KR20220098094A - a composition comprising Alphitolic acid compound isolated from an extract of Agrimonia corana NAKAI as an active ingredient for preventing or treating immune-involved disease - Google Patents

Abstract

The present invention relates to a composition for preventing or treating immune-related diseases comprising an alphytolic acid compound isolated from an extract of Agrimonia coreana, a native plant native to Korea, as an active ingredient. By confirming the strong CD4+ T cell proliferation inhibitory ability and ORAI1 current inhibitory ability through an anti-immune activity evaluation experiment using T cells isolated from human blood compounds (experimental example 1), and experimental evaluation of inhibitory activity of ORAI1 ion channel regulating intracellular calcium signal (experimental example 2), the compound of the present invention is useful for preventing or treating immune-related diseases.

Description

A composition comprising Alphitolic acid compound isolated from an extract of Agrimonia corana NAKAI as an active ingredient for preventing or treating immune-involved disease }

The present invention relates to a composition for the prevention or treatment of immune-related diseases comprising, as an active ingredient, an alpitolic acid compound isolated from a purified fraction of wild alpaca root, a native plant native to Korea, containing a large amount of active ingredient.

[Document 1] Immunology. 49, 1992; Dig dis Sci. 52, pp 1890-1896, 2007; J Life Sci. 19, pp 479-485, 2009; Biol Pharm Bull. 27, pp 617-620, 2004

[Document 2] J Allergy clin immunol. 9, pp 616, 1993; Immunology. 47, pp 75, 1982

[Document 3] A-Reum Yu, Ho-Young Park, Yun-Sook Kim, Sang-Keun Ha, Hee-Do Hong, Hee-Don Choi. 2012. Immuno-enhancing Effect of Seed Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(12): 1671-1676

[Document 4] Uthaisangsook S, Day NK, Bahna SL, Good RA, Haraguchi S. 2002. Innate immunity and its role against infections. Ann. Allergy Asthma Immunol. 88: 253-264

[Document 5] Birk RW, Gratchev A, Hakiy N, Politz O, Schledzewski K, Guillot P, Orfanos CE, Goerdt S. 2001. Alternative activation of antigen-presenting cells: concepts and clinical relevance. Hautarzt 52: 193-200

[Document 6] Seon A Yoo, Ok Kyung Kim, Da-Eun Nam, Yongjae Kim, Humyoung Baek, Woojin Jun, Jeongmin Lee. 2014. Immunomodulatory Effects of Fermented Curcuma longa L. Extracts on RAW 264.7 Cells. J Korean Soc Food Sci Nutr 43(2): 216-243)

[Document 7] A-Reum Yu, Ho-Young Park, In-Wook Choi, Yong-Kon Park, Hee-Do Hong, Hee-Don Choi. 2012. Immune Enhancing Effect of Medicinal Herb Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(11): 1521-1527

[Document 8] .Myung-Woo Byun. 2013. Immunomodulatory Activities of Apple Seed Extracts on Macrophage. J Korean Soc Food Sci Nutr 42(9): 1513-1517

[Document 9] Seon A Yoo, Ok Kyung Kim, Da-Eun Nam, Yongjae Kim, Humyoung Baek, Woojin Jun, Jeongmin Lee. 2014. Immunomodulatory Effects of Fermented Curcuma longa L. Extracts on RAW 264.7 Cells. J Korean Soc Food Sci Nutr 43(2): 216-243

[Document 10] Yi Seul Seo and Kwang-Soon Shin. 2012. Immune System-Stimulating Activities of Mucilage Polysaccharides Isolated from Opuntia humifusa. J Korean Soc Food Sci Nutr 41(1): 95-102

[Document 11]. A-Reum Yu, Ho-Young Park, In-Wook Choi, Yong-Kon Park, Hee-Do Hong, Hee-Don Choi. 2012. Immune Enhancing Effect of Medicinal Herb Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(11): 1521-1527

[Document 12] Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann N Y Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x

[Document 13] Stefan Feske, Yousang Gwack, Murali Prakriya, Sonal Srikanth, Sven-Holger Puppel, Bogdan Tanasa, Patrick G Hogan, Richard S Lewis, Mark Daly, Anjana Rao A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006 May 11; 441 (7090): 179-85. doi: 10.1038/nature04702.

[Document 14] Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann N Y Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x,

ther, Alexander Papolos, Jeffery Kutok, Claire Hivroz, Francoise LeDeist, Katrin Plogmann, Stephan Ehl, Gundula Notheis, Michael H. Albert, Bernd H. Belohradsky, Janbernd Kirschner, Anjana Rao, Alain Fisched,Stefan Feske ORAI1 deficiency and lack of store-operated Ca2+ entry cause immunodeficiency, myopathy and ectodermal dysplasia J Allergy Clin Immunol. 2009 Dec; 124(6): 1311-1318.e7. doi: 10.1016/j.jaci.2009.10.007][Document 15] Christie-Ann McCarl, Capucine Picard, Sara Khalil, Takumi Kawasaki, Jens R

ther, Alexander Papolos, Jeffery Kutok, Claire Hivroz, Francoise LeDeist, Katrin Plogmann, Stephan Ehl, Gundula Notheis, Michael H. Albert, Bernd H. Belohradsky, Janbernd Kirschner, Anjana Rao, Alain Fisched, Stefan Feske ORAI1 deficiency and lack of store -operated Ca2+ entry cause immunodeficiency, myopathy and ectodermal dysplasia J Allergy Clin Immunol. 2009 Dec; 124(6): 1311-1318.e7. doi: 10.1016/j.jaci.2009.10.007]

[Document 16] Life Resources Information Service, Korean Native Crops Encyclopedia, https://www.bris.go.kr

[Document 17] Information Recruitment, Dohaehyang Pharmacy Dictionary, Youngrimsa, pp636-637, 1998

[Document 18] Korean Patent Publication No. 10-2010-0128770

[Document 19] Korean Patent Publication No. 10-2012-0126416

[Document 20] Korean Patent Publication No. 10-2012-0003317

[Document 21] Registered Patent No. 10-1554030

[Document 22] Korean Patent Application Laid-Open No. 2001-0053978

[Document 23] Kim JJ, Jiang J, Shim DW, Kwon SC, Kim TJ, Ye SK, Kim MK, Shin YK, Koppula S, Kang TB, Choi DK, Lee KH. (2012) Anti-inflammatory and anti-allergic effects of Agrimonia pilosa Ledeb extract on murine cell lines and OVA-induced airway inflammation. J. Ethnopharmacol. 140(2):213-221

[Document 24] Apigenin [Aziz N, Kim MY, Cho JY. (2018) Anti-inflammatory effects of luteolin: A review of in vitro, in vivo, and in silico studies. J Ethnopharmacol. 28; 225:342-358.

[Document 25] Kaempferol [Pang L, Zou S, Shi Y, Mao Q, Chen Y. (2019) Apigenin attenuates PM2.5-induced airway hyperresponsiveness and inflammation by down-regulating NF-κB in murine model of asthma Int J Clin Exp Pathol. 12(10):3700-3709]

[Document 26] Alam W, Khan H, Shah MA, Cauli O, Saso L. (2020) Kaempferol as a Dietary Anti-Inflammatory Agent: Current Therapeutic Standing. Molecules 7:25(18):E4073

[Document 27] Guiling Chen, Yang Ye, Ming Cheng, Yi Tao, Kejun Zhang, Qiong Huang, Jingwen Deng, Danni Yao, Chuanjian Lu1 and Yu Huang. “ Quercetin Combined With Human Umbilical Cord Mesenchymal Stem Cells Regulated Tumor Necrosis Factor-a/Interferon-g-Stimulated Peripheral Blood Mononuclear Cells via Activation of Toll-Like Receptor 3 Signaling. Front Pharmacol. 2020; 11: 499.

[Document 28] Young-Chang Cho, Jiyoung Park, Sayeon Cho (2020) Anti-Inflammatory and Anti-Oxidative Effects of luteolin-7-O-glucuronide in LPS-Stimulated Murine Macrophages through TAK1 Inhibition and Nrf2 Activation. Int J Mol Sci. 16;21(6):2007

[Document 29] [Weicheng Hu, Xinfeng Wang, Lei Wu, Ting Shen, Lilian Ji, Xihong Zhao, Chuan-Ling Si, Yunyao Jiang, Gongcheng Wang (2016) Apigenin-7-O-β-D-glucuronide inhibits LPS- induced inflammation through the inactivation of AP-1 and MAPK signaling pathways in RAW 264.7 macrophages and protects mice against endotoxin shock. Food Funct. 7(2):1002-13.

[Document 30] cetyl trimethylammonium bromide method, Adam Healey, Agnelo Furtado, Tal Cooper & Robert J Henry. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 2014, 10:21

[Document 31] JD Thompson, DG Higgins, TJ Gibson. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994 Nov 11;22(22):4673-80

[Document 32] Tsukasa Iwashina and Hiroaki Setoguchi et al. Flavonoids from the Leaves of Vitex rotundifolia (Verbenaceae), and their Qualitative and Quantitative Comparison between Coastal and Inland Populations. Bull. Natl. Mus. Nat. Sci., Ser. B, 37(2), pp. 87-94

[Document 33] Ufuk Ozgen et al. A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599

[Document 34] Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.

o D

L

ng). J Tradit Complement Med. 2013 Jan-Mar; 3(1): 33-40; [Document 35] Hui-Ling Cheng and Li-Jie et al. Antiinflammatory and Antioxidant Flavonoids and Phenols from Cardiospermum halicacabum (倒地鈴 D

o D

L

ng). J Tradit Complement Med. 2013 Jan-Mar; 3(1): 33-40;

[Document 36] Ufuk Ozgen et al. A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599;

[Document 37] Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.

[Document 38] Bae, Bae, et al. Separation and quantification of veturic acid and alpitolic acid from jujube. Journal of Pharmaceutical Sciences, Vol. 40, No. 4 558~562 (1996);

[Document 39] Sang-Myung Lee et al. Anti-complementary Activity of Triterpenoides from Fruits of Zizyphus jujuba. Biol. Pharm. Bull. 27(11) 1883-1886 (2004)

[Document 40] Somin Park et al. Expedient Synthesis of Alphitolic Acid and Its Naturally Occurring 2-O-Ester Derivatives. J. Nat. Prod. 2019, 82, 895-902

[Document 41] J Immunol July 15, 2002, 169 (2) 802-808

[Document 42] BIOPRESERVATION AND BIOBANKING, Volume 14, Number 5, 2016

[Document 43] The American Journal of Chinese Medicine, Vol. 47, No. 7, 1-15

The present invention relates to a composition for the prevention or treatment of immune-related diseases comprising, as an active ingredient, an alpitolic acid compound isolated from a purified fraction of wild gypsum, a native plant native to Korea containing a large amount of active ingredient.

The human body has the characteristic of trying to maintain homeostasis, which also works in the immune system. "Immunity" refers to a series of biological defense reactions that occur in order to exclude substances other than self-components that break homeostasis or threaten self. It can be said to be a homeostasis maintenance activity through the action of phagocytosis to remove external irritants as a defense system that protects All immune actions, including the inflammatory response, which were activated due to the influx of pathogens into the body, return to a normal state after the pathogen is removed. do. A state in which the immune function is deficient or lowered is called "immune failure". Conversely, "immune hypersensitivity reaction" refers to an overreaction of some immune responses, resulting in an imbalance of the immune system, resulting in an allergic reaction (Immunology. 49, 1992; Dig dis Sci. 52, pp 1890-1896, 2007; J Life Sci. 19, pp 479-485, 2009; Biol Pharm Bull. 27, pp 617-620, 2004).

When the immune system is not properly regulated and becomes imbalanced, immune regulation is impaired due to causes such as imbalance of cytokines in the body, proliferation of T/B cells, and depletion of antioxidant nutrients, and secretion of inflammatory substances increases, causing damage to cells and tissues. Inflammation can be aggravated because it cannot cope with the influx of pathogens. Therefore, the immune response of the human body must be balanced and controlled to maintain health, so the ability to regulate immunity is important for disease prevention and treatment (J Allergy clin immunol. 9, pp 616, 1993; Immunology. 47, pp 75, 1982) ).

In the spleen, it is involved in immune regulation and secretes cytokines such as interferon (IFN)-γ, tumor necrosis factor (TNF)-α and interleukin (IL)-1β, IL-5, IL-6, and PGE2. These cytokines act in the execution stage of the immune response, and play an important role in the signal transduction process between immune cells and the inflammatory system.

Since 2000, acute new infectious diseases such as acute respiratory syndrome SARS, avian flu, and Ebola virus have emerged around the world, and the importance of immunity, which is the body's defense ability against these infectious diseases, is further emerging. Immunity, which is the body's defense against threats such as disruption of body homeostasis or invasion of pathogens, consists of non-specific immunity involving macrophages and natural killer (NK) cells and specific immunity involving T cells or B cells. (1. A-Reum Yu, Ho-Young Park, Yun-Sook Kim, Sang-Keun Ha, Hee-Do Hong, Hee-Don Choi. 2012. Immuno-enhancing Effect of Seed Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(12): 1671-1676). When pathogens invade the human body, phagocytes such as neutrophiles, monocytes, and macrophages are the main cell group of the innate immune response that first defends the human body from pathogens (Uthaisangsook S, Day NK, Bahna SL, Good RA, Haraguchi S. 2002. Innate immunity and its role against infections. Ann. Allergy Asthma Immunol. 88: 253-264). In particular, macrophages are the first cells to respond to biodefense after the epithelial barrier and also function as an antigen presenting cell, and affect T cells in relation to adaptive immunity (3. Birk). RW, Gratchev A, Hakiy N, Politz O, Schledzewski K, Guillot P, Orfanos CE, Goerdt S. 2001. Alternative activation of antigen-presenting cells: concepts and clinical relevance. Hautarzt 52: 193-200), pathogen-infected cells It also removes cancer cells or cancer cells, and secretes cytokines such as nitric oxide (NO) and tumor necrosis factor-α (TNF-α) that contribute to the immune response (4Seon A Yoo, Ok Kyung Kim, Da-Eun Nam, Yongjae Kim, Humyoung Baek, Woojin Jun, Jeongmin Lee. 2014. Immunomodulatory Effects of Fermented Curcuma longa L. Extracts on RAW 264.7 Cells. J Korean Soc Food Sci Nutr 43(2): 216-243).

Research on natural substances to find the activator of macrophages responsible for the innate immune function that can respond to diseases before the human body's adaptive immunity works is being actively conducted. (5.A-Reum Yu, Ho-Young Park, In-Wook Choi, Yong-Kon Park, Hee-Do Hong, Hee-Don Choi. 2012. Immune Enhancing Effect of Medicinal Herb Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(11): 1521-1527) reported the immune enhancing effect of macrophages using herbal extracts, and reported macrophage immunomodulatory activity using ethanol extracts from feces apple seed ( 6.Myung-Woo Byun. 2013. Immunomodulatory Activities of Apple Seed Extracts on Macrophage. J Korean Soc Food Sci Nutr 42(9): 1513-1517), Yoo et al. reported. (4Seon A Yoo, Ok Kyung Kim, Da-Eun Nam, Yongjae Kim, Humyoung Baek, Woojin Jun, Jeongmin Lee. 2014. Immunomodulatory Effects of Fermented Curcuma longa L. Extracts on RAW 264.7 Cells. J Korean Soc Food Sci Nutr 43( 2): 216-243)

Macrophages are immune cells that phagocytose and play an important primary defense function of intrinsic immunity that exists in almost all tissues of the human body. Macrophage is an immune cell that secretes various cytokines in the process of detecting and removing bacteria or foreign substances and plays a pivotal role in immune action against antigens (12Yi Seul Seo and Kwang-Soon Shin. 2012. Immune System-Stimulating Activities of Mucilage Polysaccharides Isolated from Opuntia humifusa.J Korean Soc Food Sci Nutr 41(1): 95-102). NO produced by macrophages is an important signal transmitter that acts as a defense against tumor cells or intracellularly infected microorganisms in the immune system. The production ability was evaluated, and these herbal extracts showed NO production ability of macrophages at a level similar to that of the positive control, LPS (5.A-Reum Yu, Ho-Young Park, In-Wook Choi, Yong-Kon Park, Hee). -Do Hong, Hee-Don Choi. 2012. Immune Enhancing Effect of Medicinal Herb Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(11): 1521-1527).

It has been reported that inflammatory diseases and immune diseases, in principle, exhibit different pathological mechanisms, for example, endoplasmic reticulum ₍ ER) calcium release and exhaustion occurs. This depletion of the ER calcium store causes a continuous calcium influx from outside the cell, and it has been reported that this intracellular calcium influx is made through the ORAI1 ion channel whose molecular properties were revealed in 2006 [[Document 1] Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann NY Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x] Calcium influx through ORAI1 is known to be important for activating the calcineurin-NFAT signaling pathway that causes immune cell activation, so the importance of calcium signaling through ORAI1 It has been reported that the inhibitor is located much higher than the target signaling protein. [[Document 2] Stefan Feske, Yousang Gwack, Murali Prakriya, Sonal Srikanth, Sven-Holger Puppel, Bogdan Tanasa, Patrick G Hogan, Richard S Lewis, Mark Daly, Anjana Rao A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function . Nature 2006 May 11; 441 (7090): 179-85. doi: 10.1038/nature04702.]

ther, Alexander Papolos, Jeffery Kutok, Claire Hivroz, Francoise LeDeist, Katrin Plogmann, Stephan Ehl, Gundula Notheis, Michael H. Albert, Bernd H. Belohradsky, Janbernd Kirschner, Anjana Rao, Alain Fisched,Stefan Feske ORAI1 deficiency and lack of store-operated Ca2+ entry cause immunodeficiency, myopathy and ectodermal dysplasia J Allergy Clin Immunol. 2009 Dec; 124(6): 1311-1318.e7. doi: 10.1016/j.jaci.2009.10.007]).Therefore, because intracellular calcium signaling through ORAI1 acts as the top regulator of immune signals, a much more potent immunosuppressant can be made when developing new drugs targeting it, and in fact, severe immunodeficiency when ORAI1 ion channel is deficient in the human body A report of the occurrence of a disease has been reported in world-renowned journals including Nature (Document 1] Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann NY Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111 /j.1749-6632.2011.06240.x, [Document 3] Christie-Ann McCarl, Capucine Picard, Sara Khalil, Takumi Kawasaki, Jens R

ther, Alexander Papolos, Jeffery Kutok, Claire Hivroz, Francoise LeDeist, Katrin Plogmann, Stephan Ehl, Gundula Notheis, Michael H. Albert, Bernd H. Belohradsky, Janbernd Kirschner, Anjana Rao, Alain Fisched, Stefan Feske ORAI1 deficiency and lack of store -operated Ca2+ entry cause immunodeficiency, myopathy and ectodermal dysplasia J Allergy Clin Immunol. 2009 Dec; 124(6): 1311-1318.e7. doi: 10.1016/j.jaci.2009.10.007]).

Agrimonia pilosa is a perennial herb belonging to the dicotyledonous Rosaceae family, and is a plant that grows in the sun or semi-shade throughout Korea, as well as eastern Russia, Mongolia, Europe, Okinawa, Japan, and northeastern China. While the stipule sickle shape of Agrimonia pilosa usually does not wrap the stem, the sedge plant is distinguished from the stylus in that it wraps the stem in a semi-circular or fan-shaped shape. In addition, the flowers are closely attached to the raceme, so they are distinguished from the wild herbaceous plants, which are somewhat sloppy. (Life Resources Information Service, Korean Native Crops Encyclopedia, https://www.bris.go.kr)

On the other hand, a native plant native to Korea ( Agrimonia corana NAKAI ) is a perennial herb belonging to the dicotyledonous Rosaceae family that grows throughout Korea, and is distributed in eastern Russia, Mongolia, Europe, Okinawa Japan, and northeastern China. ), agrimonolide, tannin, and saponin components are known, and among them, agrimonin component is known to have a hemostatic action, hypoglycemic action, and anthelmintic action. (Information Relations, Dohaehyang Pharmacy Dictionary, Youngrimsa, pp636-637, 1998).

As for the efficacy of parasitic plants ( Agrimonia pilosa ), Korean Patent Application Laid-Open No. 10-2010-0128770 discloses the invention of a cosmetic composition for anti-atopic dermatitis containing an ethanol extract of parasitic stalks as an active ingredient; Korean Patent Application Laid-Open No. 10-2012-0126416 discloses the invention of a composition for inhibiting or treating anti-inflammatory, anti-allergic, asthmatic, or anti-inflammatory, anti-allergic, anti-inflammatory, anti-inflammatory, anti-inflammatory compositions comprising a methanol extract of parasitic plants; Korean Patent Application Laid-Open No. 10-2012-0003317 discloses the invention of a composition for inhibiting the secretion of granules from mast cells, including an extract of Agrimonia pilosa; Registered Patent No. 10-1554030 discloses the invention of a method for preparing a composition for improving skin condition by the root of Seonhakcho; Korean Patent Application Laid-Open No. 2001-0053978 discloses the invention of an anti-irritant cosmetic composition containing Seonhakcho extract as an active ingredient.

In addition, as an anti-inflammatory active ingredient that can be isolated from the apricot plant ( Agrimonia pilosa ), luteolin (Kim JJ, Jiang J, Shim DW, Kwon SC, Kim TJ, Ye SK, Kim MK, Shin YK, Koppula S, Kang TB, Choi DK, Lee KH. (2012) Anti-inflammatory and anti-allergic effects of Agrimonia pilosa Ledeb extract on murine cell lines and OVA-induced airway inflammation. J. Ethnopharmacol. 140(2):213-221); Apigenin [Aziz N, Kim MY, Cho JY. (2018) Anti-inflammatory effects of luteolin: A review of in vitro, in vivo, and in silico studies. J Ethnopharmacol. 28; 225:342-358.], Kaempferol [Pang L, Zou S, Shi Y, Mao Q, Chen Y. (2019) Apigenin attenuates PM2.5-induced airway hyperresponsiveness and inflammation by down-regulating NF-κB in murine model of asthma Int J Clin Exp Pathol. 12(10):3700-3709], Quercetin [Alam W, Khan H, Shah MA, Cauli O, Saso L. (2020) Kaempferol as a Dietary Anti-Inflammatory Agent: Current Therapeutic Standing. Molecules 7:25(18):E4073; Guiling Chen, Yang Ye, Ming Cheng, Yi Tao, Kejun Zhang, Qiong Huang, Jingwen Deng, Danni Yao, Chuanjian Lu1 and Yu Huang. “ Quercetin Combined With Human Umbilical Cord Mesenchymal Stem Cells Regulated Tumor Necrosis Factor-a/Interferon-g-Stimulated Peripheral Blood Mononuclear Cells via Activation of Toll-Like Receptor 3 Signaling. Front Pharmacol. 2020; 11: 499.], Luteolun 7-glucuronide [Young-Chang Cho, Jiyoung Park, Sayeon Cho (2020) Anti-Inflammatory and Anti-Oxidative Effects of luteolin-7-O-glucuronide in LPS-Stimulated Murine Macrophages through TAK1 Inhibition and Nrf2 Activation. Int J Mol Sci. 16;21(6):2007], Apigenin 7-glucuronide [Weicheng Hu, Xinfeng Wang, Lei Wu, Ting Shen, Lilian Ji, Xihong Zhao, Chuan-Ling Si, Yunyao Jiang, Gongcheng Wang (2016) Apigenin-7- O-β-D-glucuronide inhibits LPS-induced inflammation through the inactivation of AP-1 and MAPK signaling pathways in RAW 264.7 macrophages and protects mice against endotoxin shock. Food Funct. 7(2):1002-13.] is known.

However, the new or known anti-inflammatory component separation and industrial mass production of these anti-inflammatory active ingredients for the wild ginseng plant ( Agrimonia corana NAKAI ), which is a native plant native to Korea having a different scientific name from that of the apricot plant ( Agrimonia pilosa ) had a difficult problem.

Therefore, the present inventors have purified more from the extract of the native plant, Agrimonia corana NAKAI , which is different from the previously known extract of the alpaca ( Agrimonia pilosa ) extract, which contains a large amount of active ingredient known as an anti-inflammatory active ingredient ( Agrimonia corana NAKAI ) The focus has been on the search for purified substances, and the research has been focused on the research on the purified substances containing the active ingredient of Agrimonia corana NAKAI at a high concentration and the mass production method thereof.

Accordingly, the present inventors conducted an anti-immune activity evaluation experiment using T cells isolated from human blood for a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI (Experimental Example 1); By confirming the strong CD4+ T cell proliferation inhibitory ability and ORAI1 current inhibitory ability through the evaluation experiment (Experimental Example 2), etc. of the inhibitory activity of the ORAI1 ion channel regulating the intracellular calcium signal, the compound of the present invention prevents or treats immune-related diseases By confirming that it can be usefully used, the present invention was completed.

As an aspect for achieving the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of immune-related diseases comprising a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI , as an active ingredient. to provide.

As defined herein, “a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI ” is apigenin 7-glucuronide, luteolin 7-glucuronide (Luteolin). 7-glucuronide), luteolin, apigenin, kaempferol, quercetin, or a compound selected from Alphitolic acid or pharmaceutically acceptable salts and solvates includes

As defined herein, the " Agrimonia corana NAKAI " is a native plant native to Korea, and is native to Chungcheong-do, Jeolla-do, and Namhae in Gyeongsang-do. , outposts, leaves or stems.

Immune-related diseases as defined herein include autoimmune diseases, organ transplant rejection, immune hypersensitivity such as hypersensitivity allergic diseases; Or immunosuppression, preferably autoimmunity, such as a disease caused by a decrease in immune function due to anticancer therapy such as chemotherapy or radiotherapy or a disease caused by immunosuppression after bone marrow transplantation, AIDS due to immune system damage, and cancer disease caused by a decrease in immune function Immune hypersensitivity such as disease, hypersensitivity allergic disease, or decrease in immune function due to chemotherapy and radiotherapy such as chemotherapy or radiation therapy, or immunosuppression due to immunosuppression after bone marrow transplantation, more preferably, autoimmune disease, atopic dermatitis, acute or Immune hypersensitivity such as chronic urticaria or bacterial/viral infection in the elderly, chronic respiratory infection, chronic urinary tract infection, pressure sores, influenza, pneumonia, chickenpox in children, measles, sudden rash, hand, foot and mouth disease, rubella, or Crohn's disease, etc. Including immunosuppression due to immunosuppression of

The compounds of the present invention can be prepared as pharmaceutically acceptable salts and solvates according to methods conventional in the art.

As the salt of the present invention, an acid addition salt formed by a free acid is useful as a pharmaceutically acceptable salt. Acid addition salts are prepared by conventional methods, for example, by dissolving the compound in an aqueous solution of an excess of acid, and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equal molar amounts of compound and acid or alcohol (eg glycol monomethyl ether) in water may be heated to dryness, followed by evaporation of the mixture, or the precipitated salt may be filtered off with suction.

In this case, organic acids and inorganic acids can be used as free acids, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. can be used as inorganic acids, and methanesulfonic acid, p -toluenesulfonic acid, acetic acid, trifluoroacetic acid, etc. can be used as organic acids. , citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid (gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid and hydroiodic acid may be used.

In addition, a pharmaceutically acceptable metal salt can be prepared using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt, and the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

Pharmaceutically acceptable salts of the compounds of the present invention, unless otherwise indicated, include salts of acidic or basic groups that may be present in the compounds of the present invention. For example, pharmaceutically acceptable salts include sodium, calcium and potassium salts of a hydroxyl group, and other pharmaceutically acceptable salts of an amino group include hydrobromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogen There are phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p -toluenesulfonate (tosylate) salts, and methods or processes for preparing salts known in the art can be manufactured through

The derivatives of the present invention are prepared by chemical synthesis or separation and purification methods that repeatedly perform a purification process using a silica gel column and recrystallization method well known in the art, or are commercially available.

The compounds as defined herein can be prepared as pharmaceutically acceptable salts and solvates thereof according to methods conventional in the art.

Accordingly, the present invention is characterized in that the compounds include isomers, pharmaceutically acceptable salts, or solvates thereof.

As the salt of the present invention, an acid addition salt formed with a pharmaceutically acceptable free acid is useful. Acid addition salts are prepared by conventional methods, for example by dissolving the compound in an aqueous solution of excess acid and precipitating the salt with a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equal molar amounts of compound and an acid or alcohol (eg glycol monomethyl ether) in water may be heated and then the mixture evaporated to dryness, or the precipitated salt may be filtered off with suction.

In this case, organic acids and inorganic acids can be used as free acids, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. can be used as inorganic acids, and methanesulfonic acid, p -toluenesulfonic acid, acetic acid, trifluoroacetic acid, Citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid ( gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid and the like can be used.

In addition, a pharmaceutically acceptable metal salt can be prepared using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt, and the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

In addition, the compounds of the present invention may exist in different enantiomeric forms because they have asymmetric centers, and all optical isomers and R or S stereoisomers of the compounds of the present invention and mixtures thereof are also intended to be included within the scope of the present invention. . The present invention includes the use of a racemate, one or more enantiomeric forms, one or more diastereomeric forms, or mixtures thereof, and includes methods or preparations for the separation of isomers known in the art.

Hereinafter, the present invention will be described in more detail.

The compounds of the present invention can be obtained by the following preparation method.

For example, the present invention will be described in detail below.

A native plant native to Korea in a dry state, Agrimonia corana NAKAI , above-ground parts, outposts, leaves, stems, roots, etc., specifically, water, methanol, ethanol, butanol, etc. in the above-ground parts, outposts, leaves or stems with 1 carbon number A solvent selected from the lower alcohols of to 4, alcohol, or a mixture thereof, preferably water and ethanol or a mixed solvent of alcohol, more preferably 30 to 80% ethanol or alcohol is added to 10° C. to 100° C., preferably 20 Cold extraction method, ultrasonic extraction method, reflux cooling extraction method, hot water extraction method, room temperature extraction method, reflux cooling extraction method or a combination of one or more extraction methods selected from cold extraction method, ultrasonic extraction method, reflux cooling extraction method, hot water extraction method for 30 minutes to 72 hours, preferably 3 hours to 48 hours at a temperature of ℃ to 90℃ a first step of recovering the extract obtained by repeating the extraction method, preferably the reflux cooling extraction method, about 1 to 20 times, preferably 2 to 10 times to obtain a first extract; One or more purification of the first extract solution of the first step such as reverse phase chromatography, flash column chromatography, RP C18 column chromatography or silica gel open column chromatography, Diaion HP-20 column chromatography, Sephadex column chromatography method, etc. It is possible to isolate the compounds of the present invention by optionally repeating the process several times.

The present inventors conducted an anti-immune activity evaluation experiment using T cells isolated from human blood for the compounds obtained by the above preparation method (Experimental Example 1); By confirming the strong CD4+ T cell proliferation inhibitory ability and ORAI1 current inhibitory ability through the evaluation experiment (Experimental Example 2), etc. of the inhibitory activity of the ORAI1 ion channel regulating the intracellular calcium signal, the compound of the present invention is useful for the treatment of immune-related diseases It was confirmed that it can be used.

In addition, the compound isolated from the plant extract of the present invention as a drug that has been edible or used as a herbal medicine for a long time does not have problems such as toxicity and side effects.

The pharmaceutical composition of the present invention contains 0.1 to 90% by weight of the compound based on the total weight of the composition.

Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of immune-related diseases comprising a compound isolated from an extract of a wild plant native to Korea, Agrimonia corana NAKAI , as an active ingredient.

As another aspect for achieving the above object, the present invention provides a compound isolated from an extract of a wild plant native to Korea, Agrimonia corana NAKAI , and a pharmaceutically acceptable carrier or excipient for immune-related diseases containing A pharmaceutical composition for prevention or treatment is provided.

In the present invention, dragon grass may be purchased and used commercially, or harvested or grown in nature, but is not limited thereto.

In addition, the compound of the present invention may be prepared in a powder state by additional processes such as distillation under reduced pressure and freeze drying or hot air drying.

As used herein, the term “prevention” refers to any action of suppressing or delaying immune-related diseases by administration of a composition comprising a compound isolated from the extract. In addition, as used herein, the term "treatment" refers to any action in which symptoms of immune-related diseases are improved or beneficially changed by administration of a composition containing the compound.

In another aspect, a treatment method for treating an immune-related disease comprising administering to a patient with an immune-related disease a compound isolated from the extract of the native plant, Agrimonia corana NAKAI , according to the present invention to provide.

As another aspect, the composition containing the compound isolated from the extract of the native plant, Agrimonia corana NAKAI , as an active ingredient, and a pharmaceutically acceptable carrier or excipient according to the present invention is administered to immune-related It provides a treatment method for treating an immune-related disease, including administration to a disease patient.

As another aspect, the present invention provides the use of a compound isolated from an extract of wild ginseng plant native to Korea for the manufacture of a therapeutic agent for treating patients with immune-related diseases.

As another aspect, the present invention comprises a compound isolated from the extract of the wild plant native to Korea, Agrimonia corana NAKAI , as an active ingredient for the manufacture of a therapeutic agent for treating patients with immune-related diseases, and pharmaceutically Provided is the use of a composition containing an acceptable carrier or excipient.

The pharmaceutical composition comprising the compound according to the present invention is formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. can be used in combination. Carriers, excipients and diluents that may be included in the composition comprising the extract include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate , cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it is prepared using diluents or excipients such as commonly used fillers, weight agents, binders, wetting agents, sealants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract and fraction, for example, starch, calcium carbonate, sucrose It is prepared by mixing sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.

Non-aqueous solvents, suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used in the above formulation. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerol gelatin and the like can be used.

A preferred dosage of the pharmaceutical composition containing the compound of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, the route of administration, and the duration, but may be appropriately selected by those skilled in the art. However, for a desirable effect, the pharmaceutical composition comprising the tablet of the present invention is preferably administered at 0.0001 to 100 mg/kg per day, preferably at 0.001 to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.

The compound of the present invention may be administered to mammals such as rats, mice, livestock, and humans by various routes. Any mode of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

In addition, the present invention provides a health functional food for the prevention or improvement of immune-related diseases containing as an active ingredient a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI .

"Health functional food" as defined herein means a food manufactured and processed using raw materials or ingredients useful for the human body according to Health Functional Food Act No. 6727, and "functionality" means the human body's It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients with respect to structure and function or physiological effects.

The health functional food for the prevention or improvement of immune-related diseases of the present invention contains the compound in an amount of 0.01 to 95%, preferably 1 to 80% by weight based on the total weight of the composition.

In addition, for the purpose of preventing or improving immune-related diseases, pharmaceutical dosage forms such as powders, granules, tablets, capsules, pills, suspensions, emulsions, syrups, or health functional foods in the form of tea bags, leached teas, health drinks, etc. It can be manufactured and processed.

In addition, the present invention provides a health supplement for the prevention or improvement of immune-related diseases containing as an active ingredient a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI .

In addition, the present invention provides a food or food additive for the prevention or improvement of immune-related diseases containing a compound isolated from an extract of a wild plant native to Korea, Agrimonia corana NAKAI , as an active ingredient.

In addition, the health functional food may additionally contain food additives, and the suitability as a "food additive" is determined according to the general rules and general test methods of the Food Additives Code approved by the Food and Drug Administration, unless otherwise specified. It is judged according to the standards and standards.

As defined herein, the term "active ingredient" refers to about 1 to 99% (w/w), preferably, 5 to 60%, more preferably, 20 to 50% (w) based on 100% weight of the whole food composition. /w) weight.

Items listed in the "Food Additives Code", for example, chemical synthetic products such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid, natural additives such as depigmentation, licorice extract, crystalline cellulose, guar gum, L- Mixed preparations such as sodium glutamate preparation, noodle-added alkali agent, preservative agent, and tar color agent can be mentioned.

Examples of functional foods containing the compound of the present invention include bread, rice cakes, dried fruits, candies, chocolates, chewing gum, and confectionery products such as jams, ice cream products, ice cream products, and ice cream powders, milk, low-fat milk, and lactose-digested milk. , Processed milk, goat milk, fermented milk, buttermilk, concentrated milk, milk cream, butter oil, natural cheese, processed cheese, milk powder, milk products such as whey Processed meat products, processed eggs, meat products such as hamburgers Fish cakes, ham Fish and meat products such as processed fish meat products such as , sausages and bacon Ramen, dried noodles, raw noodles, fried noodles, luxurious dried noodles, improved soft noodles, frozen noodles, pasta, etc. Fruit drinks, vegetable drinks, carbonated drinks, soy milk , lactic acid bacteria drinks such as yogurt, beverages such as mixed drinks soy sauce, soybean paste, red pepper paste, chunjang, cheonggukjang, mixed soy sauce, vinegar, sauces, tomato ketchup, curry, seasoning foods such as dressings, margarine, shortening and pizza. It is not limited.

The health functional beverage composition of the present invention is not particularly limited in other ingredients except for containing the purified substance or compound as an essential ingredient in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage. can Examples of the aforementioned natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.); disaccharides, (eg maltose, sucrose, etc.); and conventional sugars such as polysaccharides (eg, dextrin, cyclodextrin, etc.), and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. have. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages, and the like. In addition, the compositions of the present invention may contain natural fruit juice and pulp for the production of fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the compound of the present invention may be added to food or beverage for the purpose of preventing the target disease. At this time, the amount of the compound in the food or beverage may be added in an amount of 0.01 to 15% by weight of the total food weight, and the health drink composition may be added in a ratio of 0.02 to 5 g, preferably 0.3 to 1 g based on 100 ml. can

The purified substance or compound according to the present invention added to food, including beverages, in the process of manufacturing the health functional food may appropriately increase or decrease its content as needed.

Anti-immune activity evaluation experiment using T cells isolated from human blood for a compound isolated from an extract of a native plant native to Korea, Agrimonia corana NAKAI according to the present invention (Experimental Example 1); By confirming the strong CD4+ T cell proliferation inhibitory ability and ORAI1 current inhibitory ability through the evaluation experiment (Experimental Example 2), etc. of the inhibitory activity of the ORAI1 ion channel regulating the intracellular calcium signal, the compound of the present invention prevents or treats immune-related diseases can be usefully used for

1 is a schematic diagram of the preparation of fractions for isolating compounds APH13211 and APH13212;
Fig. 2 is an HPLC analysis result of a parasitic plant extract and compounds APH13211 and APH13212;
3 is a schematic diagram of the preparation of fractions for isolating compounds APC-311 and APC-312;
4 is an HPLC analysis result of compounds APC-311 and APC-312;
Figure 5 is the result of CD4+ T cell proliferation inhibition analysis of APC-311, Luteolin 7-gluruconid, Apigenin 7-glucuronide;
6 shows the results of an ORAI1 inhibition assay for 8 compounds.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the content of the present invention is not limited by the examples.

Reference Example 1: Analytical Instruments

Melting points were measured without correction in the instrument (Koflermicrohostage), optical rotation was analyzed in the instrument (Jasco P-1020 polarimeter), and UV data were measured in the instrument (UV-VIS 2450 spectrometer), FT-IR spectra (spectra) is instrument (Jasco FT/IR-4200), NMR spectra is recorded on instrument (Varian UNITY 400 MHz FT-NMR spectrometer) using tetramethylsilane as an internal standard did HRESIMS was performed on an instrument (Waters Q-TOF Premier spectrometer) and HPLC separation was performed on an instrument (Gilson) using a UV/VIS-155 detector and a pump (pump 305).

Example 1: Identification of a parasitic plant sample through genetic analysis

Through the genetic analysis method, the sample of the present invention, Agrimonia coreana NAKAI, Minkyung Mulsan, Korea) was tested by a genetic analysis institute (Genotech Co., Ltd., Research Director: Seonho Cha, https://www.genotech. co.kr/ T: 82-42-862-8404 , 26-69, Gajeongbuk-ro, Yuseong-gu, Daejeon, Republic of Korea 305-343) Dried wild apricot ( Agrimonia coreana NAKAI, Korea) above- ground leaves ( Minkyung Mulsan, 143, Jeongneungcheon Dong-ro, Dongdaemun-gu, Seoul, Korea) The exact scientific name of the sample was confirmed using genetic analysis.

1-1. experimental process

1-1-1. DNA extraction and purification

DNA extraction and purification from the sample is performed by the CTAB method (cetyl trimethylammonium bromide method, Adam Healey, Agnelo Furtado, Tal Cooper & Robert J Henry. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 2014, 10:21) was performed as follows, and DNA was extracted and purified according to the manual of each commercially available product.

(1) Sample pretreatment

For DNA extraction, about 100 mg of the dried sample was placed in a mortar and pulverized to a fine powder state using liquid nitrogen.

(2) DNA extraction method using CTAB

Transfer the powder sample to a 2 ml tube, and pour 500 μl of lysis buffer ((K-3031, Bioneer), 20 mM Tris-HCl pH 8.0, 2 mM sodium EDTA, 1.2 % Triton X-100, lysozyme 20 mg/ml) and 10 ul of proteinase K solution (K-3031, Bioneer) (600 mAU/ml or more) were added, mixed thoroughly, and reacted for 1 hour in a 37 ℃ incubator, followed by 400 μl of CTAB (Cetyltrimethylammonium Bromide) buffer (( C2007, Biosang), 0.1 M Tris, pH 8.0; 1.4 M NaCl, 0.02 M EDTA, pH 8.0; 2 % hexadecyltrimethylammonium bromide; 0.2 % 2-mercaptoethanol) was added and incubated at 65 ° C (BS-31, Vision Lab Science Co., Ltd.) ) was treated for 30 minutes.

600 μl of a solvent mixture (Phenol: Chloroform: Isoamylalcohol = 25: 24: 1) and 300 μl of purified water were added to the reaction mixture, shaken to mix thoroughly, and centrifuged at 14,000 rpm at 20 °C for 10 minutes.

Take 600 μl of the supernatant, put it in a new 1.5 ml tube, add 600 μl of Isopropanol, and then stir several times, and then centrifuge the reaction at room temperature for 10 minutes at 14,000 rpm in Chicago at 20° C. for 10 minutes.

After removing the supernatant, the precipitated DNA was washed 2-3 times with 500 μl of 70% Ethanol and dried naturally at room temperature.

Dissolve the dried DNA in 20 ~ 30 μl of sterile tertiary purified water and leave it at 4 °C for 1 hour, then add 2 μl of RNase (K-3031, Bioneer), 100 mg/ml, 7,000 units/ml), 37 The reaction was carried out at ℃ condition for 30 minutes.

(3) Confirmation of DNA purity and concentration

After confirming the extracted DNA by electrophoresis on a 1% agarose gel (54801, Takara Korea Bio), it was stained with EtBr (Ethidium Bromide (E1510, Sigma-Aldrich)) and UV light (Gel Doc XR, Bio-RAD) Check the quality, measure the concentration at 260 nm and 280 nm absorbance using a UV spetrophotometer (Nanodrop, USA), and dilute with distilled water to quantify.

1-1-2. PCR conditions for DNA barcode analysis

(1) DNA barcode primer

The DNA barcode primers of the genus Parasiticaria plant were used as DNA barcode primers as shown in Table 1, and based on this, a barcode primer specific to the Parasitoid plant was developed by comparing it with barcode information of plants of the genus Parasiticaria from GenBank DB.

DNA barcode primer used to confirm the origin of herbal medicines *DNA bar-code primers used in DNA analysis target region Primer Primer Sequence Sequence I.D. cpDNA Coding
region matK* 3F_KIM f CGTACAGTACTTTTGTGTTTACGAG One 1R_KIM r CCCATT CATCTGGAAATCTTGGTTC 2 rbcL* rbcLa_R GTAAAATCAAGTCCACC G CG 3 rbcLa_F ATGTCACCACAAACAGAGACTAAAGC 4 Non-coding
region atpF-atpH* atpF f TCGCTTA ACACTCCC C TTCC 5 atpH r GCTTT C ATGGAAGCTTTAACAAT 6 psbA-trnH* psbA3 F GTTATGCATGAACGTAATGCTC 7 trnHf_05 CGCGC G TGGTGGATTCACAATCC 8 psbK-psbI* psbK f TTAGCCTTTGTTTGGCAAG 9 psbI r A T AGTTT A AGAGTAAGCAT 10 trnL-intron** trn c CGAAA T CGGTAGACGCTACG 11 trn d GGGGATAGAGGGACTTGAAC 12 trnL-trnF** trn e GGTTCAAGTCCCTCTATCCC 13 trn f ATTTGAACTGGTGACACGAG 14 *, CBOL; A CBOL Plant working group (2009) A DNA barcode for land plants. Proc Nati Acad Sci USA. 106(31): 12794-12797.
**, trnT-trnL; trnL-intron, trnL-trnF; Taberlet et al. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.
※ underlined character : specific base sequences of Agrimonia genus

(2) PCR (Polymerase Chain Reaction)

PCR conditions using barcode primers were: 2 μl of forward primer (10 pmole/μl), 2 μl of reverse primer (10 pmole/μl) and 20 ng/ul of quantified template DNA in a commercialized PCR premix (K-2115, Bioneer). were mixed and purified water was added to make the final reaction volume a total of 30 μl.

Reaction conditions include predenaturation at 95 °C for 5 minutes, denaturation at 95 °C for 45 seconds, annealing at 55 °C for 45 seconds, and amplification at 72 °C for 1 minute (extension). After repeating the process 35 times, the DNA amplification product was obtained by final extension at 72 °C for 5 minutes.

The DNA amplification product was electrophoresed by dripping 5 μl on a 1% agarose gel, and then treated with Ethidium Bromide (EtBr) staining to confirm the amplification product.

(3) DNA barcode sequencing analysis

For nucleotide sequence analysis, the PCR product obtained through the barcode primer was purified and nucleotide sequence analysis was performed.

The nucleotide sequence analyzed for each DNA barcode of each sample was analyzed by the Clustal W method (JD Thompson, DG Higgins, TJ Gibson. CLUSTAL W: improving the sensitivity) using the Bioedit program (Version 7.0.5,3 Tom Hall Ibis Bioscienes, USA) program. of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994 Nov 11;22(22):4673-80.)

Based on the nucleotide sequence analysis results for each plant of origin, insertions, deletions, and substitutions of nucleotides were analyzed for each position to confirm the differences between species.

NCBI GenBank DB Blast Analysis

For the barcode sequence of each sample, the sequence of the sample's Chloroplast DNA (cpDNA) barcodes was analyzed for 7 sections (matK, rbcL, atpF-atpH, psbA-trnH, psbK-psbI, trnL-intron, trnL-trnF). .

As a result of the above experiment, in 7 barcode sections (matK, rbcL, atpF-atpH, psbA-trnH, psbK-psbI, trnL-intron, trnL-trnF ) of wild alpaca (Agrimonia coreana NAKAI) registered in GenBank DB of NCBI. It was confirmed that it was consistent with the nucleotide sequences for

Example 2: Separation of active compounds (APH13211, APH13212) from the extract

2-1. Separation of purified fractions

In Example 1, the final identification of wild ginseng ( Agrimonia coreana NAKAI, Minkyung Mulsan, Korea) (Genotech Co., Ltd., research director: Seon-ho Cha) https://www.genotech.co.kr/ T:82 -42-862-8404 , 26-69, Gajeongbuk-ro, Yuseong-gu, Daejeon, Republic of Korea 305-343) Dried wild apricot ( Agrimonia coreana NAKAI, Korea) above-ground leaves (Minkyung Mulsan, Korea) 1 kg was selected, washed and cut to an appropriate size, put into an extractor (MM-0750A, Mikwang Medical), and 70% alcohol was added to about 20 times (v/w), followed by circulation extraction at 70 °C for 4 hours. The process of filtration of the extracted extract with a filter (R5PPMF01ES, Kajika Co.) was repeated 5 times, and after recovery, the filtrate was collected at about 460 g using a vacuum evaporation concentrator (Buchi, Rotavapor® R-300) at 60 ° C or less. (soft algae extract, concentrate) was obtained.

2-2. Isolation of purified fractions and compounds (APH13211, APH13212)

The extract obtained in 1-1 was sequentially partitioned and extracted with equal amounts of hexane and ethyl acetate to obtain three fractions, which were analyzed under the HPLC analysis conditions in Table 1 below. Among them, the water layer showing the HPLC pattern similar to the fraction with the highest activity was adsorbed on Diaion HP-20 resin and eluted with 30%, 70%, and 100% methanol 3 L each to obtain 3 purified products (HP-pass, HP- 30M, HP-70M) and analyzed by HPLC.

Among them, the HP-70M fraction having the most similar peak to the active fraction and having a high content was concentrated under reduced pressure, and the concentrate was fractionated by reversed-phase (ODS) MPLC and divided into four fractions (MPLC-1 to MPLC-4). The solvent used for MPLC preparatives was varied in concentration from 40% methanol to 100% methanol. Then, after concentrating the MPLC-1 fraction, Sephadex LH-20 column chromatography was performed using 70% methanol as an elution solvent, and HPLC analysis was performed to obtain 10 fractions (LH-1 to LH-10). The obtained LH-3 fraction was concentrated, and second Sephadex LH-20 column chromatography was performed using 50% methanol as an elution solvent, and the fractions were analyzed by HPLC to obtain five fractions (Fr. I to Fr. V). . The obtained fraction Fr. After concentration of II under reduced pressure, preparative ODS MPLC was performed by changing the concentration from 0% methanol to 100% methanol. MPLC fractions were analyzed by HPLC to obtain three fractions (MPLC-1 to MPLC-3). In order to remove impurities in the obtained final MPLC-1 fraction, preparative ODS MPLC was performed again to separate and purify APH13211. In order to remove impurities in the final MPLC-3 fraction obtained by the same method, preparative ODS MPLC was performed again to separate and purify APH13212 from the MPLC-3 fraction. The purification process for the separation of the parasitic plant compound is briefly shown in FIG. 1 .

The HPLC analysis conditions of the finally separated and purified APH13211 and APH13212 are shown in Table 2 below, and the analysis results are shown in FIG. 2 .

HPLC analysis conditions High-Speed Liquid Chromatography Analysis Conditions analysis instrument HITACHI Chromaster, HITACHI , Japan Analysis conditions Column TSK-gel 100V (4.6 mm×250 mm, 5 ㎛), TOSOH, Japan Column Temperature 25 ℃ Mobile phase A: 5% MeOH (0.04% TFA)
B: MeOH Gradient hour Mobile phase A (%) Mobile phase B (%) 0 90 10 2 90 10 20 0 100 22 0 100 23 90 10 26 90 10 Injection volume 10 μl Flow rate 1ml/min

2-3. Structural analysis of compounds (APH13211, APH13212)

For structural analysis of APH13211 and APH13212 obtained in Example 2-2, after redissolving in DMSO- d ₆ solvent, ¹ H NMR, ¹³ C NMR, (JEOL JNM-ECA600 600 MHz FT-NMR spectrometer (JAPAN)) measured.

As a result, APH13211 was analyzed as luteolin 7-glucuronide having the following physical properties, and their physicochemical data were compared with the existing literature. (Tsukasa Iwashina and Hiroaki Setoguchi et al. Flavonoids from the Leaves of Vitex rotundifolia (Verbenaceae), and their Qualitative and Quantitative Comparison between Coastal and Inland Populations. Ozgen et al. A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)

a. Luteolin 7-glucuronide:

<Compound APH13211>

¹ H NMR: (500 MHz, DMSO- d ₆ , JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 12.80 (1H, -COOH), 9.96 (1H, OH), 9.38 (1H, OH) ), 7.44 (1H, dd, J = 8.5, 2.5 Hz, H-6'), 7.42 (1H, d, J = 2.5 Hz, H-2'), 6.91 (1H, d, J = 8.5 Hz, H -5'), 6.80 (1H, d, J = 2.0 Hz, H-8), 6.74 (1H, s, H-3), 6.46 (1H, d, J = 2.0 Hz, H-6), 5.28 ( 1H, d, J = 7.5 Hz, H-1''), 4.04-3.30 (sugar protons, 4H, H-2'', H-3'', H-4'', H-5'').

¹³ C NMR: (125 MHz, DMSO- d ₆ , JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 181.8 (C-4), 170.0 (C-6''), 164.5 (C- 2), 162.5 (C-7), 161.2 (C-5), 156.9 (C-9), 149.9 (C-4'), 145.7 (C-3'), 121.3 (C-1'), 119.1 ( C-6'), 116.0 (C-5'), 113.5 (C-2'), 105.4 (C-10), 103.2 (C-3), 99.4 (C-6), 99.2 (C-1'' ), 94.5 (C-8), 75.6 (C-3''), 75.4 (C-5''), 72.8 (C-2''), 71.2 (C-4'').

b. Apigenin 7-glucuronide:

APH13212 was analyzed as apigenin 7-glucuronide having the following physical properties, and their physicochemical data were compared with the existing literature. (Hui-Ling Cheng and Li-Jie et al. Antiinflammatory and Antioxidant Flavonoids and Phenols from Cardiospermum halicacabum (倒地鈴 Dao Di Ling).J Tradit Complement Med.2013 Jan-Mar;3(1):33-40;Ufuk Ozgen et al.A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)

<Compound APH13212>

¹ H NMR: (500 MHz, DMSO- d ₆ , JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 12.96 (1H, -COOH), 10.39 (1H, OH), 7.93 (2H, d , J = 8.5 Hz, H-2'/6'), 6.93 (2H, d, J = 8.5 Hz, H-3'/5'), 6.84 (1H, d, J = 2.0 Hz, H-8) , 6.83 (1H, s, H-3), 6.45 (1H, d, J = 2.0 Hz, H-6), 5.26 (1H, d, J = 7.5 Hz, H-1''), 4.05-3.31 ( sugar protons, 4H, H-2'', H-3'', H-4'', H-5'').

¹³ C NMR: (125 MHz, CD ₃ OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 182.0 (C-4), 170.0 (C-6''), 164.3 (C-2) ), 162.5 (C-7), 161.4 (C-4'), 161.2 (C-5), 157.0 (C-9), 128.6 (C-2'/6'), 121.0 (C-1'), 116.0 (C-3'/5'), 105.5 (C-10), 103.1 (C-3), 99.4 (C-6), 99.2 (C-1''), 94.7 (C-8), 75.6 ( C-3''), 75.4 (C-5''), 72.8 (C-2''), 71.2 (C-4'').

Example 3. Isolation of the active compound (APC-311. APC-312)

3-1. Preparation of extracts

It was prepared in the same way as the extract preparation method of Example 2-1.

3-2. Separation of purified fractions and compounds (APC-311, APC-312)

The extract obtained in 3-1 was partitioned and extracted with the same amount of hexane, and the water layer was again partitioned and extracted with chloroform, and the chloroform layer showing high activity was concentrated under reduced pressure. The concentrated chloroform layer was subjected to silica gel column chromatography (elution solvent: hexane:ethyl acetate=10:1→0:1, v/v), and the fraction was analyzed by TLC (eluent: hexane:ethyl acetate=1:1). , v/v) through 7 groups (AP-C-1 ~ AP-C-7). After concentrating the AP-C-3 fraction showing the highest activity among the 7 groups, Sephadex LH-20 column chromatography (elution solvent: chloroform:methanol=1:1, v/v) was performed, and the fraction was analyzed by TLC ( Developing solvent: hexane:ethyl acetate=1:1), and fractions were divided into the following four groups (APC3-1, APC3-2, Fr.32-38, APC3-5). Among the four groups, Fr. After concentration of fractions 32-38, Sephadex LH-20 column chromatography was performed using methanol. The fractions were analyzed by TLC (eluent: hexane:thyl acetate=1:1) and divided into two groups (APC3-3, APC3-4) for a total of 5 types (APC3-1, APC3-2, APC3-3, APC3). -4, APC3-5) was aliquoted.

Preparative ODS MPLC (eluent: 70-100% aq. methanol) was performed by concentrating the APC3-3 fraction showing the highest activity among them, and 4 groups (MPLC-1, MPLC-2, MPLC-3, MPLC) were performed. -4) was aliquoted. Among them, MPLC-3 showing the highest activity was concentrated and APC-31 was isolated by performing preparative HPLC (ODS column, 10x150 mm, 65% aq. acetonitrile, 3 ml/min).

As a result, APC-31 was divided into two peaks, and APC-311 (2.8 mg) and APC-312 were performed by preparative HPLC (ODS column, 4.6x150 mm, 70-100% aq. acetonitrile, 1 ml/min). (4.5 mg) was isolated from each.

The separation of the fractions is shown briefly in FIG. 3 . And HPLC analysis conditions were prepared in Table 3 below, and the HPLC analysis result of APC-31 is shown in FIG.

HPLC analysis conditions High-Speed Liquid Chromatography Analysis Conditions analysis instrument HITACHI Chromaster, HITACHI , Japan Analysis conditions Column TSK-gel 100V (4.6 mm×250 mm, 5 ㎛), TOSOH, Japan Column Temperature 25 ℃ Mobile phase A: 3rd distilled water
B: Acetonitrile Gradient hour Mobile phase A (%) Mobile phase B (%) 0 30 70 2 30 70 20 0 100 26 0 100 27 30 70 30 30 70 Injection volume 10 μl Flow rate 1ml/min

3-3. Structural analysis of compounds (APC-311, APC-312)

For structural analysis of APC-311 and APC-312 obtained in Example 3-2, ¹ H NMR, ¹³ C NMR, (JEOL JNM _- ECA600 600 MHz FT-NMR spectrometer (JAPAN)) was measured with

a. Alphitolic acid:

As a result, APC-311 was analyzed as alphitolic acid having the following physical properties, and their physicochemical data were identified by comparing them with the existing literature. (Bae, Ki-Hwan, et al. Isolation and Quantification of Vetulinic Acid and Alphytolic Acid from Jujubes. Journal of Pharmaceutical Sciences, Vol. 40, No. 4, 558~562(1996); Sang-Myung Lee et al. Anti-complementary Activity of Triterpenoides from Fruits of Zizyphus jujuba. Biol. Pharm. Bull. 27(11) 1883-1886 (2004); Somin Park et al. Expedient Synthesis of Alphitolic Acid and Its Naturally Occurring 2-O-Ester Derivatives. J. Nat. Prod. 2019, 82 , 895-902)

<Compound APC-311>

¹ H NMR: (500 MHz, CD ₃ OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 4.70 (1H, br s, H-29), 4.58 (1H, br, s, H -29), 3.60 (1H, m, H-2), 3.03 (1H, m, H-19), 2.88 (1H, d, J = 9.5 Hz, H-3), 2.33 (1H, m, H- 13), 2.23 (1H, dt, J = 13.0, 3.0 Hz, H-16), 1.99 (1H, dd, J = 12.5, 4.5 Hz, H-1), 1.94 (1H, m, H-21), 1.89 (1H, m, H-22), 1.73 (1H, m, H-12), 1.69 (3H, s, H-30), 1.61 (1H, t, J = 11.5 Hz, H-18), 1.54 (1H, m, H-15), 1.53 (1H, m, H-6), 1.45 (1H, H-11), 1.44 (1H, H-7), 1.42 (1H, H-6), 1.42 ( 1H, H-22), 1.41 (1H, H-16), 1.38 (1H, H-7), 1.38 (1H, H-9), 1.38 (1H, H-21), 1.29 (1H, dd, J = 12.5, 4.5 Hz, H-11), 1.16 (1H, m, H-15), 1.07 (1H, m, H-12), 1.00 (3H, s, H-27), 0.98 (3H, s, H-23), 0.96 (3H, s, H-26), 0.91 (3H, s, H-25), 0.83 (1H, t, J = 12.0, H-1), 0.77 (3H, s, H- 24), 0.79 (1H, m, H-5).

¹³ C NMR: (125 MHz, CD ₃ OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 48.4 (C-1), 69.8 (C-2), 84.4 (C-3), 40.5 (C-4), 56.8 (C-5), 19.5 (C-6), 35.5 (C-7), 42.0 (C-8), 52.0 (C-9), 39.5 (C-10), 22.2 (C-11), 26.8 (C-12), 39.6 (C-13), 43.6 (C-14), 30.8 (C-15), 33.4 (C-16), 57.6 (C-17), 50.5 ( C-18), 48.5 (C-19), 152.1 (C-20), 31.7 (C-21), 38.2 (C-22), 29.1 (C-23), 17.2 (C-24), 17.9 (C -25), 16.7 (C-26), 15.1 (C-27), 180.4 (C-28), 110.1 (C-29), 19.6 (C-30).

b. 2α,3β-dihydroxyolean-13(18)-en-28-oic acid:

APC-312 has the following physical properties It was analyzed as 2α,3β-dihydroxyolean-13(18)-en-28-oic acid, and its physicochemical data were identified by comparing it with the existing literature.

Based on the analysis results, this compound was identified as 2α,3β-dihydroxyolean-13(18)-en-28-oic acid. The three-dimensional structure was inferred from the comparison of the above compound APC-311 with proton and carbon peaks.

<Compound APC-312>

¹ H NMR: (500 MHz, CD ₃ OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 3.64 (1H, m, H-2), 2.91 (1H, d, J = 9.5 Hz) , H-3), 2.79 (1H, m, H-12), 2.44 (1H, dd, J = 14.0, 2.0 Hz, H-19), 2.14 (1H, H-22), 2.06 (1H, dd, J = 12.5, 4.5 Hz, H-1), 1.90 (1H, m, H-16), 1.89 (1H, m, H-12), 1.76 (1H, m, H-15), 1.75 (1H, br) d, J = 14.0 Hz, H-19), 1.57 (1H, H-9), 1.54 (1H, m, H-6), 1.54 (1H, H-11), 1.53 (1H, m, H-16) ), 1.46 (1H, H-7), 1.41 (1H, H-7), 1.38 (1H, m, H-11), 1.37 (1H, H-6), 1.31 (1H, H-21), 1.31 (1H, H-22), 1.21 (1H, H-21), 1.19 (3H, s, H-27), 1.13 (1H, m, H-15), 1.00 (3H, s, H-23), 0.96 (3H, s, H-25), 0.93 (1H, t, J = 12.0, H-1), 0.93 (3H, s, H-26), 0.92 (3H, s, H-29), 0.86 ( 1H, m, H-5), 0.78 (3H, s, H-24), 0.74 (3H, s, H-30).

¹³ C NMR: (125 MHz, CD ₃ OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 48.4 (C-1), 69.7 (C-2), 84.5 (C-3), 40.5 (C-4), 56.8 (C-5), 19.5 (C-6), 36.1 (C-7), 42.7 (C-8), 52.1 (C-9), 39.6 (C-10), 22.9 (C-11), 26.3 (C-12), 139.1 (C-13), 45.6 (C-14), 28.3 (C-15), 34.3 (C-16), 49.5 (C-17), 129.9 ( C-18), 42.0 (C-19), 33.6 (C-20), 38.0 (C-21), 36.9 (C-22), 29.2 (C-23), 17.4 (C-24), 18.2 (C -25), 18.4 (C-26), 21.5 (C-27), 180.7 (C-28), 32.7 (C-29), 24.7 (C-30).

Example 4. Inhibition of CD4+ T cell proliferation by isolation compounds

For sample preparation requiring increased dose, apigenin 7-glucuronide (Sigma-Aldrich, 04490590), luteolin 7-glucuronide (sugma-Alfrich Co. Sigma-Aldrich) Luteolin 7-glucuronide: Sigma-Aldrich, 04480585), luteolin (Luteolin: Sigma-Aldrich, L9283), apigenin (Apigenin: Sigma-Aldrich, 42251), kaempferol (Kaempferol: Sigma-Aldrich, K0133), quercetin (Quercetin: Sigma-Aldrich, Q4951) was purchased, respectively, and the alpitolic acid isolated in Example 3-2 was dissolved in DMSO to determine whether immune cell proliferation could be inhibited. was used.

Experimental Example 1: Evaluation of anti-immune activity using T cells isolated from human blood

In order to confirm the anti-immune activity of the sample obtained in the above example, an experiment was performed using T cells isolated from human blood as follows by applying the method described in the existing literature. (J Immunol July 15, 2002, 169 (2) 802-808;)

1.1. Isolation of T cells from human blood

To evaluate the anti-immune activity, T cells were isolated from human blood according to the method described in the literature (BIOPRESERVATION AND BIOBANKING, Volume 14, Number 5, 2016). First, human blood was collected and then PBMCs (peripheral blood mononuclear cells) were isolated using Ficoll (GE17-5442-02, GE Healthcare).

For the isolated PBMC, only CD4+ T cells were isolated using a T cell isolation kit (130-096-533, Miltenyi biotec). Isolation of T cells was precisely separated according to the method indicated by the manufacturer.

1.2. Evaluation of T cell proliferation inhibition using CFSE (Carboxyfluorescein succinimidyl ester)

Analysis of the anti-immune activity of T cells was evaluated by inhibition of proliferation of isolated CD4+ T cells. Carboxyfluorescein diacetate succinimidyl ester (CFSE, C34570, ThermoFisher scientific) was treated so that the concentration of CFSE was 1 μM in isolated T cells, and then incubated at room temperature for 30 minutes blocking light, followed by DPBS (Dulbecco's Phosphate-Buffered Saline, LB 001-) 01, welgene) was washed twice to complete staining.

CFSE-stained T cells were seeded in the prepared 96-well plate at the number of cells per 2x10 ⁵ wells and stimulated using anti-CD3 and anti-CD28.

In order to evaluate the T cell proliferation inhibition of the samples obtained in the above examples, the extracts and purified products obtained in the above examples together with the stimulation of anti-CD3 and anti-CD28 were used to obtain a concentration of 100 μg/ml using a mechanical pipette. injected. As a control for anti-immune activity, 10 μM of BTP2 ([N-{4-[3,5-bis(Trifluoromethyl)-1H-pyrazol-1-yl]phenyl}-4-methyl-1,2,3-thiadiazole- 5-carboxamide] , 203890-M, Calbiochem).

The sample-treated T cells were cultured in a 5% CO2 incubator (MCO-18AC, Panasonic) at 37° C. for 72 hours. After culturing, the cells were collected and analyzed by flow cytometry (BD LSRFortessa, BD Bioscience).

As a result of the above experiment, as shown in FIG. 5, T cell proliferation did not occur in the group not treated with anti-CD3 or anti-CD28 ((-)CD3, CD28), but in the group treated with anti-CD3 and anti-CD28 ((+) CD3, CD28) can confirm that cell proliferation occurs. In the group treated with BTP2, it was confirmed that cell proliferation did not occur in the same way as in the (-)CD3 and CD28 groups.

Analysis of CD4+ T cell proliferation inhibition of three example compounds: Apigenin 7-glucuronide, Luteolin 7-glururonide, and Alphitolic acid did

As a result, as shown in FIG. 5 , it was confirmed that all three compounds caused CD4+ T cell proliferation inhibition in a concentration-dependent manner. Alphitolic acid isolated in Example showed high activity at low concentration. The inhibition rate of CD4+ T cell proliferation of alphitolic acid by concentration is as follows. 0.3 μM: 10.55±2.35%, 1 μM: 29.98±0.914%, 3 μM: showed inhibition of 80.18±7.11%. The CD4+ T cell proliferation inhibition rate of apigenin 7-glucuronide by concentration is as follows. 10 μM: 24.1±3.949%, 100 μM: showed inhibition of 91.16±1.144%. The inhibition rate of CD4+ T cell proliferation of luteolin 7-glucuronide by concentration is as follows. 10 μM: 41.1±3.286%, 100 μM: showed inhibition of 95.8±0.118%. The CD4+ T cell proliferation inhibition rate of Kaempferol by concentration is as follows. 10 μM: showed inhibition of 89.52±0.632%, 100 μM: 96.42±0.516%. (See Table 4)

Comparative analysis of CD4+ T cell proliferation inhibition rate of Example compounds matter density CD4+ T cell proliferation inhibition rate (%) Alphitolic acid 0.3 μM 10.55 ± 2.35 1 μM 29.98 ± 0.914 3 μM 80.18 ± 7.11 Apigenin 7-glucuronide 10 μM 24.1 ± 3.949 100 μM 91.16 ± 1.144 Luteolin 7-Glucuronide 10 μM 41.1 ± 3.286 100 μM 95.8 ± 0.118 Keemferol 10 μM 89.52 ± 0.632 100 μM 96.42 ± 0.516

Experimental Example 2: Evaluation of inhibitory activity of ORAI1 ion channel regulating intracellular calcium signal

In order to confirm the inhibitory activity of the ORAI1 ion channel regulating the intracellular calcium signal of the sample obtained in the above example, an experiment was performed as follows by applying the method described in the existing literature. (The American Journal of Chinese Medicine, Vol. .47, No. 7, 1-15)

Inhibition of the ORAI1 ion channel, which can increase intracellular calcium signaling, an important process for T cell proliferation, was analyzed.

The composition of the extracellular fluid for patch clamp analysis was 135mM NaCl, 3.6mM KCl, 1mM MgCl2, 10mM CaCl2, 5mM D-glucose, 10mM HEPES (H3375, sigma), and pH was titrated with NaOH to 7.4. The composition of the intracellular fluid was 130mM Cs-glutamate, 20mM BAPTA, 1mM MgCl2, 3mM MgATP, 0.002mM sodium pyruvate, 20mM HEPES (H3375, sigma), and the pH was 7.2 and CsOH (C8518, sigma) was titrated.

ORAI1 current was measured using an AAxopatch 200B amplifier (Axon Axopatch 200B Microelectrode Amplifier, Molecular Devices) and a Digidata 1440A (Axon digidata 1440A, Molecular Devices), and data were analyzed using pClamp10.4 (pClamp10.4, Molecular Devices). .

Ramp-pulse for recording current was changed from -130mV to 50mV for 100msec, and the cell membrane voltage was fixed at -10mV and repeated every 20 seconds.

In order to compare the degree of inhibition of components exhibiting anti-immune activity, 10 μM of BTP2 (203890-M, Calbiochem), known as an ORAI1 inhibitor, was flowed into the chamber at the end of current measurement to confirm inhibition of current.

As a result, as shown in FIG. 6 , it was confirmed that all of the compounds inhibited the ORAI1 current. Among them, it was confirmed that the effect of Alphitolic acid was the highest. Luteolin 7-glucuronide: 51.31±5.293%, Apigenin 7-glucuronide: 51.5±5.083%, Alphitolic acid 1 μM: 34.46±6.067%, 10 μM: 76.88±2.923%, 2α,3β-dihydroxyolean-13(18)-en-28-oic acid: 39.22±9.920%, Apigenin: 38.95±6.851%, chemferol (Kaempferol): 53.29±5.125%, Luteolin: 20.16±2.361%, Quercetin: 32.33±4.642% (see Table 5).

Comparative analysis of ORAI1 inhibition rate of Example samples matter density ORAI1 inhibition (%) Alphytolic acid 1 μM 3Alphytolic acid 067 10 μM 76.88 ± 2.923 2α,3β-dihydroxyolean-13(18)-en-28-oic acid 100 μM 39.22 ± 9.920 Apigenin 7-glucuronide 100 μM 51.5 ± 5.083 Luteolin 7-Glucuronide 100 μM 51.31 ± 5.293 apigenin 100 μM 38.95 ± 6.851 luteolin 100 μM 20.16 ± 2.361 Keemferol 100 μM 53.29 ± 5.125 quercetin 100 μM 32.33 ± 4.642

4-7. Statistical processing

One-way ANOVA was performed on the results obtained from various experiments, and the significance between each group was verified using Dunnett's multiple comparison test as a post hoc test.

The formulation examples of the pharmaceutical composition containing the compound of the present invention will be described, but the present invention is not intended to be limited thereto, but only to be described in detail.

Formulation Example 1. Preparation of powder

APH13211 20 mg

Lactose 100 mg

talc 10 mg

The above ingredients are mixed and filled in an airtight bag to prepare a powder.

Formulation Example 2. Preparation of tablets

APH13212 10 mg

Corn Starch 100 mg

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above ingredients, tablets are prepared by tableting according to a conventional manufacturing method of tablets.

Formulation Example 3. Preparation of capsules

APC-311 10 mg

3 mg of crystalline cellulose

Lactose 14.8 mg

Magnesium stearate 0.2 mg

According to a conventional capsule preparation method, the above ingredients are mixed and filled in a gelatin capsule to prepare a capsule.

Formulation Example 4. Preparation of injection

Apigenin 10 mg

mannitol 180 mg

Sterile distilled water for injection 2974 mg

Na ₂ HPO _4· 12H ₂ O 26 mg

According to a conventional method for preparing injections, the content of the above ingredients per 1 ampoule (2 ml) is prepared.

Formulation Example 5. Preparation of liquid formulation

Luteolin 20 mg

10 g isomerized sugar

5 g of mannitol

Purified water appropriate amount

According to a conventional liquid preparation method, each component is added to purified water to dissolve it, an appropriate amount of lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 mL by adding purified water, and then filled in a brown bottle. Sterilize to prepare a solution.

Formulation Example 6. Preparation of health food

APC-311 1000 mg

vitamin mixture appropriate amount

70 μg vitamin A acetate

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

0.2 μg of vitamin B ₁₂

Vitamin C 10 mg

Biotin 10 μg

Nicotinamide 1.7 mg

50 μg of folic acid

Calcium Pantothenate 0.5 mg

mineral mixture appropriate amount

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 90 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

The composition ratio of the above vitamin and mineral mixture is a composition that is relatively suitable for health food in a preferred embodiment, but the mixing ratio may be arbitrarily modified. , to prepare granules, and can be used for preparing health food compositions according to a conventional method.

Formulation Example 7. Preparation of a health drink

APC-312 100 mg

vitamin C 15 g

100 g vitamin E (powder)

iron lactate 19.75 g

3.5 g zinc oxide

3.5 g of nicotinic acid amide

0.2 g vitamin A

0.25 g of vitamin B ₁

Vitamin B ₂ 0.3g

water metering

After mixing the above ingredients according to a conventional health drink manufacturing method, after stirring and heating at 85 ° C for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 liter container, sealed and sterilized, then refrigerated. It is used to prepare the health drink composition of the invention.

Although the composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demanding class, demanding country, and use.

<110> Dongguk University Industry-Academic Cooperation Foundation Dongguk University Gyeongju Campus Industry-Academy Cooperation Foundation <120> a composition comprising Alphitolic acid compound isolated from an extract of Agrimonia corana NAKAI as an active ingredient for preventing or treating immune-involved disease <130> DIF/DIV_2021-03-003/EK <150> KR 10-2020-0135544 <151> 2020-10-19 <150> KR 10-2021-0061187 <151> 2021-10-19 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 1 Cys Gly Thr Ala Cys Ala Gly Thr Ala Cys Thr Thr Thr Thr Gly Thr 1 5 10 15 Gly Thr Thr Thr Ala Cys Gly Ala Gly 20 25 <210> 2 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 2 Cys Cys Cys Ala Thr Thr Cys Ala Thr Cys Thr Gly Gly Ala Ala Ala 1 5 10 15 Thr Cys Thr Thr Gly Gly Thr Thr Cys 20 25 <210> 3 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 3 Gly Thr Ala Ala Ala Ala Thr Cys Ala Ala Gly Thr Cys Cys Ala Cys 1 5 10 15 Cys Gly Cys Gly 20 <210> 4 <211> 26 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 4 Ala Thr Gly Thr Cys Ala Cys Cys Ala Cys Ala Ala Ala Cys Ala Gly 1 5 10 15 Ala Gly Ala Cys Thr Ala Ala Ala Gly Cys 20 25 <210> 5 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 5 Thr Cys Gly Cys Thr Thr Ala Ala Cys Ala Cys Thr Cys Cys Cys Cys 1 5 10 15 Thr Thr Cys Cys 20 <210> 6 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 6 Gly Cys Thr Thr Thr Cys Ala Thr Gly Gly Ala Ala Gly Cys Thr Thr 1 5 10 15 Thr Ala Ala Cys Ala Ala Thr 20 <210> 7 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 7 Gly Thr Thr Ala Thr Gly Cys Ala Thr Gly Ala Ala Cys Gly Thr Ala 1 5 10 15 Ala Thr Gly Cys Thr Cys 20 <210> 8 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 8 Cys Gly Cys Gly Cys Gly Thr Gly Gly Thr Gly Gly Ala Thr Thr Cys 1 5 10 15 Ala Cys Ala Ala Thr Cys Cys 20 <210> 9 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 9 Thr Thr Ala Gly Cys Cys Thr Thr Thr Gly Thr Thr Thr Gly Gly Cys 1 5 10 15 Ala Ala Gly <210> 10 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 10 Ala Thr Ala Gly Thr Thr Thr Ala Ala Gly Ala Gly Thr Ala Ala Gly 1 5 10 15 Cys Ala Thr <210> 11 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 11 Cys Gly Ala Ala Ala Thr Cys Gly Gly Thr Ala Gly Ala Cys Gly Cys 1 5 10 15 Thr Ala Cys Gly 20 <210> 12 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 12 Gly Gly Gly Gly Ala Thr Ala Gly Ala Gly Gly Gly Ala Cys Thr Thr 1 5 10 15 Gly Ala Ala Cys 20 <210> 13 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 13 Gly Gly Thr Thr Cys Ala Ala Gly Thr Cys Cys Cys Thr Cys Thr Ala 1 5 10 15 Thr Cys Cys Cys 20 <210> 14 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> primers for PCR analysis <400> 14 Ala Thr Thr Thr Gly Ala Ala Cys Thr Gly Gly Thr Gly Ala Cys Ala 1 5 10 15 Cys Gly Ala Gly 20

Claims (3)

Autoimmune disease, atopic dermatitis, acute or chronic urticaria, bacterial/viral in the elderly containing an Alphitolic acid compound isolated from the extract of Agrimonia corana NAKAI , a native plant native to Korea A pharmaceutical composition for the prophylaxis or treatment of an immune-related disease selected from infection, chronic respiratory infection, chronic urinary tract infection, pressure sores, flu, pneumonia, chickenpox in children, measles, breakthrough rash, hand, foot and mouth disease, rubella, or Crohn's disease. Autoimmune disease, atopic dermatitis, acute or chronic urticaria, bacterial/viral in the elderly containing an Alphitolic acid compound isolated from the extract of Agrimonia corana NAKAI , a native plant native to Korea Health functional food for the prevention or improvement of immune-related diseases selected from infections, chronic respiratory infections, chronic urinary tract infections, bedsores, flu, pneumonia, chickenpox in children, measles, sudden rashes, hand, foot and mouth disease, rubella, or Crohn's disease. 3. The method of claim 2,
The health functional food is a health functional food in the form of powders, granules, tablets, capsules, pills, suspensions, emulsions, syrups, tea bags, leached teas, or health drinks.

Images