KR20220110444A - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Hedyotis diffusa Willdenow extract, or Forsythiae Fructus extract, or active component separated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle diseases or improving muscular functions containing a Hedyotis diffusa extract, a Forsythia koreana extract, or a component separated from the same as an active ingredient. The Hedyotis diffusa extract, the Forsythia koreana extract, digitolutein, or adoxosidic acid improves a function of mitochondria, promotes the differentiation of myoblast, relieves the atrophy of root canal cells, and promotes the formation of root canal cells, so that there is an effect of preventing or treating muscle disease or improving muscle function, which can be used as a material such as medicines and foods.

Description

A composition for preventing or treating or improving muscle function, comprising as an active ingredient an extract of baekyun grass, or yeonkyo extract, or a substance isolated therefrom; Fructus extract, or active component separated therefrom as an active ingredient}

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising, as an active ingredient, an extract of Baegun grass, yeonkyo extract, or a substance isolated therefrom.

Muscle is an important component of the human body and is a tissue expressed in stem cells of the mesoderm. Muscles are responsible for about 40% of our body, are supported by bones and tendons, and are made up of bundles of muscle fibers to move with each other and change the size of cells to cause contraction. Muscles are divided into skeletal muscles, cardiac muscles, and visceral muscles, which generate force at each position and induce movement, and also play a role in protecting body organs such as bones, joints, and internal organs. In addition, the muscle has the ability to regenerate, and when the muscle is damaged, it can be regenerated into a muscle having the original contractility and relaxation ability after being denatured by the satellite cells and the surrounding environment.

Muscle diseases are caused by congenital genetic or environmental causes, and diseases related to muscle loss are increasing with the recent aging society and the flow of life extension. Human muscle decreases by more than 1% every year after the age of 40, and 50% of the maximum muscle mass decreases at the age of 80, so muscle loss in old age is recognized as the most important cause of lowering overall physical function. These muscle diseases are on the increase worldwide compared to the past.

However, since the causes of muscle diseases are more diverse than other diseases, accurate diagnosis is not easy, symptoms and disease intensity vary depending on the type, and the exact mechanism is often unknown in the form of rare diseases. In addition, the symptoms of muscle disease progress rapidly, and as the disease progresses, patients with muscle disease suffer to the extent that it is difficult for them to live their daily lives alone. there is no situation.

On the other hand, "Baegun grass (Hedyotis diffusa Willdenow)" is a plant belonging to the family Apiaceae, and has been mainly used for leaf parts since ancient times, and is known as a plant with anticancer efficacy. "Forsythiae Fructus" refers to the dried fruit of Forsythiae viridissima Lindley or Forsythia suspense Vahl of the family Ash leca, and is known to be effective in peripheral neuropathy or immune diseases.

However, the prevention or treatment effect of muscle-related diseases or improvement of muscle function with respect to baekyun grass, Yeongyo, or digitolutein or adoxocidic acid isolated therefrom has not been previously known at all.

Under this background, the present inventors have made diligent efforts to develop a composition effective for the prevention or treatment of muscle-related diseases or improvement of muscle function from substances derived from natural materials, and as a result, as a result of intensive efforts to develop a composition effective for the prevention or treatment of muscle-related diseases or the extract of basilica or yeonkyo extract or an active substance isolated therefrom, digitolutein (digitolutein) or a doxosidic acid (adoxosidic acid) was completed by confirming that the effect.

Republic of Korea Patent Publication No. 10-2014-0024582

It is an object of the present invention to provide a composition for preventing or treating muscle disease or improving muscle function, comprising a baekun grass extract, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease, or for improving muscle function, comprising a baekun grass extract, yeonkyo extract, digitolutein, or a doxosidic acid as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for preventing or treating muscle disease, or for improving muscle function, comprising Baegun grass extract, Yeongyo extract, digitolutein, or a doxosidic acid as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or treating muscle disease, or for improving muscle function, comprising an extract of Baegun grass, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient.

Another object of the present invention is to provide a health functional food for the prevention or treatment of muscle disease or for improving muscle function, which contains baekun grass extract, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient.

Another object of the present invention is to provide a feed composition for preventing or treating muscle disease, or for improving muscle function, comprising an extract of basilica extract, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient.

Another object of the present invention is to obtain an extract from Baegun grass; Or to provide a method for preparing a composition for preventing or treating or improving muscle function, comprising the step of obtaining a yeonkyo extract from yeonkyo.

Another object of the present invention is to separate digitolutein from the extract of Baegun grass; Or to provide a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of isolating axosidic acid from the yeonkyo extract.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

In one aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising as an active ingredient a baekun grass extract, yeonkyo extract, digitolutein, or axosidic acid. .

In the present invention, the term "extract" refers to a liquid component obtained by immersing a desired substance, such as the Baegun grass or Yeongyo in various solvents, and then extracting it at room temperature or in a warm state for a certain period of time, and the solvent obtained by removing the solvent from the liquid component. It means the result of solid content, etc. In addition, it can be comprehensively interpreted as including all of the dilutions of the above results, their concentrates, their preparations, and their purified products.

In addition, the present invention may be an extract obtained from, for example, leaves, roots, stems, fruits, etc. without limitation on the part of Baegun grass or Yeongyo, and in one embodiment, it may be an extract of Baegun grass leaves or Yeongyo fruit.

The extract may be obtained by extraction with water or various organic solvents, and the like, but is not particularly limited thereto, and preferably may be extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. In addition, the method for obtaining the extract is also not particularly limited thereto, but preferably a cold extraction method in which a dried or processed product thereof is immersed in the solvent and extracted at room temperature of 10 to 25 ° C., by heating to 40 to 100 ° C. Methods such as a heating extraction method for extraction, an ultrasonic extraction method for extraction by adding ultrasonic waves, and a reflux extraction method using a reflux condenser can be used.

The extraction solvent is preferably added by 1 to 20 times the weight of the extraction solvent, and more preferably 10 times by weight. The extraction temperature is preferably 10 ~ 45 ℃, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, most preferably 3 days, but is not limited thereto. Drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.

In the present invention, the term "fraction" refers to a result obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. In the present invention, the fraction may be interpreted as a fraction obtained by applying the baegun grass or Yeongyo extract to various fractionation methods. The fractionation method is not particularly limited thereto, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing through an ultrafiltration membrane having a constant molecular weight cut-off value, or a chromatographic fractionation method. In addition, as the solvent used in the solvent fractionation method, a polar solvent or a non-polar solvent may be used without particular limitation.

In the present invention, 'digitolutein' may be represented by the following formula (1).

[Formula 1]

In the present invention, digitolutein is an organic compound having a chemical formula of C ₁₆ H ₁₂ O ₄ .

The digitolutein may be isolated from a site including leaves, stems, roots, etc. of Baiyun grass, and in one embodiment, may be isolated from Baiyun grass leaf extract. In addition, as long as the substance of digitolutein according to the present invention is the same, it is included in the scope of the present invention, without limitation to chemical synthesis known in the art, or obtaining from other sources, or manufacturing process. In addition, the digitolutein may be obtained by extraction with a single or mixed solvent of the basilica leaf extract, and any known solvent may be used.

Baegun grass extract according to the present invention may be an extract containing digitolutein.

In the present invention, 'adoxosidic acid' may be represented by the following formula (2).

[Formula 2]

The axosidic acid is an organic compound having a chemical formula of C ₁₆ H ₂₄ O ₁₀ .

Adoxosidic acid according to the present invention may be isolated from after obtaining the extract without limitation on the site of Yeongyo, for example, it may be isolated from Yeongyo fruit extract.

In addition, as long as the material of the atoxosidic acid according to the present invention is the same, it is included in the scope of the present invention without limitation of the chemical synthesis, or obtaining from other sources, or manufacturing process known in the art.

In addition, the axosidic acid may be obtained by extracting the fruit extract of Yeongyo fruit alone or with a mixed solvent, and any known solvent may be used.

Yeongyo extract according to the present invention may be an extract containing axosidic acid.

In the present invention, 'muscle' refers to tendons, muscles, and tendons inclusively. 'Muscle strength' refers to the ability to exert force by contraction of the muscle, and the strength is proportional to the muscle mass. 'Improvement of muscle strength' refers to the differentiation of myocytes into muscle cells to increase muscle mass, improve physical performance, improve maximum endurance, strengthen muscle recovery, reduce muscle fatigue, and improve energy balance. In addition, this strength is related to the 'mobility' or 'exercise performance' of the body. 'Exercise performance ability' refers to the ability to quickly, strongly, for a long time, and skillfully perform physical movements performed in daily life or sports. do. In addition, 'muscle weakness' refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to any one muscle, one side of the body, upper or lower extremities, or the like, or may appear throughout the body. In addition, subjective muscle weakness symptoms, including muscle fatigue and muscle pain, can be quantified objectively through physical examination.

In addition, as used herein, the term 'muscle disease' refers to a disease or condition reported in the art as a muscle disease caused by a decrease in muscle function, muscle wasting, or muscle degeneration. The muscle wasting or degeneration occurs due to genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles. Examples of related diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy and sarcopenia ( sarcopenia) and the like. The composition of the present invention has the effect of increasing muscle mass, and the type of muscle is not limited.

The composition of the present invention has, for example, prevention, improvement, and therapeutic efficacy of the above-mentioned diseases or conditions, such as sarcopenia, muscular atrophy, by promoting differentiation of myoblasts.

The composition of the present invention is not limited thereto, but can be implemented in the form of various compositions for external use, such as pharmaceutical compositions, food (including food additives) compositions, quasi-drugs compositions, feed (feed additive) compositions, cosmetic compositions, etc. have.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

Carriers for parenteral administration may also include water, suitable oils, saline, aqueous glucose and glycols, and the like. In addition, it may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention may be administered to mammals including humans by any method. For example, it can be administered orally or parenterally, and parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal. , intranasal, enteral, topical, sublingual or rectal administration.

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above. When formulated, one or more buffers (e.g., saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions or capsules, and such solid preparations include the pharmaceutical composition of the present invention and at least one excipient, such as For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol , cellulose, methyl cellulose, sodium carboxymethyl cellulose, and hydroxypropylmethyl-cellulose or gelatin may be mixed and prepared. For example, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, grinding it, adding suitable adjuvants, and processing it into a granular mixture.

In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, or syrups. In addition to water or liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances or preservatives may be included. have. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, and an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier and a preservative may be further included. .

For parenteral administration, the pharmaceutical composition of the present invention may be formulated according to methods known in the art in the form of injections, transdermal administrations and nasal inhalants together with suitable parenteral carriers. In the case of the injection, it must be sterilized and protected from contamination of microorganisms such as bacteria and fungi. For injection, examples of suitable carriers include, but are not limited to, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and/or a solvent or dispersion medium containing vegetable oil. can More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol and 5% dextrose. . In order to protect the injection from microbial contamination, it may further include various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In addition, in most cases, the injection may further contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointment, cream, lotion, gel, external solution, pasta, liniment, and air are included. Here, 'transdermal administration' means that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.

In the case of administration by inhalation, the compositions used according to the invention can be formulated in pressurized packs or with the use of a suitable propellant, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a recipe generally known to all pharmaceutical chemistry.

The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

As another aspect for achieving the above object, the present invention provides a quasi-drug composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Baekun grass, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient. .

The term "quasi-drug" as used in the present invention refers to articles that are not instruments, machines, or devices used for the purpose of diagnosing, treating, alleviating, treating or preventing diseases of humans or animals, and pharmacologically affecting the structure and function of humans or animals. It refers to articles other than instruments, machines, or devices among articles used for the purpose of influencing, and may include, but is not limited to, preparations for internal use in one embodiment, formulation methods, doses, and methods of use of quasi-drugs , components and the like may be appropriately selected from conventional techniques known in the art.

The quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent if necessary in addition to the above components. The pharmaceutically acceptable carrier, excipient or diluent is not limited as long as it does not impair the effects of the present invention, for example, a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, a lubricant, a sweetener, a fragrance, a preservative, etc. may include

As another aspect for achieving the above object, the present invention provides a food composition for preventing or treating muscle disease, or for improving muscle function, comprising an extract of Baekun grass, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient. .

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives and feed, and includes animals including humans or livestock. target for eating. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and their processed foods (canned fruit, bottled, jam, marmalade, etc.), fish, meat and their processed foods (ham, sausage corned beef, etc.) , Breads and noodles (udon, soba, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (butter, cheese, etc.), edible vegetable oils and fats, margarine, vegetable protein, retort food, frozen food , various seasonings (soybean paste, soy sauce, sauce, etc.) can be prepared by adding the active ingredient.

In addition, as a nutritional supplement, it can be prepared by adding the above active ingredients to capsules, tablets, pills, and the like. In addition, the health functional food is not limited thereto, but it can be ingested by liquefying, granulating, encapsulating, and powdering it so that it can be prepared in the form of tea, juice, and drink and consumed as a health drink, for example. In addition, in order to use the Baegun grass or Yeongyo in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it can be prepared in the form of a composition by mixing with a known active ingredient known to be effective in improving muscle strength.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, It may contain glycerin, alcohol or a carbonation agent and the like.

As another aspect for achieving the above object, the present invention provides a feed composition for preventing or treating muscle disease or improving muscle function, comprising an extract of basilica extract, yeonkyo extract, digitolutein, or axosidic acid as an active ingredient. .

In the present invention, the feed composition may be formulated in a conventional feed form, and may include known feed ingredients together. In addition, it can be used as a feed additive, which is added in the form of an additive to the feed used. The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act, and is a mineral preparation such as sodium bicarbonate (bicarbonate), bentonite, magnesium oxide, complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, kerotene, vitamin E, vitamins A, D, E, nicotinic acid, vitamins such as vitamin B complex, protective amino acids such as methionine and lyic acid, protective fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermented products, yeast agents, and the like may be further included.

The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry and fish.

As another aspect for achieving the above object, the present invention comprises the steps of obtaining an extract of Baegun grass; Or it provides a method for preparing a composition for preventing or treating or improving muscle function, comprising the step of obtaining a yeonkyo extract from yeonkyo.

As another aspect for achieving the above object, the present invention is a step of separating digitolutein from the extract of Baegun grass; Or it provides a method for preparing a composition for preventing muscle disease or improving muscle function, comprising the step of isolating axosidic acid from the yeonkyo extract.

Baegun grass, or yeonkyo extract of the present invention, or a material separated therefrom has an effect for preventing or treating muscle disease or improving muscle function, and thus can be used as a material for pharmaceuticals, food, and the like.

1 shows the structure (FIG. 1A) and separation schematic diagram (FIG. 1B) of digitolutein.
Figure 2 shows the structure (Figure 2A) and separation schematic diagram (Figure 2B) of a doxosidic acid (adoxosidic acid).
3 shows the results of nuclear magnetic resonance (NMR) measurement for confirming the structure of digitolutein (FIG. 3A: ¹ H NMR, FIG. 3B: ¹³ C NMR).
4 shows the results of nuclear magnetic resonance (NMR) measurement for confirming the structure of a doxosidic acid (FIG. 4A: ¹ H NMR, FIG. 4B: ¹³ C NMR).
5 shows an EGFP fluorescence image (FIG. 5A) and quantitative analysis results (FIG. 5B) confirming the effect on mitochondrial damage caused by muscle atrophy according to digitolutein treatment in a zebrafish model of anticancer drug-induced muscle atrophy.
6 is an EGFP fluorescence image (FIG. 6A) and quantitative analysis results (FIG. 6B) confirming the effect on mitochondrial damage caused by muscle atrophy according to a doxosidic acid treatment in a zebrafish model of anticancer drug-induced muscle atrophy.
7 shows the results of measuring the gene expression of MyoD (FIG. 7A) and myogenin (FIG. 7B) according to digitolutein treatment by RT-qPCR.
8 is a result of RT-qPCR measurement of the gene expression of MyoD ( FIG. 8A ) and myogenin ( FIG. 8B ) according to the treatment with a doxosidic acid.
9 shows the results of RT-qPCR measurement of gene expression of Myh1 (FIG. 9A), Myh2 (FIG. 9B), Myh4 (FIG. 9C), and Myh7 (FIG. 9D) according to digitolutein treatment.
10 is a result of RT-qPCR measurement of the gene expression of Myh1 (FIG. 10A), Myh2 (FIG. 10B), Myh4 (FIG. 10C), and Myh7 (FIG. 10D) according to the treatment with a doxosidic acid.
11 is a result of RT-qPCR measurement of gene expression of MuRF1 (FIG. 11A) and MAFbx (FIG. 11B) according to digitolutein treatment.
12 is a result of RT-qPCR measurement of gene expression of MuRF1 ( FIG. 12A ) and MAFbx ( FIG. 12B ) according to the treatment with a doxosidic acid.
13 shows the results of confirming the MHC-positive myotube cell image ( FIG. 13A ) and the multinuclear MHC-positive myotube cell distribution ( FIG. 13B ) according to digitolutein treatment by immunofluorescence staining.
14 is a result of confirming the MHC-positive myotube cell image ( FIG. 14A ) and the multinuclear MHC-positive myotube cell ratio ( FIG. 14B ) by immunofluorescence staining according to the treatment with a doxosidic acid.
15 shows the results of RT-qPCR measurement of gene expression of COX2 (FIG. 15A) and DRP1 (FIG. 15B) according to digitolutein treatment.
16 is a result of RT-qPCR measurement of gene expression of SDHA (FIG. 16A), COX1 (FIG. 16B), and COX2 (FIG. 16C) according to the treatment with a doxosidic acid.

Hereinafter, the present invention will be described in more detail through the following examples. However, these Examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited only to these Examples.

Example 1: Preparation of basilica extract and Digitolutein (Digitolutein)

130 kg of basilica leaves were cooled to reflux with 95% ethanol and extracted twice for 3 hours. 3 L of distilled water was added to the concentrated ethanol extract using a vacuum rotary vacuum concentrator and suspended. Solvent fractionation was performed using the same amount of methylene chloride, ethyl acetate and n-butanol using a separatory funnel. Column chromatography was performed on 111.6 g of the methylene chloride fraction. 111.6 g of the methylene chloride fraction was adsorbed on silica gel 70-230 mesh to solidify, and then loaded onto a column, and the developing solvent is hexane: ethyl acetate = 50: 1 to 1:1, methylene chloride: methanol = 20: A total of six fractions were obtained by proceeding at a ratio of increasing polarity using 1:1 to 1: 1 (hereinafter referred to as 'MC1 to MC5').

Silica gel 230-400 mesh filler was used with respect to 14.52 g of the obtained MC3, and a yellow crystalline material was obtained at 51.6 mg of MC3-2. As a result, the digitolutein was obtained (Fig. 1 and 3).

yellow amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 268.26 [M]+; Molecular formula C ₁₆ H ₁₂ O ₄ ; ¹ H-NMR (500 MHz, CDCl ₃ ) δ 8.28~8.23 (2H, m, H-5 and 8), 8.00 (1H, s, H-4), 7.79~7.72 (2H, m, H-6 and 7), 6.76 (1H, s, OH), 4.03 (3H, s, OCH3), 2.41 (3H, s, CH3); ¹³ C-NMR (250 MHz, CDCl ₃ ) δ 182.69 (C-9), 182.58 (C-10), 153.92 (C-3), 146.18 (C-4), 134.65 (C-10a), 133.90 (C -6), 133.80 (C-7), 133.13 (C-8a), 131.49 (C-2), 127.12 (C-5), 126.91 (C-8), 126.82 (C-1), 126.65 (C- 9a), 123.68 (C-4a), 62.30 (OCH3), 16.47 (CH3).

Example 2: Preparation of Yeongyo extract and Aodoxosidic acid

10 kg of Yeongyo fruit was immersed in 99.9% methanol at room temperature and extracted 3 times for 48 hours. 5 L of distilled water was added to the concentrated methanol extract using a vacuum rotary vacuum concentrator under reduced pressure and suspended. Solvent fractionation was performed using the same amount of ethyl acetate and n-butanol using a separatory funnel. Column chromatography was performed on 549 g of the ethyl acetate fraction. 549 g of the ethyl acetate fraction was adsorbed on silica gel 70-230 mesh to be solidified and then loaded onto a column, and the developing solvent was methylene chloride: methanol = 100: 0 to 0: 100 using a ratio of increasing polarity to obtain a total of 10 small fractions (hereinafter referred to as 'E1 ~ E10').

21.54 g of obtained E4 was recrystallized with methanol to obtain a white crystalline material, and as a result, the axosidic acid was obtained ( FIGS. 2 and 4 ).

white amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 376 [M]+; molecular formula

C ₁₆ H ₂₄ O ₁₀ ; ¹ H-NMR (500 MHz, CD ₃ OD) δ 7.42 (1H, s, H-3), 5.12 (1H, d, J = 6.5 Hz, H-1), 4.60 (1H, d, J = 7.8 Hz) , Glc-H-1), 3.13-3.85 (8H, m, Glc-H-2, 3, 4, 5, 6, H-10), 2.73 (1H, m, H-5), 2.10 (1H, m, H-8), 1.75-1.89 (3H, m, H-6a, 7a, 9), 1.19-1.40 (2H, m, H-6b, 7b); ¹³ C-NMR (250 MHz, CD ₃ OD) δ 170.1 (C-11), 152.5 (C-3), 111.1 (C-4), 99.4 (Glc-1), 97.5 (C-1), 77.2 ( Glc-3), 76.9 (Glc-5), 73.7 (Glc-2), 70.5 (Glc-4), 65.6 (C-10), 61.6 (Glc-6), 43.2 (C-8, 9), 35.4 (C-5), 32.4 (C-6), 27.6 (C-7).

Experimental Example 1: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in zebrafish model of anticancer drug-induced muscle atrophy of digitolutein

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossbreeding of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect of digitolutein due to muscular atrophy through the muscular atrophy zebrafish model, the embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) and muscle atrophy zebrafish. A fish model was made, and 0.01 ng/ml of digitolutein isolated from the leaf extract of Baegun grass in Example 1 was treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, in FOLFIRI-treated muscle cells of zebrafish embryos, the brightness of EGFP expressed in mitochondria was significantly decreased compared to that of the control group due to mitochondrial damage, but as digitolutein was treated at a concentration of 0.01 ng/ml, the expression level It was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated (FIG. 5). Therefore, it was confirmed through the above results that digitolutein can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 2: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in zebrafish model of anticancer drug-induced muscle atrophy of adoxocidic acid

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossbreeding of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect caused by muscle atrophy of adoxocidic acid through a zebrafish model of muscle atrophy, the embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to muscle atrophy. (muscle atrophy) A zebrafish model was prepared, and 0.1 ng/ml of a doxosidic acid isolated from Yeongyo fruit extract in Example 2 was treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing mitochondrial physiological activity through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria 24 hours after extract treatment It was observed through a microscope (Carl Zeiss, Germany).

As a result, the brightness of EGFP expressed in mitochondria was significantly decreased compared to the control group due to mitochondrial damage in the muscle cells of FOLFIRI-treated zebrafish embryos. As the amount increased, it was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated (FIG. 6). Therefore, through these results, it was confirmed that adoxocidic acid can inhibit the occurrence of muscle atrophy by restoring the mitochondrial damage of muscle cells caused by the anticancer drug (FOLFIRI) treatment.

Experimental Example 3: Confirmation of the effect of digitolutein to induce myoblast differentiation, alleviate myotube cell atrophy and promote myotube cell formation

Based on the results of Experimental Example 1, the following cell experiments were performed using C2C12 myoblasts to determine the effect of digitolutein on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with digitolutein in DM at a concentration of 0.01 and 0.1 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

3-1: Effect of digitolutein in promoting myoblast differentiation

To confirm the effect of digitolutein on myoblast differentiation, first, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are indicators of myogenesis related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, digitolutein was treated and cultured in C2C12 in the same manner as described above to induce differentiation, and then, Trizol solution was added to lyse the cells and centrifuged. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene description Primers Sequences (5' →3') SEQ ID NO: COX2 F ATGGCCTACCCATTCCAACT One R CGGGGTTGTTGATTTCGTC 2 DRP1 F TCTGCAGCTAGTCCACGTTTC 3 R ACCCCATTCTTCTTGCTTCAA 4 GAPDH F CGTGCCGCCTGGAGAAAC 5 R TGGGAGTTGCTGTTGAAGTCG 6 MAFbx F AGTGAGGACCGGCTACTGTG 7 R GATCAAACGCTTGCGAATCT 8 Myh1 F GAGGGACAGTTCATCGATAGCAA 9 R GGGCCAACTTGTCATCTCTCAT 10 Myh2 F CCGCAATGCAGAAGAGAAA 11 R TTCACGGTCTGCTCCATGT 12 Myh4 F CAGGACTTGGTGGACAAACTACA 13 R TTTAGTGTGAACCTCTCGGCTC 14 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 15 R GGAGCGCAAGTTTGTCATAAGT 16 MuRF1 F TGACATCTACAAGCAGGAGTGC 17 R TCGTCTTCGTGTTCCTTGC 18 MyoD F AAACCCCAATGCGATTTATCAGG 19 R TAAGCTTCATCTTTTGGGCGTGA 20 Myogenin F ACAGCATCACGGTGGAGGATATGT 21 R CCCTGCTACAGAAGTGATGGCTTT 22

As a result, the expression levels of MyoD, an early stage indicator of myoblast differentiation, and myogenin, an intermediate stage indicator, gradually increased as digitolutein was treated at concentrations of 0.01 and 0.1 ng/ml compared to the control, and the MyoD gene expression level was 0.1 ng/ml treated It was significantly higher in the group, and the expression level of myogenin was significantly increased at all concentrations (FIG. 7).

As a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and related to muscle contraction speed and function, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) were found in the digitolutein-treated group in the control group. Contrast concentration-dependently increased significantly (FIG. 9). The above results show that digitolutein has a differentiation-promoting effect of C2C12 myoblasts.

3-2: Effect of digitolutein for alleviating myotube cell atrophy

Next, in order to confirm the effect of digitolutein on myotube atrophy, the mRNA expression of MuRF1 and MAFbx, which are involved in muscle-specific degradation as representative muscle atrophy indicators, was measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, the expression level of MuRF1 was significantly decreased compared to the control group at all concentrations treated with digitolutein, and the expression level of MAFbx was significantly decreased compared to the control group in the group treated with digitolutein at a concentration of 0.01 ng/ml. It was confirmed that (Fig. 11). The above results show that digitolutein has an effect of alleviating atrophy of myotube cells.

3-3: digitolutein promotes myotube cell formation

To determine the degree of MHC-positive myotube cell formation by digitolutein through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeated with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 13A and 13B, respectively. It was confirmed that MHC-positive myotube cell formation was promoted by digitolutein treatment compared to the control (FIG. 13A). In addition, in the experimental group treated with digitolutein at 0.01 and 0.1 ng/ml, mononuclear MHC-positive myotubes showed a tendency to decrease compared to the control group, while the formation of multinucleated MHC-positive myotubes increased. In particular, the number of MHC-positive myotube cells having 6 or more nuclei significantly increased compared to the control group at all concentrations treated with digitolutein ( FIG. 13B ). Through the above results, it was demonstrated that digitolutein promotes the differentiation of C2C12 myoblast cells and alleviates myotube cell atrophy, thereby promoting the formation of multinucleated myotubes.

3-4: Confirmation of regulation of gene expression related to mitochondrial function of digitolutein

In order to check whether the effects of digitolutein on myoblast differentiation and myotubular cell atrophy and formation are related to mitochondrial function, COX2 and mitochondrial division, which constitute the electron transport complex IV present in the inner mitochondrial membrane of myoblasts The gene expression level of DRP1 regulating (mitochondrial fission) was measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, in all groups treated with digitolutein, the expression level of COX2 was significantly increased compared to the control group, whereas the expression of the DRP1 gene involved in mitochondrial division was significantly decreased ( FIG. 15 ). These results show that digitolutein treatment promotes myoblast differentiation, alleviates myotube cell atrophy, and promotes multinucleated myotube cell formation is related to mitochondrial function improvement through mitochondrial energy metabolism activation and mitochondrial damage relief.

Experimental Example 4: Confirmation of the effect of myoblast differentiation induction of a doxosidic acid, alleviation of myotube cell atrophy and promotion of myotube cell formation

Based on the results of Experimental Example 2, the following cell experiments were performed using C2C12 myoblasts to confirm the effect of atoxoid acid on myoblast differentiation and myotube formation. . C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with axosidic acid in DM at concentrations of 0.1, 1, and 10 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

4-1: Myoblast differentiation promoting effect of adoxocidic acid

In order to confirm the effect of a doxosidic acid on myoblast differentiation, first, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are myogenic markers related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, in the same manner as described above, C2C12 was treated with a doxosidic acid and cultured to induce differentiation, followed by lysis by addition of Trizol solution and centrifugation. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene description Primers Sequences (5' →3') SEQ ID NO: COX1 F TGGAGGCTTTGGAAACTGAC 23 R TTCATCCTGTTCCCTGCTCCT 24 COX2 F ATGGCCTACCCATTCCAACT 25 R CGGGGTTGTTGATTTCGTC 26 GAPDH F CGTGCCGCCTGGAGAAAC 27 R TGGGAGTTGCTGTTGAAGTCG 28 MAFbx F AGTGAGGACCGGCTACTGTG 29 R GATCAAACGCTTGCGAATCT 30 Myh1 F GAGGGACAGTTCATCGATAGCAA 31 R GGGCCAACTTGTCATCTCTCAT 32 Myh2 F CCGCAATGCAGAAGAGAAA 33 R TTCACGGTCTGCTCCATGT 34 Myh4 F CAGGACTTGGTGGACAAACTACA 35 R TTTAGTGTGAACCTCTCGGCTC 36 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 37 R GGAGCGCAAGTTTGTCATAAGT 38 MuRF1 F TGACATCTACAAGCAGGAGTGC 39 R TCGTCTTCGTGTTCCTTGC 40 MyoD F AAACCCCAATGCGATTTATCAGG 41 R TAAGCTTCATCTTTTGGGCGTGA 42 Myogenin F ACAGCATCACGGTGGAGGATATGT 43 R CCCTGCTACAGAAGTGATGGCTTT 44 SDHA F CAGAAGTCGATGCAGAACCA 45 R CGACCCGCACTTTGTAATCT 46

As a result, the expression levels of MyoD, an early stage indicator of myoblast differentiation, and myogenin, an early stage indicator, gradually increased as compared to the control group by treatment with a doxosidic acid at concentrations of 0.1, 1, and 10 ng/ml, so that the MyoD gene expression level was 1, It was significantly higher in the 10 ng/ml treatment group, and the expression level of myogenin at all concentrations increased significantly compared to the control group (FIG. 8).

As a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and related to the speed and function of muscle contraction, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) compared to the control group. It increased in a concentration-dependent manner in the group. In particular, the expression level of Myh1 was significantly increased in the treatment group at all concentrations, and it was confirmed that Myh2 and Myh4 were significantly increased in the group treated with 1, 10 ng/ml of adoxosidic acid compared to the control group (FIG. 10A, FIG. 10A, FIG. 10B, FIG. 10C). Myh7 gene expression level was significantly increased in the group treated with a doxosidic acid at a concentration of 10 ng/ml compared to the control group ( FIG. 10D ). The above results show that a doxosidic acid has a differentiation-promoting effect of C2C12 myoblasts.

4-2: Relief effect of atrophy of myotube cells of adoxocidic acid

Next, in order to confirm the effect of a doxosidic acid on myotube atrophy, the mRNA expression of MuRF1 and MAFbx, which are involved in muscle-specific degradation as representative muscle atrophy indicators, was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, in the case of MuRF1, the expression level of the corresponding gene was significantly decreased in the group treated with a doxosidic acid at concentrations of 1 and 10 ng/ml compared to the control group, and the expression of the gene was significantly decreased in the group treated with MAFbx at 0.1 and 1 ng/ml compared to the control group. It was confirmed that this significantly decreased (FIG. 12). The above results show that adroxic acid has an effect of alleviating the atrophy of myotube cells.

4-3: Adoxocidic acid promotes myotube cell formation

The degree of MHC-positive myotube cell formation by a doxosidic acid was confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeated with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed in red fluorescence and the ratio of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIG. 14 . It was confirmed that the formation of MHC-positive myotubes was promoted compared to the control group by treatment with axosidic acid ( FIG. 14A ). In addition, the formation of multinucleated MHC-positive myotube cells increased in the experimental group treated with 0.1, 1, and 10 ng/ml of axosidic acid. All concentrations treated with acid increased compared to the control group (FIG. 14B). Through the above results, it was demonstrated that adoxocidic acid promotes the differentiation of C2C12 myoblast cells and relieves myotube cell atrophy, thereby promoting the formation of multinucleated myotubes.

4-4: Confirmation of regulation of gene expression related to mitochondrial function of a doxosidic acid

SDHA and electrons, which constitute the electron transport system complex II present in the inner mitochondrial membrane of myoblasts, to confirm whether the effects of atoxoid acid on myoblast differentiation and myotube cell atrophy and formation are related to the function of mitochondria. The mRNA expression of COX1 and COX2 constituting delivery system IV was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, SDHA expression gradually increased as the atoxoid acid was treated at concentrations of 0.1, 1, and 10 ng/ml, and the expression level was significantly increased in the 10 ng/ml treatment group compared to the control group, and COX1 and COX2 were It was confirmed that the gene expression level was significantly increased in all groups treated with sidic acid (FIG. 16). These results show that the effect of promoting myoblast differentiation, alleviating myotube cell atrophy, and promoting the formation of multinucleated myotubes according to the treatment with a doxosidic acid is related to the improvement of mitochondrial function through the activation of mitochondrial energy metabolism.

The experimental examples described in this specification and the accompanying drawings show the effect of the active substance of digitolutein or a doxosidic acid, and it is common in the art to which the present invention pertains to produce the effect of an extract obtained by isolating the active substance. It is self-evident to those with knowledge.

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> Sookmyung Women's university industry-academic cooperation foundation National Institute for Korean Medicine Development <120> Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Hedyotis diffusa Willdenow extract, or Forsythiae Fructus extract, or active component separated therefrom as an active ingredient <130> KPA2022-006 <150> KR 10-2021-0013317 <151> 2021-01-29 <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 1 atggcctacc cattccaact 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 2 cggggttgtt gatttcgtc 19 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 3 tctgcagcta gtccacgttt c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 4 accccattct tctgcttcaa 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 5 cgtgccgcct ggagaaac 18 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 6 tgggagttgc tgttgaagtc g 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 7 agtgaggacc ggctactgtg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 8 gatcaaacgc ttgcgaatct 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 9 gagggacagt tcatcgatag caa 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 10 gggccaactt gtcatctctc at 22 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 11 ccgcaatgca gaagagaaa 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 12 ttcacggtct gctccatgt 19 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 13 caggacttgg tggacaaact aca 23 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 14 tttagtgtga acctctcggc tc 22 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 15 ctcaagctgc tcagcaatct attt 24 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 16 ggagcgcaag tttgtcataa gt 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 17 tgacatctac aagcaggagt gc 22 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 18 tcgtcttcgt gttccttgc 19 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 19 aaaccccaat gcgatttatc agg 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 20 taagcttcat cttttgggcg tga 23 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 21 acagcatcac ggtggaggat atgt 24 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 22 ccctgctaca gaagtgatgg cttt 24 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 23 tggaggcttt ggaaactgac 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 24 ttcatcctgt tcctgctcct 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 25 atggcctacc cattccaact 20 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 26 cggggttgtt gatttcgtc 19 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 27 cgtgccgcct ggagaaac 18 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 28 tgggagttgc tgttgaagtc g 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 29 agtgaggacc ggctactgtg 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 30 gatcaaacgc ttgcgaatct 20 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 31 gagggacagt tcatcgatag caa 23 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 32 gggccaactt gtcatctctc at 22 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 33 ccgcaatgca gaagagaaa 19 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 34 ttcacggtct gctccatgt 19 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 35 caggacttgg tggacaaact aca 23 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 36 tttagtgtga acctctcggc tc 22 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 37 ctcaagctgc tcagcaatct attt 24 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 38 ggagcgcaag tttgtcataa gt 22 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 39 tgacatctac aagcaggagt gc 22 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 40 tcgtcttcgt gttccttgc 19 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 41 aaaccccaat gcgatttatc agg 23 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 42 taagcttcat cttttgggcg tga 23 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 43 acagcatcac ggtggaggat atgt 24 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 44 ccctgctaca gaagtgatgg cttt 24 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 45 cagaagtcga tgcagaacca 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 46 cgacccgcac tttgtaatct 20

Claims (14)

A pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising Baegun grass extract, Yeongyo extract, digitolutein, or axosidic acid as an active ingredient. A quasi-drug composition for preventing or treating muscle disease, or for improving muscle function, comprising Baegun grass extract, Yeongyo extract, digitolutein, or axosidic acid as an active ingredient. A food composition for preventing or treating muscle disease, or for improving muscle function, comprising Baegun grass extract, Yeongyo extract, digitolutein, or a doxosidic acid as an active ingredient. A feed composition for preventing or treating muscle disease, or for improving muscle function, comprising Baegun grass extract, Yeongyo extract, digitolutein, or a doxosidic acid as an active ingredient. 5. The method according to any one of claims 1 to 4,
The composition, wherein the Baekun grass extract or Yeongyo extract is extracted with water, an organic solvent having 1 to 4 carbon atoms, or a mixed solvent thereof. 6. The method of claim 5,
The composition, wherein the Baegun grass extract or Yeongyo extract is extracted by at least one method selected from the group consisting of cold chilling, heating, ultrasonication and reflux extraction. 5. The method according to any one of claims 1 to 4,
The muscle disease is a muscle disease induced by a decrease in muscle function, muscle wasting or muscle degeneration, the composition. 5. The method according to any one of claims 1 to 4,
The muscle disease is muscle loss, muscle loss, dystonia (atony), muscular atrophy (muscular atrophy), muscular dystrophy (muscular dystrophy), muscle degeneration, myasthenia gravis, cachexia (cachexia), cardiac atrophy (cardiotrophy) and sarcopenia (sarcopenia) At least one selected from the group consisting of, the composition. 5. The method according to any one of claims 1 to 4,
The Baegun grass extract, Yeongyo extract, digitolutein, or doxosidic acid is to have mitochondrial damage alleviation, myoblast differentiation induction, myotube cell atrophy alleviation or myotube cell formation promoting activity. 5. The method according to any one of claims 1 to 4,
The basilica extract or digitolutein increases the expression of one or more selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, MuRF1, MAFbx, COX2 and DRP1, the composition. 5. The method according to any one of claims 1 to 4,
The yeonkyo extract or axosidic acid is MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, MuRF1, MAFbx, SDHA, COX1 and a composition that increases the expression of one or more selected from the group consisting of COX2. A health functional food for preventing or treating muscle disease or improving muscle function, comprising the food composition according to any one of claims 3 and 5 to 11. obtaining a Baiyun grass extract from Baiyun grass; Or a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of obtaining a yeonkyo extract from yeonkyo. Separating digitolutein from the basilica extract; Or a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of isolating axosidic acid from the yeonkyo extract.

Images