KR20220131481A - Composition for preventing hair loss and cosmetics for preventing hair loss using the same - Google Patents

Abstract

The present invention relates to a composition for preventing hair loss and a cosmetic for preventing hair loss using the same, and more particularly, to a composition for preventing hair loss using sulforaphane, and a cosmetic for preventing hair loss using the same. The composition for preventing hair loss and cosmetics for preventing hair loss according to an embodiment of the present invention have no side effects on the skin and are excellent in preventing hair loss.

Description

Composition for preventing hair loss and cosmetics for preventing hair loss using the same

The present invention relates to a composition for preventing hair loss and cosmetics for preventing hair loss using the same , and more particularly, to a composition for preventing hair loss using sulforaphane and cosmetics for preventing hair loss using the same.

With the development of modern science, the development of various cosmetics is increasing day by day in response to the needs of people who want beautiful and young skin. Related companies are developing products that are more upgraded than existing cosmetics, and are also contributing to the birth of so-called cosmeceutical cosmetics that focus on treatment and functionality rather than beauty.

In Korea, in the field of cosmeceutical cosmetics, not only existing cosmetics companies but also bio, pharmaceutical and medical device companies are expanding. Consumers are also increasingly interested in cosmetic products with a focus on treatment and functionality as well as beauty cosmetics pursuing beauty.

As such functional cosmetics, cosmetics with various effects such as whitening, moisturizing, UV protection and absorption, removal of harmful oxygen, collagen synthesis, skin wrinkle prevention, hair loss prevention, etc. are on the market, and interest in them is increasing.

Among them, there are known ingredients related to hair loss prevention. For example, biotin, dexpanthenol, L-menthol, zinc pyrithione, which are notified by the Ministry of Food and Drug Safety of Korea, are used as hair loss prevention ingredients, and in the United States, American food Finasteride and Minoxidil are approved by the Food and Drug Administration (FDA).

In addition, various other ingredients are known to be capable of preventing hair loss, but the effectiveness and safety verification for this have not been made.

Republic of Korea Patent Registration No. 10-0801164 (Jan. 29, 2008) Republic of Korea Patent Publication No. 10-2019-0046685 (2019.05.07)

The present invention has identified an excellent anti-hair loss effect against sulforaphane, which is known to have an antioxidant effect, and contains sulforaphane as an active ingredient, has no side effects on the skin, and has an excellent anti-hair loss effect, and a composition for preventing hair loss using the same Offer cosmetics.

Other detailed objects of the present invention will be clearly grasped and understood by experts or researchers in the technical field through the specific contents described below.

In order to solve the above problem, the present invention provides a composition for preventing hair loss and cosmetics for preventing hair loss, which include sulforaphane as an active ingredient, as an example.

Also provided is a pharmaceutical composition for preventing or treating hair loss comprising sulforaphane as an active ingredient.

At this time, the content of sulforaphane may be 1 μM to 25 μM with respect to the total amount of the composition or cosmetic.

Meanwhile, the composition for preventing hair loss and cosmetics for preventing hair loss may further include at least one component selected from the group consisting of biotin, dexpanthenol, and L-menthol as an active ingredient.

The composition for preventing hair loss and cosmetics for preventing hair loss according to an embodiment of the present invention have no side effects on the skin and have excellent hair loss prevention effect. In addition, since it is possible to reduce the separately added cosmetic for preventing hair loss , it can contribute to the reduction of manufacturing cost, and there is an effect that consumers can also use the product at an economical cost.

Other effects of the present invention will be clearly understood and understood by experts or researchers in the art through the specific details described below, or during the course of carrying out the present invention.

1 is a graph showing the results of testing the cytotoxicity according to the concentration for RAW 264.7 cells with respect to the hair loss prevention component notified by the Ministry of Food and Drug Safety.
2 is for Hepa1c1c7 cells. A graph showing the result of measuring the cytotoxicity according to the concentration of sulforaphane, which is the active ingredient of the cosmetic composition for preventing hair loss of the present invention, and comparing the result with the measurement value of the cytotoxicity of other hair loss prevention ingredients.
3 is a view showing the comparison of mRNA expression using RT-PCR of sulforaphane, an active ingredient of the cosmetic composition for preventing hair loss of the present invention, and other anti-hair loss ingredients, and protein expression level results using a Western blot experiment.
Figure 4 is a view showing the comparison of the hair condition of the test subjects before and 6 weeks after use in a clinical trial for human application using the cosmetic for preventing hair loss of the present invention.

The features and effects of the present invention described above will become more apparent through the following detailed description in relation to the accompanying drawings, and accordingly, those of ordinary skill in the art to which the present invention pertains can easily implement the technical idea of the present invention. will be able Since the present invention can have various changes and can have various forms, specific embodiments are illustrated in the drawings and described in detail in the text. However , this is not intended to limit the present invention to the specific disclosed form, it should be understood to include all modifications, equivalents and substitutes included in the spirit and scope of the present invention. The terms used in the present application are only used to describe specific embodiments, and are not intended to limit the present invention.

Hereinafter, a composition for preventing hair loss according to an embodiment of the present invention and a cosmetic for preventing hair loss using the same will be described in detail with reference to the drawings. In the present specification, the same and similar reference numerals are assigned to the same and similar components in different embodiments, and the description is replaced with the first description.

In general, androgenetic alopecia (AGA) is known as a common form of hair loss that occurs in men and women according to age. Androgenetic alopecia is related to dihydrotestosterone (DHT), which is released from testosterone by the enzymatic activity of 5α-reductase (5α-R). Dihydrotestosterone acts to atrophy the hair follicles of the scalp and induce vellus hair follicles, which eventually lead to hair loss.

Currently, inhibitors of 5α reductase that inhibit the conversion of testosterone to DHT are widely used for the treatment of androgenetic alopecia. On the other hand, from a different point of view, a method for preventing hair loss by interfering with the action of DHT can be considered, and AKR1C2 and DHRS9 are known as DHT degrading enzymes. When these enzymes are expressed, DHT binds to androgen receptor (AR) and prevents the formation of a hormone receptor complex, thereby promoting the alleviation of hair loss symptoms.

Sulforaphane is known as a component having an antioxidant effect. It has already been shown that sulforaphane can treat or prevent breast cancer by acting on cancer stem cells. In addition, antioxidants are known to have the effect of preventing skin aging and making the skin healthier by removing free radicals that have a negative effect on the skin.

However, research on whether sulforaphane, which exhibits an antioxidant effect, also has an anti-hair loss function, is incomplete. Accordingly, in the present invention, the potential of sulforaphane to include the hair loss prevention function, the degree of hair loss prevention function, human compatibility, and the appropriate amount for the hair loss prevention function are investigated, and by applying it to actual cosmetics, a composition for preventing hair loss using sulforaphane as an active ingredient and the same We present cosmetic products for preventing hair loss.

Preparation of reagents and cells

Sulforaphane, the subject of the present invention, and the announced anti-hair loss substances biotin, dexpanthenol, L-menthol, zinc pyrithione, and dimethyl sulfoxide (DMSO), an organic solvent, are manufactured by Sigma Aldrich, USA. Purchased from and prepared.

In addition, Hepa1c1c7 cells for checking the hair loss prevention function and RAW 264.7 cells for checking cytotoxicity were purchased from the Korea Cell Line Bank and prepared.

Meanwhile, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliμM bromide (MTT) for cytotoxicity was purchased from Biomax (KOREA) .

cell culture

Hepa1c1c7 cells to confirm the anti-hair loss function were cultured in α-MEM (alpha MinimμM Essential MediμM Eagle) solution containing 10% FBS (Fetal Bovine SerμM) and 1% Penicillin/Streptomycin (Penicillin/Streptomycin).

Meanwhile, RAW 264.7 cells for confirming cytotoxicity were cultured in DMEM (Dulbecco's Modified Eagle's MediμM) solution containing 10% FBS and 1% penicillin/streptomycin.

The above-described Hepa1c1c7 cells and RAW 264.7 cells were cultured in a 5% CO₂incubator maintained at 37°C.

Cytotoxicity test of sulforaphane and the notified substance for alleviating hair loss symptoms

Before evaluating the hair loss prevention effect of sulforaphane, MTT Assay (Methyl Thiazolyl diphenyl Tetrazoli μM Assay) was used to confirm the cytotoxicity of biotin, dexpanthenol, L-menthol, and zinc pyrithione, which are known substances to relieve hair loss symptoms. Regarding the cytotoxicity of sulforaphane, according to the contents of Patent Publication No. 10-2020-0041187, RAW264.7 cells were omitted and only Hepa1c1c7 cells were tested.

First, RAW264.7 and Hepa1c1c7 cells were aliquoted in a 96-hole well plate at a cell number of 1×10 per well, and samples of sulforaphane and a substance to relieve hair loss symptoms were collected by concentration (1, 2.5, 5, 10 and 25 μM). After addition, it was incubated in a CO₂ incubator at a temperature of 37° C. for 24 hours. After 24 hours, 1/10 of MTT solution was mixed in serum-free culture medium (serμM free media), 100ul each was dispensed, and incubated for 4 hours. Then, absorbance was measured at 450 nm with a microplate reader (Biomax, KOREA). The experiment was carried out by repeating three times under the same conditions.

As a result, for Raw264.7 cells, sulforaphane, biotin, dexpanthenol and L-menthol at the concentrations (1, 2.5, 5, 10 and 25 μM) applied to the experiment had no significant effect on the cell viability of 93% to 130%. However, it was confirmed that zinc pyrithione had a low cell viability as 70% to 94%. In conclusion, sulforaphane, biotin, dexpanthenol and L-menthol showed no significant difference in cell viability between the control group and the experimental group under all conditions, confirming that they were stable conditions for cytotoxicity. It was confirmed that it is an unstable condition for (see FIG. 1).

On the other hand, for Hepa1c17 cells, sulforaphane, biotin, dexpanthenol and L-menthol showed cell viability of 93% to 110% at the concentrations (1, 2.5, 5, 10 and 25 μM) applied to the experiment. On the other hand, in the case of zinc pyrithione, the cell viability was low, ranging from 94% to 70%. In conclusion, sulforaphane, biotin, dexpanthenol and L-menthol showed no significant difference in cell viability between the control group and the experimental group under all conditions, confirming that they were stable conditions for cytotoxicity. It was confirmed that the cells were toxic by appearing, and thus the experiment to identify the function of preventing hair loss was omitted (see FIG. 2 ).

As above, at a concentration of 1 to 25 μM, sulforaphane, biotin, dexpanthenol, and L-menthol do not show cytotoxicity and are expected to be safe. In particular, when the concentration of sulforaphane was 1 μM to 20 μM, it was confirmed that the cytotoxicity was very low and non-stimulatory.

Meanwhile, in order to uniformly dissolve the sample, 0.1% DMSO, an organic solvent that does not affect cytotoxicity, was used.

Sulforaphane hair loss inhibition experiment

In order to confirm the expression of the sulforaphane hair loss inhibitory gene, Hepa1c1c7 cells were treated according to the concentration of a mixture of sulforaphane, biotin, dexpanthenol and L-menthol, and then RT-PCR and Western blot were performed as follows.

At this time, sulforaphane alone was added to Hepa1c1c7 cells at final concentrations of 2.5, 5, 10, and 20 μM, and biotin, dexpanthenol, and L-menthol were made into a mixture, and final concentrations of 2.5, 5, 10, and 20 μM were added to Hepa1c1c7 cells. .

1) RT-PCR (Reverse Transcription-Polymerase Chain Reaction)

Total RNA of Hepa1c1c7 cells was isolated (RNeasy Mini kit, Qiagen, Germany). The isolated RNA was reverse transcribed using Superscript reverse transcriptase (Intron power cDNA synthesis kit, Intron Biotechnology, Korea) and oligo dT primer. RT-PCR was performed using recombinant Taq DNA polymerase according to the manufacturer's instructions (2xPCR master mix solution, Intron Biotechnology, Korea). GAPDH mRNA levels were used as controls. The primer sequences used are shown in Table 1 below.

PCR conditions were 30 cycles of 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds. PCR products were analyzed by electrophoresis on a 2% agarose gel stained with RedSafe staining solution (Intron Biotechnology, Korea).

Gene description Primers Sequences (5'-> 3') Akr1c2 F AATGGCCCTGAAACCAGGAG R GACCACAATCCCACGCTGTA Dhrs9 F GGAAACTTAGCAGCCCAGAAC R AACACGCCAAGAACACCAG GAPDH F ACCACAGTCCATGCCATCAC R CACCACCCTGTTGCTGTAGCC

2) Western blot

Cell extracts of Hepa1c1c7 cells were digested by SodiμM Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE), transferred to a polyvinylidene fluoride (PVDF) membrane, and DHRS9 polyclonal antibody (DHRS9). After immunoblotting with Rabbit Polyclonal, MyBioSource, MBS768606) and AKR1C2 polyclonal antibody (Invitrogen, PA5), an anti-beta Actin antibody (Anti-beta Actin antibody, Ab8227, Abcam, Elgland) was used and then a second HRP antibody (Goat) Anti-Rabbit IgG H&L, Ab6721, Abcam, Elgland). Reactive bands were detected by chemiluminescence using western lighting reagent (clarity ^TM western ECL substrate, Bio Rad).

3) Experiment result

First, the Ak1c21 and Dhrs9 genes were identified through PCR product (RNA level) and Western blot (protein level) results according to each concentration (2.5, 5, 10, 20 μM) in sulforaphane.

At this time, it was confirmed that as the concentration of sulforaphane increased, the gene level of Ak1c21 was increased both at the RNA level and at the protein level. However, in the case of Dhrs9, there was no significant difference in the RNA level according to the concentration, and in the protein level, it was confirmed that the protein level increased as the concentration increased (see FIG. 3a ).

In particular, when the concentration of sulforaphane was 10 μM to 20 μM, excellent expression of Ak1c21 and Dhrs9 genes was confirmed at both the RNA level and the protein level.

On the other hand, a mixture of biotin, dexpanthenol, and L-menthol, which is known as a material to relieve hair loss symptoms, was treated with the same concentration as sulforaphane (2.5, 5, 10, 20 μM) and checked. At this time, it was confirmed that, unlike sulforaphane, there was no significant difference in the gene levels of Ak1c21 and Dhrs9 at the RNA level and protein level even when the concentration was increased (Fig. 3b).

Accordingly, it was confirmed that sulforaphane increases the levels of AKR1C2 and DHRS9, which are enzymes that degrade DHT, and promotes the expression of these enzymes to prevent DHT from binding to androgen receptor (AR) to form a hormone receptor complex, thereby reducing hair loss symptoms. It can be expected that this can be facilitated to be alleviated.

Biotin, dexpanthenol, and L-menthol are thought to be involved in hair loss prevention through different actions, and when used together with sulforaphane, it is expected to produce synergistic effects through different actions.

Manufacture of gel cosmetics

Based on the above experiment, a gel-type cosmetic containing sulforaphane was prepared. The manufacturing process employs a process for manufacturing general gel-type cosmetics.

Ingredients of cosmetics include sulforaphane, purified water, ethanol, glycerin, PEG-60 hydrogenated castor oil, tromethamine, carbomer, trideceth-10, menthol, fragrance, salicylic acid, panthenol, butylene glycol Lycol, 1,2-hexanediol, caprylyl glycol, star anise extract, sodium hyaluronate, geraniol, linalool, citronellol, hexylcinnamal, and namonene were used.

In the above description, gel cosmetics were described as an example, but other cosmetic groups such as skin, lotion, foundation, essence, cream, pack, foam cleansing, etc. containing an appropriate amount of sulforaphane (1-25 μM, preferably 10-20 μM) It is expected to be applicable to

It is also expected that it will be possible to prepare a drug for preventing or treating hair loss by containing an appropriate amount of sulforaphane (1-25 μM, preferably 10-20 μM).

In order to verify the hair loss prevention effect of the gel cosmetic of the present invention, the hair loss prevention effect was verified for 23 men and women diagnosed with androgenetic alopecia aged 18 to 54 years.

All measurements and evaluations were carried out in a space where there is no movement of air or direct sunlight and constant temperature and humidity conditions (22±2℃, 50±5%) were maintained, with the subject taking skin stability. carried out.

Verification of the hair loss prevention effect of the gel cosmetic of the present invention

1) Visual evaluation of the crown and bangs

In this test, a high-resolution digital camera (DSLR, Cannon Inc., Japan) was used to take pictures of the crown (90 degrees) and the frontal region (45 degrees) under the same conditions, structure and location before and after 6 weeks of use of the test product. did.

The visual evaluation score of the crown increased from 0.000 to 0.609 before using the test product and after 6 weeks of using the test product. The visual evaluation score for the bangs is 0.000 to 0.087. The visual evaluation score was calculated by averaging the visual evaluation of each participant according to Table 2.

very bad worse slightly worse no change a little bit better get better very good -3 -2 -One 0 One 2 3

As a result, the visual evaluation score of the crown increased significantly after 6 weeks of use of the test product compared to before the use of the test product, and there was no significant change in the visual evaluation score of the frontal region (Table 3).

N=23 (No.01-23), (Mean±Standard deviation) point of view position, evaluation factor Parietal, visual assessment score bangs, visual evaluation score Before using the test product (D0) 0.00±0.00 0.00±0.00 After 6 weeks of use (D42) 0.61±0.50 0.09±0.29 Significance probability for 6 weeks compared to before use of test product ( p-values ) <0.001 -

2) Assess the total number of hairs

The Folliscope (Folliscope, LeadM, Republic of Korea) is an equipment that can evaluate hair loss and hair growth rate by magnifying the scalp or hair.

In this test, the poliscope was used before and after 6 weeks of use of the test product, after cutting hair at the hair loss area, a small 1mm diameter tattoo was applied to evaluate the phototrichogram, centering on the tattoo each time (FIG. 3).

As a result, the total number of hairs increased from 28.48 to 29.57 before and after 6 weeks of use of the test product. The change in the number of hairs showed a tendency to increase after using the product in the test product group, and increased statistically significantly after 6 weeks of use (Table 4).

N=23 (No.01-23), (Mean±Standard deviation) point of view position, evaluation factor Total number of hairs (N/cm²) Before using the test product (D0) 28.48±7.18 After 6 weeks of use (D42) 29.57±6.95 Significance probability of 6 weeks compared to before use of test product ( p-values ) 0.008

3) Statistical analysis

To verify the statistical significance before and after using the test product, statistical analysis was performed using Embedded on SPSS Statistics 26, and the significance was confirmed when the significance probability was p<0.05 at the 95% confidence interval.

The result values calculated through device evaluation were expressed by obtaining mean and standard deviation as continuous variables, and the results of questionnaire evaluation were expressed as categorical variables with frequency and percentage.

The normality of the data was verified by the Shapiro-wilk test, and in the case of repeated measurements with three or more measurement points, if normality was satisfied, the data was tested with the parametric method, fed measures ANOVA, Post-test was performed by applying the Bonferroni correction, and if normality was not satisfied, the test was performed with the non-parametric Friedman test, followed by the Wilcoxon signed sequence test by applying the Bonferroni correction. (Wilcoxon signed rank test) was post-test.

As described above, the composition for preventing hair loss including sulforaphane of the present invention and cosmetics for preventing hair loss including the same can obtain a hair loss prevention effect even in a small amount by adopting sulforaphane as an active ingredient, and it is advantageous in terms of manufacturing economy because it also includes an antioxidant effect. .

Although the detailed description of the present invention described above has been described with reference to a preferred embodiment of the present invention, those skilled in the art or those having ordinary knowledge in the art will have the spirit of the present invention described in the claims to be described later. And it will be understood that various modifications and variations of the present invention can be made without departing from the technical scope.

Claims (5)

A cosmetic composition for preventing hair loss comprising sulforaphane as an active ingredient. A pharmaceutical composition for preventing or treating hair loss comprising sulforaphane as an active ingredient. Cosmetics for preventing hair loss containing sulforaphane as an active ingredient. 4. The method of claim 3,
A cosmetic for preventing hair loss, characterized in that the content of sulforaphane is 1 μM to 25 μM with respect to the total amount of the cosmetic. 4. The method of claim 3,
A cosmetic for preventing hair loss further comprising at least one component selected from the group consisting of biotin, dexpanthenol, and L-menthol as an active ingredient.

Images