injected into the dripping portion at the lower end; an absorption pad for allowing the sample absorbed in the sample pad to be positioned opposite to the dripping portion; and a detection panel positioned between the sample pad and the absorption pad.

In another embodiment of the present invention, a material capable of specifically binding to the fluorescent material of the primer set may be fixed to the band region located on the detection panel, and the material may be an antibody, an aptamer, a ligand, etc. , but is not limited thereto.

In another embodiment of the present invention, the kit may additionally include a conjugate pad between the sample pad and the detection panel.

As another embodiment of the present invention, the conjugate pad may have metal nanoparticles capable of specifically binding to biotin of the primer set fixed therein.

In another embodiment of the present invention, when the kit includes a biological sample, a LAMP primer set, and a reagent for performing an amplification reaction, a visible band appears in the band region of the detection pad when the biological sample contains a pathogen. it could be

In addition, the present invention can provide a method for detecting a pathogen of an infectious respiratory disease by mixing the primer set for LAMP with a biological sample, a method for diagnosing whether the pathogen is infected, or a method for providing information for diagnosing whether an infection is present .

In one embodiment of the present invention, the biological sample may be a respiratory sample or saliva of an individual, and the respiratory sample is Nasopharyngeal aspirate (nasopharyngeal aspirate), nasopharyngeal swab (nasopharyngeal smear), Throat swab (throat smear), and Bronchoalveolar lavage (bronchial lavage) and the like.

As another embodiment of the present invention, the method may further include a pretreatment step of performing LAMP by mixing a biological sample with chelex-100, and the pretreatment step may include a boiling step after mixing with chelex-100 .

In another embodiment of the present invention, the method may include amplifying a LAMP primer set mixed with a biological sample at a predetermined temperature.

As another embodiment of the present invention, the amplification step may be performed in any one or more incubators selected from the group consisting of a heat block, a sol gel, and a temperature maintaining device. Preferably, the amplification step is performed in a heat block, and a small amount of water may be mixed to maintain 60 ~ 65 ℃.

The present invention relates to a LAMP primer set for diagnosing a respiratory disease that can be inspected on-site. It has the advantage of not doing it.

In addition, since the LAMP is performed by extracting the genome from the sample using chelex-100, the test can be performed simply by mixing the sample included in the kit, so the present invention has the advantage that a highly skilled person is not required for diagnosis.

In addition, the present invention provides specific reaction conditions so that more accurate and rapid diagnostic results can be confirmed.

Effects of the present invention are not limited to those mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 is a schematic diagram of the principle of LFA using the LAMP method.
2 is a schematic diagram of the analysis principle of sample reading using LFA.
3 is a schematic diagram of a NALF kit for detecting a pathogen of an infectious respiratory disease of the present invention.
4 is a view confirming the reaction results by performing LAMP on the heat block and applying the amplification product to the NALF rapid kit (left panel: TB sample, right panel: NTM sample).
5 is a view confirming the reaction results by performing LAMP on CFX96 and applying the amplification product to the NALF rapid kit (left panel: TB sample, middle panel: NTM sample, right panel: negative sample (NC)).
6 and 7 are diagrams confirming the reaction results by performing LAMP on CFX96 and applying the amplification product to the NALF rapid kit. Each line of the detection panel is Biotin-FAM detection, DIG-FAM detection, and Control detection line in the order closest to the sample dripping part. The sample of FIG. 6 is a positive control (PC) and a negative control (NC) with different KRISS concentrations, and FIG. 7 is a clinical specimen.
8 and 9 are diagrams confirming the reaction results by performing LAMP on an incubator and applying the amplification product to the NALF rapid kit. Each line of the detection panel is Biotin-FAM detection, DIG-FAM detection, and Control detection line in the order closest to the sample dripping part. The samples of FIG. 8 are positive control (PC) and negative control (NC) with different KRISS concentrations, and FIG. 9 is a clinical specimen.

The present inventors have studied a method for diagnosing infectious respiratory diseases that can be tested on-site or by self-examination, and completed a NALF system for diagnosing infectious respiratory diseases that can be used for POCT.

In the prior art, in order to obtain an accurate pathogen test result for an infectious respiratory disease, PCR was most common. Genetic testing through PCR can provide the most accurate test results, but there is a problem that equipment for performing PCR is very expensive, a skilled technician is required to operate it, and it takes a relatively long time.

The NALF (Nucleic Acid Lateral Flow) system is a system that detects genetic material using lateral flow immunoassay, and the present inventors amplify pathogen-specific genes using isothermal amplification (LAMP), and We propose a method for promptly presenting test results in the field by labeling small molecules such as biotin, digoxigenin, and DNP and fluorescent substances such as FITC, FAM, and Texas Red and detecting them through lateral flow immunoassay. .

The NALF system detects a target by sandwich bonding between a target-specific material such as an antibody fixed on an LFA strip, a genetic material labeled with the small molecule and fluorescent material, and a probe or metal nanoparticle. It is necessary that the hybrid bond of the labeled double-stranded genetic material remains stable. Therefore, the buffer and reaction conditions provided for the NALF system must be carefully adjusted according to the length of the target genetic material and the labeled material.

On the other hand, for gene amplification of pathogens, a genome extraction process that removes impurities other than the genome must be accompanied. The present invention simplifies the pretreatment step of the sample by processing the chelex-100 of the sample without a process such as centrifugation and performing a boiling step.

The sample subjected to the above-described pretreatment step is mixed with the Mix containing the LAMP primer set to induce an amplification reaction of the target gene. The LAMP primer should be designed to stably amplify only the target gene, and in the present invention, the primer set in Table 1 is provided for differential diagnosis of Mycobacterium tuberculosis and non-Mycobacterium tuberculosis infection in tuberculosis patients specifically, and SARS-CoV -2 The primer sets in Table 6 are provided for the diagnosis of infection.

Each target gene can be two or more, and multiplex-PCR can be performed by mixing two or more LAMP primer sets corresponding to the target gene. and can improve the accuracy of COVID-19 diagnosis.

On the other hand, the terminal of the LAMP amplification product may be labeled with FAM, Cy5, Texas Red, or various fluorescent substances, and the fluorescent substance is not limited, but preferably FITC, FAM, or Digoxigenin.

In addition, after performing LAMP, the sample containing the amplification product may be mixed with a buffer and administered to the sample dripping portion of the body, and the rapid kit of the present invention may include the buffer.

Then, the sample administered to the dripping part is absorbed by the LFA strip and moves to the upper part of the strip where the absorbent pad is located through capillary action. At this time, when the sample contains a pathogen, the amplified target gene amplified and labeled through LAMP is bound to a band located on the detection panel to form a visible line.

A material capable of specifically binding to the fluorescent material is fixed to the band region located on the detection panel, and the material may be an antibody, aptamer, ligand, etc. capable of specifically binding to the fluorescent material, Preferably, it may be an antibody.

A band region on the detection panel is provided to correspond to the number of targets to be detected, a material specific to one target is fixed to each band, and a distance may be maintained so that each band region is distinguished from each other.

On the other hand, the LFA strip of the present invention has a conjugate pad region in which metal nanoparticles are fixed so that they can bind with the biotin-labeled target gene amplification product during the transfer of the sample from the sample storage unit to the detection panel. may include.

The present invention can apply various transformations and can have various embodiments. Hereinafter, specific embodiments are illustrated in the drawings and described in detail in the detailed description. However, this is not intended to limit the present invention to specific embodiments, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, if it is determined that a detailed description of a related known technology may obscure the gist of the present invention, the detailed description thereof will be omitted.

Example 1. TB NALF test

Sputum and bronchial aspirate samples from tuberculosis patients and non-tuberculous mycobacterium-infected patients were provided at Korea University Guro Hospital. Each sample was pre-treated with chelex-100 and boiling, followed by an isothermal amplification reaction (LAMP), and NALF test was performed by applying the reaction product to a rapid kit. The source of infection of each sample was confirmed by real-time PCR at the hospital. Specific information on primers for LAMP is shown in Table 1 below, and the composition of the reaction mixture is shown in Tables 2 and 3 below. (In this case, N in the primer sequence of Table 1 means inosine (I).)

/primer Vol (μl) Primer sequence SEQ ID NO: TB-IS6110_
LAMP
primer
set IS6110_F3 4 GGTCGGAAGCTCCTATGACA One IS6110_B3 4 TAGGCAGCCTCGAGTTCG 2 IS6110_FIP_Biotin 36 Biotin-AGGGCTTGCCCGGGTTTGATCATGCACTAGCCGAGACGA 3 IS6110_BIP_Biotin 36 Biotin-CGGTCCATCGAGGATGTCGAGTCGCCGCAGTACTGGTAGA 4 IS6110_LF_FAM 20 FAM-CTCGGTCTTGTATAGGCCGT 5 IS6110_LB_FAM 20 FAM-ACCGCGCGCTGGGTCGA 6 NTM-RpoB_
LAMP
primer
set rpoB_F3 4 CCGGTCACCGTGCTG 7 rpoB_B3 4 GTARCGCTTCTCCTTGAAGAAC 8 rpoB_FIP 36 TGTTGTCCTTCTCCAGNGTNNGCTGGACCANCGAGCA 9 rpoB_BIP 36 TGGACATCTACCGCAAGCTGCGTTYTCCARCAGGGTCTGC 10 rpoB_LF 14 DIG-CGGAGAANCCGAANCGCTC 11 rpoB_LB 20 DIG-CCGCCGACCAAAGAGTCAGC 12 rpoB_LF_PROBE4 FAM 6 FAM-CGGGCCCGTACAAAGGGAACACCCACACTCCGCGGAGAANCCGAANCGCTC 13

BZ-IsoMDx TB/NTM kit Volume (μl) 2X 1step LAMP Mix 14.5 PM 4.5 Template 6 TOTAL 25

Volume (μl) PM 2.9 (DW) 0.8 (IS6110-P2) 0.8 (NTM2-P4) Total 4.5

1-1. Running LAMP on a heatblock

In order to successfully perform LAMP on the heat block, reaction conditions were set as shown in Table 4 below and LAMP was performed. Then, 10 μl of the LAMP product and 100 μl of the buffer were mixed and dropped into the sample dropping part of the prepared rapid kit to confirm the reaction (FIG. 4).

63℃ 40 min heatblock / 1.5ml eptube

1-2. Running LAMP on CFX96

For successful LAMP operation, reaction conditions were set as shown in Table 5 below and LAMP was performed. Then, 5 μl of the amplification product (LAMP product) and 100 μl of the buffer were mixed and dropped into the sample dropping part of the prepared rapid kit, and the reaction was confirmed (FIG. 5).

62℃ 1 min 40 cycles CFX96 / Opaque Tube

Example 2. COVID19 NALF test

Each sample was pre-treated with chelex-100 and boiling (60-100 , 10 min), and after filtering, an isothermal amplification reaction (LAMP) was performed, and the NALF test was performed by applying the amplification product to a rapid kit. The source of infection of each sample was confirmed by real-time PCR at the hospital. Specific information of primers for LAMP is shown in Table 6 below, and the composition of the reaction mixture is shown in Table 7 below. (In this case, N in the primer sequence of Table 6 means inosine (I).)

Oligo Vol (μl) Sequence (5’-3’) SEQ ID NO: Corona19
orf1ab
LAMP
primer set Wuhan_orf1ab_F3-1 4 CCG ATA AGT ATG TCC GCA AT 14 Wuhan_orf1ab_B3 4 GCT TCA GAC ATA AAA ACA TTG T 15 COVID19_RDRP_FIP_5biotin 32 Biotin - ATG CGT AAA ACT CAT TCA CAA AGT CCA ACA CAG ACT TTA TGA GTG TC 16 COVID19_RDRP_BIP_5biotin 32 Biotin - TGA TAC TCT CTG ACG ATG CTG TTT AAA GTT CTT TAT GCT AGC CAC 17 COVID19_RDRP_LB_5FAM 10 FAM - GTC TTG TCT TTA RCC A 18 COVID19_RDRP_LF_5FAM 10 FAM - CCA GTG AGC GAG GAC TG 19 DW 8 TOTAL 100 Corona19_N
gene_LAMP
primer set Wu_LAMP_N_F3 4 TGGACCCCAAAATCAGCG 20 Wu_LAMP_N_B3 4 GCCTTGTCCTCGAGGGAAT 21 COVID19_N_FIP_FAM 32 FAM - CCACTGCGTTCTCCATTCTGGTAAATGCACCCCGCATTACG 22 COVID19_N_BIP_FAM 32 FAM - CGCGATCAAAACAACGTCGGCCCTTGCCATGTTGAGTGAGA 23 COVID19_N_LF_5DIG 10 DIG - TGAATCTGAGGGTCCACCAAA 24 COVID19_N_LB_5DIG 10 DIG - GGTTTACCCAATAATACTGCGTCTT 25 DW 8 TOTAL 100

LAMP Reagent Vol (μl) (Elpis Bio LAMP) MM 10 DW 3.125 PRIMER MIX 1.25 (RdRP) 0.625 (N) Template 5 TOTAL 20

2-1. Running LAMP on CFX96

Samples with different concentrations of KRISS (10 ^-4 , 10 ^-5 , 10 ^-6 ) In order to successfully perform LAMP, reaction conditions were set as shown in Table 8 below and LAMP was performed. Then, 10 μl of the amplification product and 100 μl of the buffer were mixed and dropped into the sample dropping part of the prepared rapid kit, and the reaction was confirmed for 10 minutes (FIG. 6).

62℃ 40 min template 5 μl CFX96 / Transparent Tube

In addition, sputum and bronchial aspirate samples of patients infected with COVID-19 were provided from Korea University Guro Hospital, LAMP was performed, the amplification product was dropped into the dripping part of the rapid kit, and the reaction was confirmed for 10 minutes (FIG. 7). A new DW was used.

2-2. Run LAMP on incubator

For successful LAMP performance, LAMP was performed under the same reaction conditions as in Table 8, but LAMP was performed in an incubator, not CFX96. Then, 10 μl of the LAMP product and 100 μl of the buffer were mixed and dropped into the sample dropping part of the prepared rapid kit, and the reaction was confirmed for 10 minutes (FIG. 8).

In addition, sputum and bronchial aspirate samples of patients infected with COVID-19 were provided from Korea University Guro Hospital, LAMP was performed, the amplification product was dropped into the dripping part of the rapid kit, and the reaction was confirmed for 10 minutes (FIG. 9).

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea University Research and Business Foundation <120> Primer set for loop-mediated isothermal amplification reaction for diagnosing infectious respiratory diseases <130> DP-2021-0283P1, APC-2022-0297 <150> KR 10-2021-0047325 <151> 2021-04-12 <150> KR 10-2021-0047326 <151> 2021-04-12 <150> KR 10-2021-0047324 <151> 2021-04-12 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IS6110_F3 <400> 1 ggtcggaagc tcctatgaca 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IS6110_B3 <400> 2 taggcagcct cgagttcg 18 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> IS6110_FIP_Biotin <400> 3 agggcttgcc gggtttgatc atgcactagc cgagacga 38 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IS6110_BIP_Biotin <400> 4 cggtccatcg aggatgtcga gtcgccgcag tactggtaga 40 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NS6110_LF_FAM <400> 5 ctcggtcttg tataggccgt 20 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> IS6110_LB_FAM <400> 6 accgcgcgct gggtcga 17 <210> 7 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> rpoB_F3 <400> 7 ccggtcaccg tgctg 15 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rpoB_B3 <400> 8 gtarcgcttc tccttgaaga ac 22 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> rpoB_FIP <400> 9 tgttgtcctt ctccagngtn ngctggacca ncgagca 37 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> rpoB_BIP <400> 10 tggacatcta ccgcaagctg cgttytccar cagggtctgc 40 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rpoB_LF <400> 11 cggagaancc gaancgctc 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rpoB_LB <400> 12 ccgccgacca aagagtcagc 20 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> rpoB_LF_PROBE4 FAM <400> 13 cgggcccgta caaagggaac acccacactc cgcggagaan ccgaancgct c 51 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Wuhan_orf1ab_F3-1 <400> 14 ccgataagta tgtccgcaat 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Wuhan_orf1ab_B3 <400> 15 gcttcagaca taaaaacatt gt 22 <210> 16 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> COVID19_RDRP_FIP_5biotin <400> 16 atgcgtaaaa ctcattcaca aagtccaaca cagactttat gagtgtc 47 <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> COVID19_RDRP_BIP_5biotin <400> 17 tgatactctc tgacgatgct gtttaaagtt ctttatgcta gccac 45 <210> 18 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> COVID19_RDRP_LB_5FAM <400> 18 gtcttgtctt tarcca 16 <210> 19 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> COVID19_RDRP_LF_5FAM <400> 19 ccagtgagcg aggactg 17 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Wu_LAMP_N_F3 <400> 20 tggaccccaa aatcagcg 18 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Wu_LAMP_N_B3 <400> 21 gccttgtcct cgagggaat 19 <210> 22 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> COVID19_N_FIP_FAM <400> 22 ccactgcgtt ctccattctg gtaaatgcac cccgcattac g 41 <210> 23 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> COVID19_N_BIP_FAM <400> 23 cgcgatcaaa acaacgtcgg cccttgccat gttgagtgag a 41 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> COVID19_N_LF_5DIG <400> 24 tgaatctgag ggtccaccaa a 21 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> COVID19_N_LB_5DIG <400> 25 ggtttaccca ataatactgc gtctt 25

Claims (17)

It includes the primers of SEQ ID NOs: 1 and 2 and the probes of SEQ ID NOs: 3 to 6,
It includes the primers of SEQ ID NOs: 7 to 10 and the probes of SEQ ID NOs: 11 to 13,
comprising the primers of SEQ ID NOs: 14 and 15 and the probes of SEQ ID NOs: 16 to 19;
comprising the primers of SEQ ID NOs: 20 and 21 and the probes of SEQ ID NOs: 22 to 25,
Mycobacterium tuberculosis (TB), and non-tuberculous mycobacterium (NTM), and isothermal amplification reaction for detecting any one or more pathogens selected from the group consisting of SARS-CoV-2 (loop-mediated isothermal amplification reaction, LAMP) primer set.
According to claim 1,
The probe is characterized in that a fluorescent material or biotin (biotin) is attached to the end, LAMP primer set.
3. The method of claim 2,
The fluorescent material is 6-carboxyfluorescein (FAM), digoxigenin (DIG), fluorescein isothiocyanate (FITC), texas red, fluorescein, and HEX (2',4',5',7'- tetrachloro-6-carboxy-4,7-dichlorofluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethyl rhodamine, Oregon green (oregon green), alexa fluor, JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-XRhodamine), TET (Tetrachloro- Fluorescein), TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes and selected from the group consisting of thiadicarbocyanine Which is characterized in that any one or more, LAMP primer set.
Selected from the group consisting of Mycobacterium tuberculosis (TB), and Mycobacterium tuberculosis (NTM), and SARS-CoV-2 (SARS-CoV-2), comprising the primer set of claim 1 and a reagent for performing an amplification reaction. A kit for detecting any one or more pathogens.
5. The method of claim 4,
The reagent for performing the amplification reaction is characterized in that it comprises any one or more selected from the group consisting of DNA polymerase, dNTPs, and a buffer.
a sample loading unit for introducing the primer set of claim 2 and a reagent for performing an amplification reaction; and
Selected from the group consisting of Mycobacterium tuberculosis (TB), including Mycobacterium tuberculosis (TB), and Mycobacterium tuberculosis (NTM), and SARS-CoV-2 (SARS-CoV-2), including strips for Lateral Flow Immuno Assay (LFA). A rapid kit for detecting any one or more pathogens.
7. The method of claim 6,
The strip includes a sample pad (sample pad) for absorbing the sample injected into the dripping portion at the lower end;
an absorption pad for allowing the sample absorbed in the sample pad to be positioned opposite to the dripping portion; and
A rapid kit comprising; a detection panel positioned between the sample pad and the absorption pad.
8. The method of claim 7,
In the band region located on the detection panel, a material capable of specifically binding to the fluorescent material of the primer set is fixed, the rapid kit.
9. The method of claim 8,
The specific binding material is an antibody, an aptamer, and any one or more selected from the group consisting of a ligand, the rapid kit, characterized in that.
8. The method of claim 7,
The kit is a rapid kit, characterized in that it further comprises a conjugate pad (conjugate pad) between the sample pad and the detection panel.
11. The method of claim 10,
The conjugate pad is a rapid kit, characterized in that metal nanoparticles capable of specifically binding to biotin of the primer set are fixed.
Selecting from the group consisting of Mycobacterium tuberculosis (TB), and Mycobacterium tuberculosis (NTM), and SARS-CoV-2 (SARS-CoV-2), comprising the step of mixing the primer set for LAMP of claim 1 with a biological sample A method of providing information for diagnosing whether one or more pathogens are being infected.
3. The method of claim 2,
The biological sample is at least one selected from the group consisting of nasopharyngeal aspirate, nasopharyngeal swab, throat swab, bronchoalveolar lavage, and saliva. Characterized, information providing method.
13. The method of claim 12,
The method is characterized in that it further comprises a pre-processing step of performing LAMP of boiling after mixing the biological sample with chelex-100, information providing method.
13. The method of claim 12,
The method, characterized in that it comprises the step of amplifying the LAMP primer set mixed with the biological sample at a constant temperature, information providing method.
16. The method of claim 15,
The amplification step is an information providing method, characterized in that it is performed in any one or more incubators selected from the group consisting of a heat block, a sol gel, and a temperature maintaining device.
16. The method of claim 15,
The amplification step is performed in a heat block, characterized in that 60 ~ 65 ℃ is maintained by mixing a small amount of water, information providing method.

Images