WO2022086020A1 - A composition comprising the compounds isolated from an extract of agrimonia coreana nakai as an active ingredient for preventing or treating immune-involved disease and the use thereof - Google Patents

A composition comprising the compounds isolated from an extract of agrimonia coreana nakai as an active ingredient for preventing or treating immune-involved disease and the use thereof Download PDF

Info

Publication number
WO2022086020A1
WO2022086020A1 PCT/KR2021/014021 KR2021014021W WO2022086020A1 WO 2022086020 A1 WO2022086020 A1 WO 2022086020A1 KR 2021014021 W KR2021014021 W KR 2021014021W WO 2022086020 A1 WO2022086020 A1 WO 2022086020A1
Authority
WO
WIPO (PCT)
Prior art keywords
immune
extract
agrimonia
glucuronide
apigenin
Prior art date
Application number
PCT/KR2021/014021
Other languages
French (fr)
Inventor
Woo Kyung Kim
Joo Hyun Nam
Original Assignee
Dongguk University Industry-Academic Cooperation Foundation
Dongguk University Gyeongju Campus Industry Academy Cooperation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210061187A external-priority patent/KR20220052260A/en
Application filed by Dongguk University Industry-Academic Cooperation Foundation, Dongguk University Gyeongju Campus Industry Academy Cooperation Foundation filed Critical Dongguk University Industry-Academic Cooperation Foundation
Publication of WO2022086020A1 publication Critical patent/WO2022086020A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/73—Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/125—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives containing carbohydrate syrups; containing sugars; containing sugar alcohols; containing starch hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/191—Carboxylic acids, e.g. valproic acid having two or more hydroxy groups, e.g. gluconic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system

Definitions

  • the present invention is related to a composition comprising the compound isolated from an extract of Agrimonia coreana NAKAI as an active ingredient for preventing or treating immune-involved disease and the use thereof.
  • the human body has the characteristic of maintaining homeostasis, which also works in the immune system.
  • Immunity refers to a series of bio-defense reactions that occur to foreign substances other than their own components from breaking or threatening their homeostasis.
  • immunodeficiency syndrome A condition in which the immune function is deficient or degraded is called "immune deficiency syndrome” in which the immune response is not properly activated, causing infection by failing to respond properly to foreign substances in the body.
  • Hypersensitivity immune reaction occurs where some immune responses overreact, resulting in an imbalance in the immune system and then the occurrence of an allergic reaction.
  • the disorder in immune regulation occurs with several causes such as imbalance in cellular cytokines, imbalance in the proliferation of T/B cells, and depletion of antioxidants and it can lead to increased release of inflammatory substances, which causes to damage cells or tissues and severed inflammation. Accordingly, the regulation of immune system is very important to prevent and treat any disease (J. Allergy clin. immunol. 9, pp 616, 1993; Immunology. 47, pp 75, 1982).
  • Immunity a biological defense against the forging threated substances to break body homeostasis or pathogen invasion, can be classified into two groups, i.e., (1) nonspecific immunity involving macrophages or natural killer (NK) cells and (2) specific immunity involving T or B cells.
  • NK natural killer
  • Phagocytes such as neutrophiles, monocytes, and macrophages
  • Phagocytes are the first major group of cells in the innate immune response that protects the body from pathogens when pathogens invade the body.
  • Uthaisangsook S Day NK, Bahna SL, Good RA, Haraguchi S. 2002. Innate immunity and its role against infections.
  • macrophages functioning as antigen presenting cells in biological defense after the breakage of epithelial cell barriers, affecting T cells in relation to adaptive immunity.
  • Inflammatory and immune diseases are reported to have the different pathogenesis in principle, for example, the calcium release and depletion from endoplasmic reticulum (ER) occurs due to IP3 reproduced by activation of phospholipase C (PLC) when immune receptors are stimulated. It has been reported that such depletion of the ER calcium reservoir causes a continuous influx of calcium from outside the cell and the intracellular calcium influx occurs through the ORAI1 ion channels, of which molecular properties were identified in 2006 [Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann N Y Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x]
  • ORAI1 The importance of calcium signaling through ORAI1 is reported to be significant in activating the calcineurin-NFAT signaling pathway that causes immune cell activity, so the importance of calcium signaling through ORAI1 has increased comparing with the signal protein targeted by existing immunosuppressors.
  • Stefan Feske Yousang Gwack, Murali Prakriya, Sonal Srikanth, Sven-Holger Puppel, Bogdan Tanasa, Patrick G Hogan, Richard S Lewis, Mark Daly, Anjana Rao A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006 May 11; 441(7090): 179-85. doi: 10.1038/nature04702.
  • ORAI1 allows intracellular calcium signals to act as the top regulator of immune signals, which can create a much stronger immunosuppressant in the development of new drugs, and serious immunodeficiency diseases actually occur in the human body due to the deficiency of ORAI1 ion channels.
  • Agrimonia pilosa is a perennial herbaceous species of the double-leaf plant rose family, distributed throughout Korea, as well as eastern Russia, Mongolia, Europe, Okinawa, Japan, and northeastern China.
  • Agrimonia pilosa is distinguished from Agrimonia coreana NAKAI because it usually does not cover the stem in the shape of a chin-leaf sickle, whereas Agrimonia coreana NAKAI wraps around the stem in the shape of a semicircular or fan.
  • the flowers of Agrimonia pilosa are closely attached to the firing sequence, distinguishing them from whereas Agrimonia coreana NAKAI, which are somewhat sloppy (Korean Bio Resource Information System, https:// www.bris.go.kr)
  • Agrimonia coreana NAKAI a Korean native plant, is a perennial herbaceous species of the rose family, native to South Korea, and has been reported to contain agrimonin, agrimonolide, tannn, saponin etc and agrimonin, among them has been reported to show blood coagulating activity, hypoglycemic activity, anti-pesticide activity etc (Chung B. S et al, Dohaehyangyakdaesajeon, youngrimsa, 2 nd Ed. P636-637, 1998).
  • Korea Patent Publication No. 10-2010-0128770 discloses on "cosmetic composition containing water/ethanol extract of Agrimonia pilosa showing anti-atopic dermatitis” ;
  • Korea Patent Publication No. 10-2012-0126416 discloses on "Composition comprising extract of Agrimonia pilosa having treating or preventing inflammation, allergy or asthma disease” ;
  • Korea Patent Publication No. 10-2012-0003317 discloses on " Composition comprising extract of Agrimonia pilosa for inhibiting the degranulation of mast cell ";
  • Korea Patent Publication No. 2001--0053978 discloses on "anti-irritant cosmetic composition comprising extract of Agrimonia pilosa ": Korea Patent Registration No. 10-1554030 discloses on " cosmetic composition comprising a root extract of Agrimonia pilosa for improving skin trouble” etc.
  • Apigenin 7-glucuronide [Weicheng Hu, Xinfeng Wang, Lei Wu, Ting Shen, Lilian Ji, Xihong Zhao, Chuan-Ling Si, Yunyao Jiang, Gongcheng Wang (2016); Apigenin-7-O- ⁇ -D-glucuronide inhibits LPS-induced inflammation through the inactivation of AP-1 and MAPK signaling pathways in RAW 264.7 macrophages and protects mice against endotoxin shock. Food Funct. 7(2):1002-13.
  • the present inventors have found the potent compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, and the compounds showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2),.
  • inventive compounds isolated from the extract of Agrimonia coreana NAKAI a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.
  • the technical solution to solve the problem of the background art is for the development of the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant for treating or inhibiting effect on various immune involved diseases.
  • the present invention also provides a pharmaceutical composition and a health food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, as an active ingredient in an effective amount to treat and prevent various immune involved diseases.
  • the present invention also provides a use of the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, showing immune-modulating activity.
  • the present invention also provides a method of treating or preventing various immune involved diseases in a mammal comprising administering to said mammal an effective amount of the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, showing immune-modulating activity together with a pharmaceutically acceptable carrier thereof.
  • a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, as an active ingredient in an effective amount to treat and prevent immune involved diseases.
  • the term "the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant " disclosed herein comprises luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), ⁇ ,3 ⁇ -dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol, quercetin etc.
  • Agrimonia coreana NAKAI disclosed herein comprises the aerial part, whole plant, leaf, stem, or root of cultivated or naturally grown plant located in Chung-cheong do province, Jeolla do province, Gyeongsang do province etc in South Korea and commercially available plant, but not intent to limit thereto herein.
  • immune involved diseases comprises "all the disorder of immnuno-modulation” including (a) immune-sensitivity syndrome caused by impaired immune system such as autoimmune diseases, organ rejection, hypersensitivity allergic diseases etc; and (b) immune deficiency syndrome such as the immuno-deficiency syndrome caused by chemotherapy or radiation therapy; or immuno-deficiency syndrome caused by bone marrow transplantation, HIV infection, cancer disease, etc, specifically, (a) immune-sensitivity syndrome such as autoimmune, atopic dermatitis, acute or chronic urticarial; (b) immune deficiency syndrome such as bacterial/viral infections in older adults, chronic respiratory infections, chronic urinary tract infections, bedsores, flu, pneumonia, pox, measles, sudden rash, foot-and-mouth disease, rubella, or Crohn's disease.
  • the inventive compound can be transformed into their pharmaceutically acceptable salt and solvates by the conventional method well known in the art.
  • acid-addition salt thereof formed by a pharmaceutically acceptable free acid thereof is useful and can be prepared by the conventional method.
  • the salts are precipitated by the water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile to prepare acid addition salt thereof and further the mixture of equivalent amount of compound and diluted acid with water or alcohol such as glycol monomethylether, can be heated and subsequently dried by evaporation or filtrated under reduced pressure to obtain dried salt form thereof.
  • organic acid or inorganic acid can be used as a free acid of above-described method.
  • organic acid such as methansulfonic acid, p -toluensulfonic acid, acetic acid, trifluoroacetic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonylic acid, vanillic acid, hydroiodic acid and the like, and inorganic acid such as hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid and the like can be used herein.
  • the pharmaceutically acceptable metal salt form of inventive compounds may be prepared by using base.
  • the alkali metal or alkali-earth metal salt thereof can be prepared by the conventional method, for example, after dissolving the compound in the excess amount of alkali metal hydroxide or alkali-earth metal hydroxide solution, the insoluble salts are filtered and remaining filtrate is subjected to evaporation and drying to obtain the metal salt thereof.
  • sodium, potassium or calcium salt are pharmaceutically suitable and the corresponding silver salt can be prepared by reacting alkali metal salt or alkali-earth metal salt with suitable silver salt such as silver nitrate.
  • the pharmaceutically acceptable salt of the compound comprise all the acidic or basic salt which may be present at the compounds, if it does not indicated specifically herein.
  • the pharmaceutically acceptable salt of the present invention comprise the salt of hydroxyl group such as the sodium, calcium and potassium salt thereof; the salt of amino group such as the hydrogen bromide salt, sulfuric acid salt, hydrogen sulfuric acid salt, phosphate salt, hydrogen phosphate salt, dihydrophosphate salt, acetate salt, succinate salt, citrate salt, tartarate salt, lactate salt, mandelate salt, methanesulfonate (mesylate) salt and p -toluenesulfonate (tosylate) salt etc, which can be prepared by the conventional method well known in the art.
  • the compounds of the present invention comprise all the optically active isomers, R or S stereoisomers and the mixtures thereof.
  • Present invention also comprises all the uses of racemic mixture, more than one optically active isomer or the mixtures thereof as well as all the preparation or isolation method of the diastereomer well known in the art.
  • inventive compounds may be prepared from Agrimonia coreana NAKAI, a Korean native plant, by following procedure:
  • inventive compounds is characterized by being prepared by the process of;
  • pharmaceutically acceptable carriers or excipients comprises “pharmaceutical additives, the inactive ingredients used to make up a medication. They include dyes, flavors, binders, emollients, fillers, lubricants, preservatives, and many more classifications. Common excipients include cornstarch, lactose, talc, magnesium stearate, sucrose, gelatin, calcium stearate, silicon dioxide, shellac and glaze, which has been well-known in the art ( See , Home-page of Food and Drug Administration: www.fda.gov or drug information online: www.drugs.com) or previous literature (for example, Rowe, Raymond C et al. , Handbook of Pharmaceutical Excipients, Pharmaceutical Press, 7th Edition, 2012)
  • the present invention also provides a method for preparing inventive compounds isolated from the extract of Agrimonia coreana NAKAI comprising the steps of; adding at least one extracting solvent selected from water, spirit, C1-C4 lower alcohol such as methanol, ethanol, butanol etc or the mixtures thereof, preferably, mixture of water and ethanol or spirit , more preferably, 30-80(w/w) ethanol or spirit in water to the dried aerial part, whole plant, leaf, stem, or root of cultivated or naturally grown of Agrimonia coreana NAKAI, a Korean native plant, located in Chung-cheong do province, Jeolla do province, Gyeongsang do province etc at the 1st step; subjecting to at least one extraction method selected from reflux extraction with hot water, cold water extraction, ultra-sonication or conventional extraction, preferably reflux extraction at the temperature ranging from 10 to 100°C, preferably from 20 to 90°C, for the period ranging from 30 mins to 72 hours,
  • the term "further purification process” is selected from (i) reverse phase partition chromatography, (ii) normal phase partition chromatography, (iii) ion exchange chromatography or (iv) size exclusion chromatography, preferably, reverse phase partition chromatography or any chromatography using by any resin as a stationary phase which can retain non-polar substance while eluting polar substance, for example, Sephadex resin such as Sephadex, Sephadex LH20, Sephadex G-25, Sephadex G-10, Sepharose, Superdex, methylacrylate resin, carboxymethyl cellulose, sulphopropyl cellulose, carboxymethyl Sephadex, sulphopropyl Sephadex, carboxymethyl Sepharose, sulphopropyl Sepharose and the like; reverse polymer resin using by Stylene-divinylbenzen co-polymer such as Polymer X, HP20, PRP-h1 Polymer and the like or Methacrylate support resin etc; normal Silica gel
  • the "stationary phase in the above-described reverse phase partition chromatography” may be any stationary phases such as reverse phase substance as a stationary phase which can retain non-polar substance while eluting polar substance, preferably, Silica gel based stationary phase, polymer based stationary phase such as polystyrene etc and the like, more preferably, Silica gel derivatives such as C2, C4, C6, C8, C10, C12, 14, C16, C18 and the like; or a polymer based stationary phase such as PS-2, Oasis HLB and the like, more and more preferably, reverse phase Silica gel (C18(IV)-D), ODS-A/ODS-AQ product from YMC Co.
  • any stationary phases such as reverse phase substance as a stationary phase which can retain non-polar substance while eluting polar substance
  • Silica gel based stationary phase polymer based stationary phase such as polystyrene etc and the like
  • Silica gel derivatives such as C2, C4, C6, C8, C10, C12,
  • the "mobile phase in the above-described (i) reverse phase partition chromatography” may be at least one solvent selected from water, acetonitrile, lower alcohol such as methanol, ethanol, butanol etc, tetrahydrofuran (THF) or the mixture thereof, preferably, water, lower alcohol such as methanol, ethanol, butanol etc, or the mixture thereof, more preferably, the mixture solvent of water and methanol, more and more preferably, the mixture solvent of water and methanol with starting from 90:10(v/v) to 60:40(v/v) to elute polar substance.
  • lower alcohol such as methanol, ethanol, butanol etc, tetrahydrofuran (THF) or the mixture thereof
  • water, lower alcohol such as methanol, ethanol, butanol etc, or the mixture thereof
  • the mixture solvent of water and methanol more and more preferably, the mixture solvent of water and methanol with starting from 90:10(v/v) to 60
  • the "stationary phase in the above-described normal phase partition chromatography” may be any stationary phases such as normal phase substance as a stationary phase which can retain polar substance while eluting non-polar substance, preferably, Silica gel, Fluorosyl, or alumina based stationary phase, CN, Diol, or NH2 moiey polymer based stationary phase and the like, more preferably, Silica gel, Fluorosyl, or alumina based stationary phase, etc.
  • the "mobile phase in the above-described (ii) normal phase partition chromatography” may be at least one solvent selected from hexane, heptane, ethylacetate, ethanol, diethylether, 2-propanol or the mixture thereof, preferably, hexane, heptane, ethylacetate or the mixture thereof to elute non-polar substance.
  • the "stationary phase in the above-described (iii) ion exchange chromatography” may be any high molecular stationary phases as a stationary phase which have charged cross-linking moiety, preferably, cation exchange resin, anion exchange resin, or synthetic adsorbent, and the like, more preferably, strongly acidic cation exchange resin such as AG 50W-x8, Amberlite IR-120, Dowex 60W-x8, SKIB etc; weakly acidic cation exchange resin such as Amberlite IRA-67, Dowex 3-x4A etc; strongly basic cation exchange resin such as DIAION SKIB, DIAION PK216, DIAION CR20, DIAION UBK555 (Mitsubishi Chemical Co.), TRILITE SPC 160H, TRILITE SPC 180H, TRILITE SPC 400JH (Samyang Co.
  • the resin having similar property thereto such as Toyopearl QEA (Tosoh Co. Ltd.), Q Sepharose FF (GE Healthcare Co. Ltd.), Fractogel EMD, Fractogel TMAE, Fractogel HICAP (Merck KGaA Co. Ltd or Darmstadt Co. Ltd.); more and more preferably, SA21A; adsorbent such as SP207, HP20SS, HP20 etc, more preferably, HP 20.
  • the "stationary phase in the above-described (iv) size exclusion chromatography” may be any gel type stationary phases as a stationary phase which can separate by the size of sample, preferably, dextran-based gel such as sephadex (for example, sephadex G-25), polyacrylamide-based gel such as Sephacryl (for example, Sephacryl-S400), Agarose-based gel such as Superose or Sepharose (for example, Sepharose CL-4B) or the combinations thereof such as Superdex 200 combination Dextran (For example, Sephadex TM ), or cross-linked Agarose gel (Superose TM ) and the like, however it shall be not limited thereto herein.
  • dextran-based gel such as sephadex (for example, sephadex G-25), polyacrylamide-based gel such as Sephacryl (for example, Sephacryl-S400), Agarose-based gel such as Superose or Sepharose (for example, Sepharose CL-4B) or the combinations thereof such
  • the “mobile phase in the above-described (iv) size exclusion chromatography” may be buffer solution selected from the group consisting of sodium acetate buffer, sodium phosphate buffer, ammonium acetate buffer, MES (2-(N-morpholino)ethanesulphonic acid), Bis-Tris[2-Bis(2-hydroxyethyl)amino-2-(hydroxymethyl)-1,3-propandiol], ADA [N-(2-acetamido)iminodiacetate), PIPES [piperaxine-N,N'-Bis(2-ethanesulophonic acid)], BES [N.N'-Bis(2-hydroxyethyl)-2-aminoethansulphonic acid), MOPS [3-(N-morpholino)propansulphonic acid)], TES (N-Tris(hydroxymethyl)methyl-2-aminoethanesulphonic acid], HEPES [N-2-hydroxyethyl-piperazine-N'-2-ethanesulphonic acid),
  • the present invention can also perform (v) Gel permeation chromatography or Gel filtration chromatography in addition to (i) reverse phase partition chromatography, (ii) normal phase partition chromatography, (iii) ion exchange chromatography, (iv) size exclusion chromatography or the combination thereof, as a further purification process disclosed herein.
  • prevent comprises any act to inhibit or postpone the occurrence of certain disease or disorder disclosed herein by way of administrating the inventive composition; and the term “treat” disclosed herein comprises any act to alleviate or favorably changing the symptom associated with certain disease or disorder disclosed herein by way of administrating the inventive composition.
  • inventive compounds isolated from the extract of Agrimonia coreana NAKAI a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.
  • present invention provide a pharmaceutical composition
  • a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, as an active ingredient in an effective amount to treat and prevent immune involved diseases.
  • Present invention provide a pharmaceutical composition
  • a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, as an active ingredient and the pharmaceutically acceptable carriers or excipients, for the treatment and prevention of immune involved diseases.
  • pharmaceutically acceptable carriers or excipients comprises “pharmaceutical additives, the inactive ingredients used to make up a medication. They include dyes, flavors, binders, emollients, fillers, lubricants, preservatives, and many more classifications.
  • a method of treating or preventing immune involved diseases in mammals comprising administering a therapeutically effective amount of the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, into the mammal suffering from immune involved diseases.
  • the inventive composition for treating and preventing immune involved diseases may comprises above extracts as 0.1 ⁇ 99%, preferably, 0.1 ⁇ 50% by weight based on the total weight of the composition.
  • composition according to the present invention can be provided as a pharmaceutical composition containing pharmaceutically acceptable carriers, adjuvants or diluents, e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil.
  • pharmaceutically acceptable carriers e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl
  • the formulations may additionally include fillers, anti-agglutinating agents, lubricating agents, wetting agents, flavoring agents, emulsifiers, preservatives and the like.
  • the compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after their administration to a patient by employing any of the procedures well known in the art.
  • compositions of the present invention can be dissolved in oils, propylene glycol or other solvents that are commonly used to produce an injection.
  • suitable examples of the carriers include physiological saline, polyethylene glycol, ethanol, vegetable oils, isopropyl myristate, etc., but are not limited to them.
  • the extract of the present invention can be formulated in the form of ointments and creams.
  • compositions containing present composition may be prepared in any form, such as oral dosage form (powder, tablet, capsule, soft capsule, aqueous medicine, syrup, elixirs pill, powder, sachet, granule), or topical preparation (cream, ointment, lotion, gel, balm, patch, paste, spray solution, aerosol and the like), or injectable preparation (solution, suspension, emulsion).
  • oral dosage form prowder, tablet, capsule, soft capsule, aqueous medicine, syrup, elixirs pill, powder, sachet, granule
  • topical preparation cream, ointment, lotion, gel, balm, patch, paste, spray solution, aerosol and the like
  • injectable preparation solution, suspension, emulsion
  • composition of the present invention in pharmaceutical dosage forms may be used in the form of their pharmaceutically acceptable salts, and also may be used alone or in appropriate association, as well as in combination with other pharmaceutically active compounds.
  • the desirable dose of the inventive extract varies depending on the condition and the weight of the subject, severity, drug form, route and period of administration, and may be chosen by those skilled in the art. However, in order to obtain desirable effects, it is generally recommended to administer at the amount ranging from 0.0001 to 1000mg/kg, preferably, 0.001 to 100mg/kg by weight/day of the inventive extract of the present invention.
  • the dose may be administered in single or divided into several times per day.
  • composition of present invention can be administered to a subject animal such as mammals (rat, mouse, domestic animals or human) via various routes. All modes of administration are contemplated, for example, administration can be made orally, rectally or by intravenous, intramuscular, subcutaneous, intracutaneous, intrathecal, epidural or intracerebroventricular injection.
  • inventive compounds/extract of the present invention also can be used as a main component or additive and aiding agent in the preparation of various functional health food and health care food.
  • a health functional food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant,for the prevention or alleviation of immune involved diseases.
  • a functional health food defined herein the functional food having enhanced functionality such as physical functionality or physiological functionality by adding the extract of the present invention to conventional food to prevent or improve the purposed diseases in human or mammal.
  • a health care food defined herein "the food containing the compound/extract of the present invention showing no specific intended effect but general intended effect in a small amount of quantity as a form of additive or in a whole amount of quantity as a form of powder, granule, capsule, pill, tablet etc.
  • a sitologically acceptable additive comprises "any substance the intended use which results or may reasonably be expected to result-directly or indirectly-in its becoming a component or otherwise affecting the characteristics of any food", and can be classified into three groups according to its origin, i.e., (1) chemically synthetic additive such as ketones, glycine, potassium citrate, nicotinic acid, etc; (2) natural additive such as persimmon dye, licorice extract, crystalline cellulose, gua dum etc; (3) the mixed additive therewith such as sodium L-glutamate, preservatives, tar dye etc, or various categories according to its function in the food, for example, thickening agent, maturing agent, bleaching agent, sequestrant, humectant, anti-caking agent, clarifying agents, curing agent, emulsifier, stabilizer, thickener, bases and acid, foaming agents, nutrients, coloring agent, flavoring agent, sweetener, preservative agent, anti-oxidant, etc, which has been well-known
  • direct additive a substance that becomes part of the food in trace amounts due to its packaging, storage or other handling.
  • health care foods or health functional foods can be contained in food, health beverage, dietary supplement etc, and may be formulated into a form of pharmaceutically dosing form such as a powder, granule, tablet, suspension, emulsion, syrup, chewing tablet, capsule, beverage etc; or the food form, for example, bread, rice cake, dry fruit, candy, chocolate, chewing gum, ice cream, milk such as low-fat milk, lactose-hydrolyzed milk, goat-milk, processed milk, milk product such as fermented milk, butter, concentrated milk, milk cream, butter oil, natural cheese, processed cheese, dry milk, milk serum etc, processed meat product such as hamburger, ham, sausage, bacon etc, processed egg product, fish meat product such as fish cake etc, noodle products such as instant noodles, dried noodles, wet noodles, fried noodles, non-fried noodles, gelatinized dry noodles, cooked noodles, frozen noodles, Pasta etc, tea product such as tea bag, leached tea etc, health drinks such as fruit drinks, vegetable drinks,
  • above described compound/extract can be added to food or beverage for prevention and improvement of purposed disorder.
  • the amount of above described extract in food or beverage as a functional health food or health care food may generally range from about 0.01 to 100 w/w % of total weight of food for functional health food composition.
  • the preferable amount of the extract of the present invention in the functional health food, health care food or special nutrient food may be varied in accordance to the intended purpose of each food, it is preferably used in general to use as an additive in the amount of the extract of the present invention ranging from about 0.01 to 5% in food such as noodles and the like, from 40 to 100% in health care food on the ratio of 100% of the food composition.
  • the health beverage composition of present invention contains above described extract or compound as an essential component in the indicated ratio
  • the other component can be various deodorant or natural carbohydrate etc such as conventional beverage.
  • natural carbohydrate are monosaccharide such as glucose, fructose etc; disaccharide such as maltose, sucrose etc; conventional sugar such as dextrin, cyclodextrin; and sugar alcohol such as xylitol, and erythritol etc.
  • natural deodorant such as taumatin, stevia extract such as levaudioside A, glycyrrhizin et al., and synthetic deodorant such as saccharin, aspartame et al.
  • the amount of above described natural carbohydrate is generally ranges from about 1 to 20 g, preferably 5 to 12 g in the ratio of 100 ml of present beverage composition.
  • the other components than aforementioned composition are various nutrients, a vitamin, a mineral or an electrolyte, synthetic flavoring agent, a coloring agent and improving agent in case of cheese, chocolate et al., pectic acid and the salt thereof, alginic acid and the salt thereof, organic acid, protective colloidal adhesive, pH controlling agent, stabilizer, a preservative, glycerin, alcohol, carbonizing agent used in carbonate beverage et al.
  • the other component than aforementioned ones may be fruit juice for preparing natural fruit juice, fruit juice beverage and vegetable beverage, wherein the component can be used independently or in combination.
  • the ratio of the components is not so important but is generally range from about 0 to 20 w/w % per 100 w/w % present composition.
  • Examples of addable food comprising aforementioned extract or compound therein are various food, beverage, gum, vitamin complex, health improving food and the like.
  • Inventive extract of the present invention has no toxicity and adverse effect therefore; they can be used with safe.
  • inventive compounds isolated from the extract of Agrimonia coreana NAKAI a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases
  • Fig. 1 shows the inhibitory effect of the APC-311, Luteolin 7-gluruconid, Apigenin 7-glucuronide on the proliferation of CD4+ T cell;
  • Fig. 2 presents the inhibitory effect of the 8 compounds isolated from Agrimonia coreana NAKAI prepared in Example on ORAI1.
  • Fig. 1 shows the inhibitory effect of the APC-311, Luteolin 7-gluruconid, Apigenin 7-glucuronide on the proliferation of CD4+ T cell;
  • Fig. 2 presents the inhibitory effect of the 8 compounds isolated from Agrimonia coreana NAKAI prepared in Example on ORAI1.
  • test sample 100g was poured to mortar and pulverized to be very fine powder using liquid nitrogen for DNA extraction.
  • the dried powder was transferred to 2ml of tube and 500 ⁇ L of lysis buffer (K-3021, BIONEER Corp.,Korea), 20 mM Tris-HCl (pH 8.0), 2 mM sodium EEDTA, 1.2% Triton X-100, 20 mg/mL of lysozyme and 10 ⁇ L of proteinase K solution (K-3031, BIONEER Corp.,Korea, more than 600 mAU/mL) were added thereto to mix thoroughly and reacted together for 1 hour at 37 °C in pyrostat (BS-31, Vison Lab Science Co. Ltd, Korea).
  • lysis buffer K-3021, BIONEER Corp.,Korea
  • 20 mM Tris-HCl pH 8.0
  • 2 mM sodium EEDTA 1.2% Triton X-100
  • 20 mg/mL of lysozyme 20 mg/mL of lysozyme and 10 ⁇ L of proteinase K solution (K-3031, BIONEER
  • CTAB cetyl trimethylammonium bromide buffer solution
  • C2007 Biosesang Co. Ltd. Korea
  • 0.1M Tris pH 8.0
  • 2% hexadecyltrimethylammonium bromide 0.2% 2-mercaptoethanol
  • the precipitated DNA was washed with 500 ⁇ L of 70% ethanol three times and left alone to dry purified DNA at room temperature.
  • the purified DNA was dissolved in 20 - 30 ⁇ L of sterilized triple distilled water to left alone for 1 hour at 4 °C and 2 ⁇ L of RNase enzyme (100mg/mL, 7,000 units/mL, K-3031, BIONEER Corp., Korea) was added thereto to react together for 30 mins at 37°C. ,
  • DNA was stained with staining agent (EtBr: Ethidium Bromide, E1510, Sigma-Aldrich Co. Ltd.) and the purity and content of DNA were determined using by UV spectrophotometer (Nanodrop, USA) under UV light (Absorbance: 260nm and 280 nm, Gel Doc XR, Bio-RAD) to DNA quantification.
  • staining agent EtBr: Ethidium Bromide, E1510, Sigma-Aldrich Co. Ltd.
  • the DNA barcode primers shown in Table 1 was used in the experiment and the specific DNA barcode for Agrimonia coreana NAKAI was developed by comparing with barcode information listed in GenBank DB.
  • the mixture of 2 ⁇ L of forward primer (10pmole/ ⁇ L ), 2 ⁇ L of reverse primer (10pmole/ ⁇ L ) and 20ng/ ⁇ L of fixed quantity of stranded DNA was mixed with PCR premix (K-2115, Bioneer Corp., Korea) and added with distilled water to the extent that the final reaction volume has reached to be 30 ⁇ L.
  • the isolated DNA was amplified by PCR [(pre-denaturation at 95°C for 5min, denaturation at 95°C for 45sec, annealing at 55°C for 45sec and extension at 72°C for 1 min.) ⁇ 35 cycles and final-extension at 72°C for 5mins] to afford the amplified DNA product.
  • the PCR product prepared from the above-step was purified to be used for performing following DNA barcode sequencing analysis.
  • the analyzed DNA sequence of each sample by each DNA barcode was aligned by multiple alignment method according to Bioedit program (version 7.0.5.3 Tom Hall Ibis Biosciences, USA) as well as Clustal method (D Thompson, DG Higgins, TJ Gibson. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994 Nov. 11;22(22):4673-80).
  • the analyzed DNA sequence of each sample by each DNA barcode was analyzed by comparing with 7 barcode region of Chloroplast DNA (cpDNA) of sample. i.e. matK, rbcL, atpF-atpH, psbA-trnH, psbK-psbI, trnL-intron, trnL-trnF.
  • cpDNA Chloroplast DNA
  • Example 2 The preparation of active compounds ( APH13211, APH13212 )
  • Example 1 1kg of dried leaf of Agrimonia coreana NAKAI of which species has been identified in Example 1 was cut into small pieces and mixed with 20 fold volume of 70% ethanol(v/w). The mixture was extracted with reflux extraction at 70°C for 4 hours to collect the filtrate, three times. The extract was filtered with filtration apparatus (R5PPMF01ES, Kajika Co.,) to remove the debris, five times. The collected filtrate was concentrated by rotary vacuum evaporator (Buchi, Ratavapor, R-300) at 55 ⁇ 65°C under reduced pressure and dried with freezing dryer to obtain 460g of dried crude extract (designated as 'APE" hereinafter).
  • rotary vacuum evaporator Buchi, Ratavapor, R-300
  • Example 2-1 The crude extract (APE) preppared in Example 2-1, was performed to successive fractionation with the identical volume of hexane and ethylacetate to afford 3 fractions (hexane fraction, ethylacetate fraction and water fraction) to be analyzed on HPLC with HPLC condition as shown in Table 2.
  • the water fraction showing the most potent activity was adsorbed on highly porous styrene non-polar adsorbent (Diaion HP20) as a stationary phase and eluted with three eluting solvents, i. e, 3L of 30%, 70% and 100% methanol, successively.
  • the resulting 3 purified fractions HP-pass, HP-30M and HP70M were performed to HPLC analysis.
  • the MPLC-1 fraction was performed to the 1 st Sephadex LH-20 column chromatography eluting with 70% methanol to afford 10 sub-fractions, i. e, LH-1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 and to be analyzed on HPLC.
  • the LH-3 sub-fraction among them was concentrated was performed to the 2 nd Sephadex LH-20 column chromatography eluting with 50% methanol to afford 5 sub-fractions, i.e, Fr. I, II, III, IV and V and to be analyzed on HPLC.
  • HPLC condition (APH13211, APH13212) HPLC analysis condition Apparatus HITACHI Chromaster, HITACHI , Japan Analysis condition Column TSK-gel 100V (4.6 mm ⁇ 250 mm, 5 ⁇ m), TOSOH, Japan Column Temperature 25 °C Mobile phase A : 5% MeOH (0.04% TFA) B : MeOH Gradient Time Mobile phase A (%) Mobile phase B (%) 0 90 10 2 90 10 20 0 100 22 0 100 23 90 10 26 90 10 Injection volume 10 ⁇ l Flow rate 1ml/min
  • APH13211 was identified as Luteolin 7-glucuronide showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Tsukasa Iwashina and Hiroaki Setoguchi et al. Flavonoids from the Leaves of Vitex rotundifolia (Verbenaceae), and their Qualitative and Quantitative Comparison between Coastal and Inland Populations. Bull. Natl. Mus. Nat. Sci., Ser. B, 37(2), pp. 87-94.; Ufuk Ozgen et al. A New Sulfated ⁇ -Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)
  • APH13212 was identified as Apigenin 7-glucuronide ) showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Hui-Ling Cheng and Li-Jie et al. Antiinflammatory and Antioxidant Flavonoids and Phenols from Cardiospermum halicacabum ( ⁇ Dao Di Ling). J Tradit Complement Med. 2013 Jan-Mar; 3(1): 33-40; Ufuk Ozgen et al. A New Sulfated ⁇ -Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)
  • Example 3 The preparation of active compounds ( APC-311, APC-312 )
  • Example 1 1kg of dried leaf of Agrimonia coreana NAKAI of which species has been identified in Example 1 was cut into small pieces and mixed with 20 fold volume of 70% ethanol(v/w). The mixture was extracted with reflux extraction at 70°C for 4 hours to collect the filtrate, three times. The extract was filtered with filtration apparatus (R5PPMF01ES, Kajika Co.,) to remove the debris, five times. The collected filtrate was concentrated by rotary vacuum evaporator (Buchi, Ratavapor, R-300) at 55 ⁇ 65°C under reduced pressure and dried with freezing dryer to obtain 460g of dried crude extract (designated as 'APE" hereinafter).
  • rotary vacuum evaporator Buchi, Ratavapor, R-300
  • the crude extract (APE) prepared in Example 3-1 was performed to successive fractionation with the identical volume of hexane and chloroform to afford 3 fractions (hexane fraction, chloroform fraction and water fraction) to be analyzed on HPLC with HPLC condition as shown in Table 2.
  • the chloroform fraction showing the most potent activity was performed to Silica gel column chromatography eluting with eluting solvents (hexane: ethylacetate: 10:1 ⁇ 0:1, v/v) to afford 7 fractions (AP-C-1, 2, 3, 4, 5, 6 and 7) through TLC analysis (developing solvents: hexane: ethylacetate: 1:1, v/v).
  • Fr.32-38 fraction showing the abundant amount of active ingredients among them, was concentrated was performed to the 2 nd Sephadex LH-20 column chromatography to isolate further purified 2 sub-fractions and then to be grouped,5 sub-groups, i.e, APC3-1, APC3-2, APC3-3, APC3-4 and APC3-5through TLC analysis (developing solvents: hexane: ethylacetate: 1:1, v/v).
  • the MPLC-3 showing the most potent activity among them was concentrated and performed again to preparative HPLC (ODS column, 70 ⁇ 100% aq. acetonitrile, 1 ml/min) to afford APC-311 compound (2.8mg) and APC-312 compound (4.5mg).
  • HPLC condition (APC-311 compound and APC-312) HPLC analysis condition Analysis HITACHI Chromaster, HITACHI , Japan Analysis condition Column TSK-gel 100V (4.6 mm ⁇ 250 mm, 5 ⁇ m), TOSOH, Japan Column Temperature 25 °C Mobile phase A : 3rd distilled water B : Acetonitrile Gradient Time Mobile phase A (%) Mobile phase B (%) 0 30 70 2 30 70 20 0 100 26 0 100 27 30 70 30 30 70 Injection volume 10 ⁇ l Flow rate 1ml/min
  • APC-311 and APC-312 prepared in the above, the compounds were dissolved in CD 3 OD to determine 1 H- NMR and 13 C- NMR (JEOL JNM-ECA600 600MHz FT-NMR spectrometer, JAPAN).
  • APC-311 was identified as Alphitolic acid showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Bae G.W et al., isolation of betulic acid and alphitolic acid from Ziziphus jujuba var. inermis , Archives of Pharmacal Research , 40(4), pp558-562, 1998; Sang-Myung Lee et al. Anti-complementary Activity of Triterpenoides from Fruits of Zizyphus jujuba. Biol. Pharm. Bull. 27(11) 1883-1886 (2004); Somin Park et al. Expedient Synthesis of Alphitolic Acid and Its Naturally Occurring 2-O-Ester Derivatives. J. Nat. Prod. 2019, 82, 895-902.
  • APC-312 was identified as 2 ⁇ ,3 ⁇ -dihydroxyolean-13(18)-en-28-oic acid showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature.
  • PBMC peripheral blood mononuclear cell
  • T cell which had been used in the various immunological analysis, were prepared from human blood using Fiicoll (GE17-5442-02, GE Healthcare) according to the previous literature (BIOPRESERVATION AND BIOBANKING, Volume 14, Number 5, 2016).
  • CD4+ T cell was carefully isolated from the isolated PBMC using by T cell isolation kit (130-096-533, Miltenyi biotec.) according to the manufacture's manual instruction.
  • the anti-immunological effect on T cell was evaluated by the inhibition effect on the proliferation of CD4+ T cell.
  • CFSE Carboxyfluorescein diacetate succinimidyl ester, C34570, ThermoFisher Scientific
  • DPBS Dulbecco's Phosphate-Buffered Saline, LB 001-01, welgene
  • the stained T cells with CFSE were inoculated into 96 well plates (2 x 10 5 cells/well) and stimulated with anti-CD3 and anti-CD 28.
  • the compounds in DMSO were inoculated into the well plate to be 100 ⁇ g/mL with the stimuli of anti-CD3 and anti-CD 28.
  • the T cell treated with test sample was incubated at 37°C for 72 hours in 5% CO2 incubator (MCO-18AC, Panasonic) and then the cell was collected to be analyzed using Flow cytometry (BD LSRFortessa, BD Biosciences).
  • ORAI1 ion channel which can increase the cellular calcium signaling pathway, an important pathway to induce the proliferation of T cell.
  • the extracellular fluid for patch clamp analysis was prepared to contain 135mM NaCl, 3.6mM KCl, 1mM MgCl2, 10mM CaCl2, 5mM D-glucose, 10mM HEPES(H3375, Sigma) and adjusted to pH 7.4 with NaOH.
  • the intracellular fluid for patch clamp analysis was prepared to contain 130mM Cs-glutamate, 20mM BAPTA, 1mM MgCl2, 3mM MgATP, 0.002mM sodium pyruvate, 20mM HEPES (H3375, Sigma) and adjusted to pH 7.2 with CsOH (C8518, Sigma).
  • the ORAI1 electric current was determined by using Axopatch 200B amplifier (Axon Axopatch 200B Microelectrode Amplifier, Molecular Devices) and Digidata 1440A(Axon digidata 1440A, Molecular Devices) and the data was analyzed by pClamp10.4(pClamp10.4, Molecular Devices).
  • the ramp-pulse for recording electric current was changed to -130mV ⁇ 50mV for 100msec and the voltage of cellular membrane was fixed to -10mM to record every 20 seconds, repeatedly.
  • APH13211 compound 100mg
  • Injection preparation was prepared by dissolving active component, controlling pH to about 7.5 and then filling all the components in 2ml ample and sterilizing by conventional injection preparation method.
  • APH13212 compound 500mg
  • Powder preparation was prepared by mixing above components and filling sealed package.
  • APH-311 compound 200mg
  • Tablet preparation was prepared by mixing above components and entabletting.
  • APH-312 compound 100mg
  • Lactose 50mg
  • Tablet preparation was prepared by mixing above components and filling gelatin capsule by conventional gelatin preparation method.
  • APH13211 compound 1000mg
  • Liquid preparation was prepared by dissolving active component, and then filling all the components in 1000ml ample and sterilizing by conventional liquid preparation method.
  • APH13212 compound 1000mg
  • Vitamin mixture optimum amount
  • Vitamin E 1.0mg
  • Vitamin B 10 13mg
  • Vitamin B 2 0.15mg
  • Vitamin B6 0.5mg
  • Vitamin B1 20.2g
  • Vitamin C 10mg
  • Zinc oxide 0.82mg
  • APH-311 compound 1000mg
  • Citric acid 1000mg
  • Health beverage preparation was prepared by dissolving active component, mixing, stirred at 85 o C for 1 hour, filtered and then filling all the components in 1000ml ample and sterilizing by conventional health beverage preparation method.
  • the inventive compounds isolated from the extract of Agrimonia coreana NAKAI showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Polymers & Plastics (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

The present invention relates to composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, to treat and prevent immune involved diseases and the inventive compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.

Description

[Rectified under Rule 91, 08.02.2022] A COMPOSITION COMPRISING THE COMPOUNDS ISOLATED FROM AN EXTRACT OF AGRIMONIA COREANA NAKAI AS AN ACTIVE INGREDIENT FOR PREVENTING OR TREATING IMMUNE-INVOLVED DISEASE AND THE USE THEREOF
The present invention is related to a composition comprising the compound isolated from an extract of Agrimonia coreana NAKAI as an active ingredient for preventing or treating immune-involved disease and the use thereof.
The human body has the characteristic of maintaining homeostasis, which also works in the immune system.
Immunity refers to a series of bio-defense reactions that occur to foreign substances other than their own components from breaking or threatening their homeostasis.
All immune actions, including inflammatory responses, activated by the infiltration of pathogens into the body, return to normal status after removal of the pathogen, but if immune control is difficult, the immune response is significantly higher or lower than normal people.
A condition in which the immune function is deficient or degraded is called "immune deficiency syndrome" in which the immune response is not properly activated, causing infection by failing to respond properly to foreign substances in the body. On the contrary, " Hypersensitivity immune reaction" occurs where some immune responses overreact, resulting in an imbalance in the immune system and then the occurrence of an allergic reaction. (Immunology. 49, 1992; Dig dis Sci. 52, pp 1890-1896, 2007; J Life Sci. 19, pp 479-485, 2009; Biol Pharm Bull. 27, pp 617-620, 2004).
If the immune system is not properly regulated and imbalanced, the disorder in immune regulation occurs with several causes such as imbalance in cellular cytokines, imbalance in the proliferation of T/B cells, and depletion of antioxidants and it can lead to increased release of inflammatory substances, which causes to damage cells or tissues and severed inflammation. Accordingly, the regulation of immune system is very important to prevent and treat any disease (J. Allergy clin. immunol. 9, pp 616, 1993; Immunology. 47, pp 75, 1982).
An acute new infectious diseases such as acute respiratory syndrome, SARS, bird flu, and Ebola virus have emerged worldwide since 2000, the importance of immunity against the pathogens has been highlighted.
Immunity, a biological defense against the forging threated substances to break body homeostasis or pathogen invasion, can be classified into two groups, i.e., (1) nonspecific immunity involving macrophages or natural killer (NK) cells and (2) specific immunity involving T or B cells. (1. A-Reum Yu, Ho-Young Park, Yun-Sook Kim, Sang-Keun Ha, Hee-Do Hong, Hee-Don Choi. 2012. Immuno-enhancing Effect of Seed Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(12): 1671-1676).
Phagocytes, such as neutrophiles, monocytes, and macrophages, are the first major group of cells in the innate immune response that protects the body from pathogens when pathogens invade the body. (Uthaisangsook S, Day NK, Bahna SL, Good RA, Haraguchi S. 2002. Innate immunity and its role against infections. Ann. Allergy Asthma Immunol. 88: 253-264). In particular, macrophages functioning as antigen presenting cells in biological defense after the breakage of epithelial cell barriers, affecting T cells in relation to adaptive immunity. (3. Birk RW, Gratchev A, Hakiy N, Politz O, Schledzewski K, Guillot P, Orfanos CE, Goerdt S. 2001. Alternative activation of antigen-presenting cells: concepts and clinical relevance. Hautarzt 52: 193-200). It also removes pathogen-infected cells, cancer cells etc, and secretes various cytokines such as nitric oxide (NO) and tumor necrosis factor-α (TNF-α), which contribute to the immune response. (4Seon A Yoo, Ok Kyung Kim, Da-Eun Nam, Yongjae Kim, Humyoung Baek, Woojin Jun, Jeongmin Lee. 2014. Immunomodulatory Effects of Fermented Curcuma longa L. Extracts on RAW 264.7 Cells. J Korean Soc Food Sci Nutr 43(2): 216-243).
There have been several reports to develop the effective natural substances functioning as an activating factor of macrophages responsible for innate immune functions that can respond to diseases before the body's adaptive immunity works. (5.A-Reum Yu, Ho-Young Park, In-Wook Choi, Yong-Kon Park, Hee-Do Hong, Hee-Don Choi. 2012. Immune Enhancing Effect of Medicinal Herb Extracts on a RAW 264.7 Macrophage Cell Line. J Korean Soc Food Sci Nutr 41(11): 1521-1527).
Inflammatory and immune diseases are reported to have the different pathogenesis in principle, for example, the calcium release and depletion from endoplasmic reticulum (ER) occurs due to IP3 reproduced by activation of phospholipase C (PLC) when immune receptors are stimulated. It has been reported that such depletion of the ER calcium reservoir causes a continuous influx of calcium from outside the cell and the intracellular calcium influx occurs through the ORAI1 ion channels, of which molecular properties were identified in 2006 [Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann N Y Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x]
The importance of calcium signaling through ORAI1 is reported to be significant in activating the calcineurin-NFAT signaling pathway that causes immune cell activity, so the importance of calcium signaling through ORAI1 has increased comparing with the signal protein targeted by existing immunosuppressors. (Stefan Feske, Yousang Gwack, Murali Prakriya, Sonal Srikanth, Sven-Holger Puppel, Bogdan Tanasa, Patrick G Hogan, Richard S Lewis, Mark Daly, Anjana Rao A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature 2006 May 11; 441(7090): 179-85. doi: 10.1038/nature04702.]
Accordingly, it has been reported that ORAI1 allows intracellular calcium signals to act as the top regulator of immune signals, which can create a much stronger immunosuppressant in the development of new drugs, and serious immunodeficiency diseases actually occur in the human body due to the deficiency of ORAI1 ion channels. (Stefan Feske Immunodeficiency due to defects in store-operated calcium entry Ann N Y Acad Sci. 2011 Nov; 1238: 74-90. doi: 10.1111/j.1749-6632.2011.06240.x, / Christie-Ann McCarl, Capucine Picard, Sara Khalil, Takumi Kawasaki, Jens R ther, Alexander Papolos, Jeffery Kutok, Claire Hivroz, Francoise LeDeist, Katrin Plogmann, Stephan Ehl, Gundula Notheis, Michael H. Albert, Bernd H. Belohradsky, Janbernd Kirschner, Anjana Rao, Alain Fisched,Stefan Feske ORAI1 deficiency and lack of store-operated Ca2+ entry cause immunodeficiency, myopathy and ectodermal dysplasia J Allergy Clin Immunol. 2009 Dec; 124(6): 1311-1318.e7. doi: 10.1016/j.jaci.2009.10.007]).
Accordingly, there has been still needed to develop more effective treating agent in treating and alleviating immune-involved diseases from natural source with low side effects than conventionally used drugs till now.
Agrimonia pilosa is a perennial herbaceous species of the double-leaf plant rose family, distributed throughout Korea, as well as eastern Russia, Mongolia, Europe, Okinawa, Japan, and northeastern China. Agrimonia pilosa is distinguished from Agrimonia coreana NAKAI because it usually does not cover the stem in the shape of a chin-leaf sickle, whereas Agrimonia coreana NAKAI wraps around the stem in the shape of a semicircular or fan. Also, the flowers of Agrimonia pilosa are closely attached to the firing sequence, distinguishing them from whereas Agrimonia coreana NAKAI, which are somewhat sloppy (Korean Bio Resource Information System, https:// www.bris.go.kr)
Agrimonia coreana NAKAI, a Korean native plant, is a perennial herbaceous species of the rose family, native to South Korea, and has been reported to contain agrimonin, agrimonolide, tannn, saponin etc and agrimonin, among them has been reported to show blood coagulating activity, hypoglycemic activity, anti-pesticide activity etc (Chung B. S et al, Dohaehyangyakdaesajeon, youngrimsa, 2nd Ed. P636-637, 1998).
Korea Patent Publication No. 10-2010-0128770 discloses on "cosmetic composition containing water/ethanol extract of Agrimonia pilosa showing anti-atopic dermatitis" ; Korea Patent Publication No. 10-2012-0126416 discloses on "Composition comprising extract of Agrimonia pilosa having treating or preventing inflammation, allergy or asthma disease" ; Korea Patent Publication No. 10-2012-0003317 discloses on " Composition comprising extract of Agrimonia pilosa for inhibiting the degranulation of mast cell "; Korea Patent Publication No. 2001--0053978 discloses on "anti-irritant cosmetic composition comprising extract of Agrimonia pilosa": Korea Patent Registration No. 10-1554030 discloses on " cosmetic composition comprising a root extract of Agrimonia pilosa for improving skin trouble" etc.
There have been several literatures on the anti-inflammatory compounds which has been isolated from Agrimonia pilosaa, for examples,
(a) Luteolin; Kim JJ, Jiang J, Shim DW, Kwon SC, Kim TJ, Ye SK, Kim MK, Shin YK, Koppula S, Kang TB, Choi DK, Lee KH. (2012) Anti-inflammatory and anti-allergic effects of Agrimonia pilosa Ledeb extract on murine cell lines and OVA-induced airway inflammation. J. Ethnopharmacol. 140(2):213-221); Apigenin [Aziz N, Kim MY, Cho JY.(2018) Anti-inflammatory effects of luteolin: A review of in vitro, in vivo, and in silico studies. J Ethnopharmacol. 28; 225:342-358.],
(b) Kaempferol [Pang L, Zou S, Shi Y, Mao Q, Chen Y. (2019) Apigenin attenuates PM2.5-induced airway hyperresponsiveness and inflammation by down-regulating NF-KB in murine model of asthma Int J Clin Exp Pathol. 12(10):3700-3709],
(c) Quercetin [ Alam W, Khan H, Shah MA, Cauli O, Saso L.(2020) Kaempferol as a Dietary Anti-Inflammatory Agent: Current Therapeutic Standing. Molecules 7;25(18):E4073; Guiling Chen, Yang Ye, Ming Cheng, Yi Tao, Kejun Zhang, Qiong Huang, Jingwen Deng, Danni Yao, Chuanjian Lu1 and Yu Huang. Quercetin Combined With Human Umbilical Cord Mesenchymal Stem Cells Regulated Tumour Necrosis Factor-a/Interferon-g-Stimulated Peripheral Blood Mononuclear Cells via Activation of Toll-Like Receptor 3 Signalling. Front Pharmacol. 2020; 11: 499.],
(d) Luteolun 7-glucuronide [Young-Chang Cho, Jiyoung Park, Sayeon Cho (2020) Anti-Inflammatory and Anti-Oxidative Effects of luteolin-7- O-glucuronide in LPS-Stimulated Murine Macrophages through TAK1 Inhibition and Nrf2 Activation. Int J Mol Sci. 16;21(6):2007],
(e) Apigenin 7-glucuronide [Weicheng Hu, Xinfeng Wang, Lei Wu, Ting Shen, Lilian Ji, Xihong Zhao, Chuan-Ling Si, Yunyao Jiang, Gongcheng Wang (2016); Apigenin-7-O-β-D-glucuronide inhibits LPS-induced inflammation through the inactivation of AP-1 and MAPK signaling pathways in RAW 264.7 macrophages and protects mice against endotoxin shock. Food Funct. 7(2):1002-13.
However, there has been not reported or disclosed about the efficient method for preparing more potent and the inventive purified extract isolated from the extract containing more abundant ingredients, or the compounds of Agrimonia coreana NAKAI, a Korean native plant, showing immune-modulating activity than those in the above cited literatures, the disclosures of which are incorporated herein by reference.
Furthermore, there have been difficulties in mass-production and industrialization using by the extract of Agrimonia pilosa, since the plant extract contains very little anti-inflammatory ingredients such as luteolun 7-glucuronide, apigenin 7-glucuronide, luteolin, apigenin, kaempferol, quercetin etc.
Based on the previous studies on the anti-inflammatory, anti-allergy, anti-atopic dermatitis activity as well as immune-modulating activity of the extract of Agrimonia pilosa, disclosed in the above cited literatures, the present inventors have tried to develop more efficient method for preparing more potent and more abundant ingredients and the compounds showing potent immune-modulating activity isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, till now.
Accordingly, the present inventors have found the potent compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, and the compounds showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2),.
To investigate the potent immune-modulating activity of compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, the inventors of present invention have intensively carried out various experiments including such. inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2).
As a result of these investigations, the inventors finally completed the present invention by confirming that inventive compounds isolated from the extract of Agrimonia coreana NAKAI , a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.
The technical solution to solve the problem of the background art is for the development of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant for treating or inhibiting effect on various immune involved diseases.
The present invention also provides a pharmaceutical composition and a health food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, as an active ingredient in an effective amount to treat and prevent various immune involved diseases.
The present invention also provides a use of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showing immune-modulating activity.
The present invention also provides a method of treating or preventing various immune involved diseases in a mammal comprising administering to said mammal an effective amount of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showing immune-modulating activity together with a pharmaceutically acceptable carrier thereof.
Accordingly, it is an object of the present invention to provide a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, as an active ingredient in an effective amount to treat and prevent immune involved diseases.
The term " the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant " disclosed herein comprises luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol, quercetin etc.
The term " Agrimonia coreana NAKAI" disclosed herein comprises the aerial part, whole plant, leaf, stem, or root of cultivated or naturally grown plant located in Chung-cheong do province, Jeolla do province, Gyeongsang do province etc in South Korea and commercially available plant, but not intent to limit thereto herein.
The term " immune involved diseases " disclosed herein comprises "all the disorder of immnuno-modulation" including (a) immune-sensitivity syndrome caused by impaired immune system such as autoimmune diseases, organ rejection, hypersensitivity allergic diseases etc; and (b) immune deficiency syndrome such as the immuno-deficiency syndrome caused by chemotherapy or radiation therapy; or immuno-deficiency syndrome caused by bone marrow transplantation, HIV infection, cancer disease, etc, specifically, (a) immune-sensitivity syndrome such as autoimmune, atopic dermatitis, acute or chronic urticarial; (b) immune deficiency syndrome such as bacterial/viral infections in older adults, chronic respiratory infections, chronic urinary tract infections, bedsores, flu, pneumonia, pox, measles, sudden rash, foot-and-mouth disease, rubella, or Crohn's disease.
The inventive compound can be transformed into their pharmaceutically acceptable salt and solvates by the conventional method well known in the art. For the salts, acid-addition salt thereof formed by a pharmaceutically acceptable free acid thereof is useful and can be prepared by the conventional method. For example, after dissolving the compound in the excess amount of acid solution, the salts are precipitated by the water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile to prepare acid addition salt thereof and further the mixture of equivalent amount of compound and diluted acid with water or alcohol such as glycol monomethylether, can be heated and subsequently dried by evaporation or filtrated under reduced pressure to obtain dried salt form thereof.
As a free acid of above-described method, organic acid or inorganic acid can be used. For example, organic acid such as methansulfonic acid, p-toluensulfonic acid, acetic acid, trifluoroacetic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonylic acid, vanillic acid, hydroiodic acid and the like, and inorganic acid such as hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid and the like can be used herein.
Further, the pharmaceutically acceptable metal salt form of inventive compounds may be prepared by using base. The alkali metal or alkali-earth metal salt thereof can be prepared by the conventional method, for example, after dissolving the compound in the excess amount of alkali metal hydroxide or alkali-earth metal hydroxide solution, the insoluble salts are filtered and remaining filtrate is subjected to evaporation and drying to obtain the metal salt thereof. As a metal salt of the present invention, sodium, potassium or calcium salt are pharmaceutically suitable and the corresponding silver salt can be prepared by reacting alkali metal salt or alkali-earth metal salt with suitable silver salt such as silver nitrate.
The pharmaceutically acceptable salt of the compound comprise all the acidic or basic salt which may be present at the compounds, if it does not indicated specifically herein. For example, the pharmaceutically acceptable salt of the present invention comprise the salt of hydroxyl group such as the sodium, calcium and potassium salt thereof; the salt of amino group such as the hydrogen bromide salt, sulfuric acid salt, hydrogen sulfuric acid salt, phosphate salt, hydrogen phosphate salt, dihydrophosphate salt, acetate salt, succinate salt, citrate salt, tartarate salt, lactate salt, mandelate salt, methanesulfonate (mesylate) salt and p-toluenesulfonate (tosylate) salt etc, which can be prepared by the conventional method well known in the art.
There may exist in the form of optically different diastereomers since the compounds have unsymmetrical centers, accordingly, the compounds of the present invention comprise all the optically active isomers, R or S stereoisomers and the mixtures thereof. Present invention also comprises all the uses of racemic mixture, more than one optically active isomer or the mixtures thereof as well as all the preparation or isolation method of the diastereomer well known in the art.
The inventive compounds may be prepared from Agrimonia coreana NAKAI, a Korean native plant, by following procedure:
For example, inventive compounds is characterized by being prepared by the process of;
adding at least one extracting solvent selected from water, spirit, C1-C4 lower alcohol such as methanol, ethanol, butanol etc or the mixtures thereof, preferably, mixture of water and ethanol or spirit , more preferably, 30-80(w/w) ethanol or spirit in water to the dried aerial part, whole plant, leaf, stem, or root of cultivated or naturally grown of Agrimonia coreana NAKAI, a Korean native plant, located in Chung-cheong do province, Jeolla do province, Gyeongsang do province etc at the 1st step; subjecting to at least one extraction method selected from reflux extraction with hot water, cold water extraction, ultra-sonication or conventional extraction, preferably reflux extraction at the temperature ranging from 10 to 100℃, preferably from 20 to 90℃, for the period ranging from 30 mins to 72 hours, preferably, 3 to 72 hours, repeatedly, 1 - 20 times, preferably, 2 - 10 times, to afford the 1st extract at 2nd step; and subjecting the 1st extract to at least one further purification process selected from the group consisting of reverse phase partition chromatography, normal phase partition chromatography, ion exchange chromatography, and size exclusion chromatography repeatedly to afford the inventive compounds of the present invention, such as luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol, quercetin etc
The term "pharmaceutically acceptable carriers or excipients" defined herein comprises "pharmaceutical additives, the inactive ingredients used to make up a medication. They include dyes, flavors, binders, emollients, fillers, lubricants, preservatives, and many more classifications. Common excipients include cornstarch, lactose, talc, magnesium stearate, sucrose, gelatin, calcium stearate, silicon dioxide, shellac and glaze, which has been well-known in the art (See, Home-page of Food and Drug Administration: www.fda.gov or drug information online: www.drugs.com) or previous literature (for example, Rowe, Raymond C et al., Handbook of Pharmaceutical Excipients, Pharmaceutical Press, 7th Edition, 2012)
Accordingly, in an another embodiment of the present invention, the present invention also provides a method for preparing inventive compounds isolated from the extract of Agrimonia coreana NAKAI comprising the steps of; adding at least one extracting solvent selected from water, spirit, C1-C4 lower alcohol such as methanol, ethanol, butanol etc or the mixtures thereof, preferably, mixture of water and ethanol or spirit , more preferably, 30-80(w/w) ethanol or spirit in water to the dried aerial part, whole plant, leaf, stem, or root of cultivated or naturally grown of Agrimonia coreana NAKAI, a Korean native plant, located in Chung-cheong do province, Jeolla do province, Gyeongsang do province etc at the 1st step; subjecting to at least one extraction method selected from reflux extraction with hot water, cold water extraction, ultra-sonication or conventional extraction, preferably reflux extraction at the temperature ranging from 10 to 100℃, preferably from 20 to 90℃, for the period ranging from 30 mins to 72 hours, preferably, 3 to 72 hours, repeatedly, 1 - 20 times, preferably, 2 - 10 times, to afford the 1st extract at 2nd step; and subjecting the 1st extract to at least one further purification process selected from the group consisting of reverse phase partition chromatography, normal phase partition chromatography, ion exchange chromatography, and size exclusion chromatography repeatedly to afford the inventive compounds of the present invention, such as luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol, quercetin etc to treat and prevent inflammatory, allergic or atopic dermatitis disease.
Specifically, the term "further purification process" is selected from (i) reverse phase partition chromatography, (ii) normal phase partition chromatography, (iii) ion exchange chromatography or (iv) size exclusion chromatography, preferably, reverse phase partition chromatography or any chromatography using by any resin as a stationary phase which can retain non-polar substance while eluting polar substance, for example, Sephadex resin such as Sephadex, Sephadex LH20, Sephadex G-25, Sephadex G-10, Sepharose, Superdex, methylacrylate resin, carboxymethyl cellulose, sulphopropyl cellulose, carboxymethyl Sephadex, sulphopropyl Sephadex, carboxymethyl Sepharose, sulphopropyl Sepharose and the like; reverse polymer resin using by Stylene-divinylbenzen co-polymer such as Polymer X, HP20, PRP-h1 Polymer and the like or Methacrylate support resin etc; normal Silica gel such as BPC (Bonded pahse chromatography) product, Silica product procured from YMC Co. Ltd, Silica product procured from DAISO Co. Ltd, Silica product procured from ASAHI Co. Ltd, Silica product procured from COSMOSYL Co. Ltd and the like; ODS product used for HPLC filler such as ODS product procured from YMC Co. Ltd, ODS product procured from DAISO Co. Ltd, ODS product procured from ASAHI Co. Ltd, ODS product procured from CHEMCO Co. Ltd, ODS product procured from Merck Co. Ltd ODS product procured from COSMOSYL Co. Ltd ODS product procured from FUJI Co. Ltd and the like.
In a preferred embodiment adopting (i) reverse phase partition chromatography as a further purification process of the present invention, the "stationary phase in the above-described reverse phase partition chromatography" may be any stationary phases such as reverse phase substance as a stationary phase which can retain non-polar substance while eluting polar substance, preferably, Silica gel based stationary phase, polymer based stationary phase such as polystyrene etc and the like, more preferably, Silica gel derivatives such as C2, C4, C6, C8, C10, C12, 14, C16, C18 and the like; or a polymer based stationary phase such as PS-2, Oasis HLB and the like, more and more preferably, reverse phase Silica gel (C18(IV)-D), ODS-A/ODS-AQ product from YMC Co. Ltd., SP-C-ODS product from CHEMCO Co. Ltd., SP-ODS-RPS product from DAISO Co. Ltd., 5C18 product from COSMOSYL Co. Ltd., Chromatorex product from FUJI Co. Ltd., etc.
In a preferred embodiment adopting (i) reverse phase partition chromatography as a further purification process of the present invention, the "mobile phase in the above-described (i) reverse phase partition chromatography" may be at least one solvent selected from water, acetonitrile, lower alcohol such as methanol, ethanol, butanol etc, tetrahydrofuran (THF) or the mixture thereof, preferably, water, lower alcohol such as methanol, ethanol, butanol etc, or the mixture thereof, more preferably, the mixture solvent of water and methanol, more and more preferably, the mixture solvent of water and methanol with starting from 90:10(v/v) to 60:40(v/v) to elute polar substance.
In a preferred embodiment adopting (ii) normal phase partition chromatography as a further purification process of the present invention, the "stationary phase in the above-described normal phase partition chromatography" may be any stationary phases such as normal phase substance as a stationary phase which can retain polar substance while eluting non-polar substance, preferably, Silica gel, Fluorosyl, or alumina based stationary phase, CN, Diol, or NH2 moiey polymer based stationary phase and the like, more preferably, Silica gel, Fluorosyl, or alumina based stationary phase, etc.
In a preferred embodiment adopting (ii) normal phase partition chromatography as a further purification process of the present invention, the "mobile phase in the above-described (ii) normal phase partition chromatography" may be at least one solvent selected from hexane, heptane, ethylacetate, ethanol, diethylether, 2-propanol or the mixture thereof, preferably, hexane, heptane, ethylacetate or the mixture thereof to elute non-polar substance.
In a preferred embodiment adopting (iii) ion exchange chromatography as a further purification process of the present invention, the "stationary phase in the above-described (iii) ion exchange chromatography" may be any high molecular stationary phases as a stationary phase which have charged cross-linking moiety, preferably, cation exchange resin, anion exchange resin, or synthetic adsorbent, and the like, more preferably, strongly acidic cation exchange resin such as AG 50W-x8, Amberlite IR-120, Dowex 60W-x8, SKIB etc; weakly acidic cation exchange resin such as Amberlite IRA-67, Dowex 3-x4A etc; strongly basic cation exchange resin such as DIAION SKIB, DIAION PK216, DIAION CR20, DIAION UBK555 (Mitsubishi Chemical Co.), TRILITE SPC 160H, TRILITE SPC 180H, TRILITE SPC 400JH (Samyang Co. Ltd.), AMBERLITE 200C Na, AMBERLITE CG50, AMBERLITE CR1310 Na, AMBERJET 200H, AMBERLYST 131 WET, ALBERLYST 232 WET (ROHM and HAAS Co. Ltd.), Lewatit VP OC 1800, Lewatit VP OC 1812, Lewatit MDS1368 Na, Lewaitit K1221 (Bayer Co. Ltd.), PUROLITE PCR833CA, PUROLITE C145 (Purolite Co. Ltd.), MFG210, MFG 250 (Finex Co. Ltd.) etc; strongly basic anion exchange resin such as SA11A, SA20A, SA21A etc; or CaptoQ (GE Healthcare Co. Ltd.), or the resin having similar property thereto such as Toyopearl QEA (Tosoh Co. Ltd.), Q Sepharose FF (GE Healthcare Co. Ltd.), Fractogel EMD, Fractogel TMAE, Fractogel HICAP (Merck KGaA Co. Ltd or Darmstadt Co. Ltd.); more and more preferably, SA21A; adsorbent such as SP207, HP20SS, HP20 etc, more preferably, HP 20.
In a preferred embodiment adopting (iv) size exclusion chromatography as a further purification process of the present invention, the "stationary phase in the above-described (iv) size exclusion chromatography" may be any gel type stationary phases as a stationary phase which can separate by the size of sample, preferably, dextran-based gel such as sephadex (for example, sephadex G-25), polyacrylamide-based gel such as Sephacryl (for example, Sephacryl-S400), Agarose-based gel such as Superose or Sepharose (for example, Sepharose CL-4B) or the combinations thereof such as Superdex 200 combination Dextran (For example, SephadexTM), or cross-linked Agarose gel (SuperoseTM) and the like, however it shall be not limited thereto herein. The "mobile phase in the above-described (iv) size exclusion chromatography" may be buffer solution selected from the group consisting of sodium acetate buffer, sodium phosphate buffer, ammonium acetate buffer, MES (2-(N-morpholino)ethanesulphonic acid), Bis-Tris[2-Bis(2-hydroxyethyl)amino-2-(hydroxymethyl)-1,3-propandiol], ADA [N-(2-acetamido)iminodiacetate), PIPES [piperaxine-N,N'-Bis(2-ethanesulophonic acid)], BES [N.N'-Bis(2-hydroxyethyl)-2-aminoethansulphonic acid), MOPS [3-(N-morpholino)propansulphonic acid)], TES (N-Tris(hydroxymethyl)methyl-2-aminoethanesulphonic acid], HEPES [N-2-hydroxyethyl-piperazine-N'-2-ethanesulphonic acid), and the like; preferably, sodium acetate buffer, sodium phosphate buffer, or ammonium acetate buffer.
In a preferred embodiment of the present invention, the present invention can also perform (v) Gel permeation chromatography or Gel filtration chromatography in addition to (i) reverse phase partition chromatography, (ii) normal phase partition chromatography, (iii) ion exchange chromatography, (iv) size exclusion chromatography or the combination thereof, as a further purification process disclosed herein.
The term "prevent" disclosed herein comprises any act to inhibit or postpone the occurrence of certain disease or disorder disclosed herein by way of administrating the inventive composition; and the term "treat" disclosed herein comprises any act to alleviate or favorably changing the symptom associated with certain disease or disorder disclosed herein by way of administrating the inventive composition.
The present inventors have found that inventive compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.
Accordingly, in accordance with the other aspect of the present invention, present invention provide a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, as an active ingredient in an effective amount to treat and prevent immune involved diseases.
Present invention provide a pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, as an active ingredient and the pharmaceutically acceptable carriers or excipients, for the treatment and prevention of immune involved diseases.
In accordance with another aspect of the present invention, there is also provided a use of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, for manufacture of medicines employed for treating or preventing immune involved diseases.
The term "pharmaceutically acceptable carriers or excipients" defined herein comprises "pharmaceutical additives, the inactive ingredients used to make up a medication. They include dyes, flavors, binders, emollients, fillers, lubricants, preservatives, and many more classifications. Common excipients include cornstarch, lactose, talc, magnesium stearate, sucrose, gelatin, calcium stearate, silicon dioxide, shellac and glaze, which has been well-known in the art (See, Home-page of Food and Drug Administration: www.fda.gov or drug information online: www.drugs.com) or previous literature (for example, Rowe, Raymond C et al., Handbook of Pharmaceutical Excipients, Pharmaceutical Press, 7th Edition, 2012)
In accordance with another aspect of the present invention, there is also provided a method of treating or preventing immune involved diseases in mammals, wherein the method comprises administering a therapeutically effective amount of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, into the mammal suffering from immune involved diseases.
The inventive composition for treating and preventing immune involved diseases may comprises above extracts as 0.1 ~ 99%, preferably, 0.1 ~ 50% by weight based on the total weight of the composition.
The composition according to the present invention can be provided as a pharmaceutical composition containing pharmaceutically acceptable carriers, adjuvants or diluents, e.g., lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starches, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil. The formulations may additionally include fillers, anti-agglutinating agents, lubricating agents, wetting agents, flavoring agents, emulsifiers, preservatives and the like. The compositions of the invention may be formulated so as to provide quick, sustained or delayed release of the active ingredient after their administration to a patient by employing any of the procedures well known in the art.
For example, the compositions of the present invention can be dissolved in oils, propylene glycol or other solvents that are commonly used to produce an injection. Suitable examples of the carriers include physiological saline, polyethylene glycol, ethanol, vegetable oils, isopropyl myristate, etc., but are not limited to them. For topical administration, the extract of the present invention can be formulated in the form of ointments and creams.
Pharmaceutical formulations containing present composition may be prepared in any form, such as oral dosage form (powder, tablet, capsule, soft capsule, aqueous medicine, syrup, elixirs pill, powder, sachet, granule), or topical preparation (cream, ointment, lotion, gel, balm, patch, paste, spray solution, aerosol and the like), or injectable preparation (solution, suspension, emulsion).
The composition of the present invention in pharmaceutical dosage forms may be used in the form of their pharmaceutically acceptable salts, and also may be used alone or in appropriate association, as well as in combination with other pharmaceutically active compounds.
The desirable dose of the inventive extract varies depending on the condition and the weight of the subject, severity, drug form, route and period of administration, and may be chosen by those skilled in the art. However, in order to obtain desirable effects, it is generally recommended to administer at the amount ranging from 0.0001 to 1000mg/kg, preferably, 0.001 to 100mg/kg by weight/day of the inventive extract of the present invention. The dose may be administered in single or divided into several times per day.
The pharmaceutical composition of present invention can be administered to a subject animal such as mammals (rat, mouse, domestic animals or human) via various routes. All modes of administration are contemplated, for example, administration can be made orally, rectally or by intravenous, intramuscular, subcutaneous, intracutaneous, intrathecal, epidural or intracerebroventricular injection.
The inventive compounds/extract of the present invention also can be used as a main component or additive and aiding agent in the preparation of various functional health food and health care food.
Accordingly, it is the other object of the present invention to provide a health functional food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant,for the prevention or alleviation of immune involved diseases.
The term "a functional health food" defined herein" the functional food having enhanced functionality such as physical functionality or physiological functionality by adding the extract of the present invention to conventional food to prevent or improve the purposed diseases in human or mammal.
It is the other object of the present invention to provide a health care food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant,together with a sitologically acceptable additive for the prevention or alleviation of immune involved diseases.
The term "a health care food" defined herein "the food containing the compound/extract of the present invention showing no specific intended effect but general intended effect in a small amount of quantity as a form of additive or in a whole amount of quantity as a form of powder, granule, capsule, pill, tablet etc.
The term "a sitologically acceptable additive" defined herein comprises "any substance the intended use which results or may reasonably be expected to result-directly or indirectly-in its becoming a component or otherwise affecting the characteristics of any food", and can be classified into three groups according to its origin, i.e., (1) chemically synthetic additive such as ketones, glycine, potassium citrate, nicotinic acid, etc; (2) natural additive such as persimmon dye, licorice extract, crystalline cellulose, gua dum etc; (3) the mixed additive therewith such as sodium L-glutamate, preservatives, tar dye etc, or various categories according to its function in the food, for example, thickening agent, maturing agent, bleaching agent, sequestrant, humectant, anti-caking agent, clarifying agents, curing agent, emulsifier, stabilizer, thickener, bases and acid, foaming agents, nutrients, coloring agent, flavoring agent, sweetener, preservative agent, anti-oxidant, etc, which has been well-known in the art or previous literature (See, "Codex General Standard for Food Additives" (GSFA, Codex STAN 192-1995) in Home-page of GSFA Online: www.codexalimentarius.net/gsfaonline/index.html).
If a substance is added to a food for a specific purpose in that food, it is referred to as a direct additive and indirect food additives are those that become part of the food in trace amounts due to its packaging, storage or other handling.
The term "health care foods or health functional foods" disclosed herein can be contained in food, health beverage, dietary supplement etc, and may be formulated into a form of pharmaceutically dosing form such as a powder, granule, tablet, suspension, emulsion, syrup, chewing tablet, capsule, beverage etc; or the food form, for example, bread, rice cake, dry fruit, candy, chocolate, chewing gum, ice cream, milk such as low-fat milk, lactose-hydrolyzed milk, goat-milk, processed milk, milk product such as fermented milk, butter, concentrated milk, milk cream, butter oil, natural cheese, processed cheese, dry milk, milk serum etc, processed meat product such as hamburger, ham, sausage, bacon etc, processed egg product, fish meat product such as fish cake etc, noodle products such as instant noodles, dried noodles, wet noodles, fried noodles, non-fried noodles, gelatinized dry noodles, cooked noodles, frozen noodles, Pasta etc, tea product such as tea bag, leached tea etc, health drinks such as fruit drinks, vegetable drinks, carbonated soft drinks, soymilk drinks, lactic beverage mixed beverage, etc, seasoning food such as soy sauce, soybean paste, red pepper paste, chunjang (a kind of fermented soybean product colored by caramel), cheonggukjang (natural fermented soybean by B. subtillis), mixed paste, vinegar, sauce, ketchup, curry, dressing etc, margarine, shortening, pizza etc, but not intended herein to limit thereto, for preventing or improving of purposed disease.
Also, above described compound/extract can be added to food or beverage for prevention and improvement of purposed disorder. The amount of above described extract in food or beverage as a functional health food or health care food may generally range from about 0.01 to 100 w/w % of total weight of food for functional health food composition. In particular, although the preferable amount of the extract of the present invention in the functional health food, health care food or special nutrient food may be varied in accordance to the intended purpose of each food, it is preferably used in general to use as an additive in the amount of the extract of the present invention ranging from about 0.01 to 5% in food such as noodles and the like, from 40 to 100% in health care food on the ratio of 100% of the food composition.
Providing that the health beverage composition of present invention contains above described extract or compound as an essential component in the indicated ratio, there is no particular limitation on the other liquid component, wherein the other component can be various deodorant or natural carbohydrate etc such as conventional beverage. Examples of aforementioned natural carbohydrate are monosaccharide such as glucose, fructose etc; disaccharide such as maltose, sucrose etc; conventional sugar such as dextrin, cyclodextrin; and sugar alcohol such as xylitol, and erythritol etc. As the other deodorant than aforementioned ones, natural deodorant such as taumatin, stevia extract such as levaudioside A, glycyrrhizin et al., and synthetic deodorant such as saccharin, aspartame et al., may be useful favorably. The amount of above described natural carbohydrate is generally ranges from about 1 to 20 g, preferably 5 to 12 g in the ratio of 100 ㎖ of present beverage composition.
The other components than aforementioned composition are various nutrients, a vitamin, a mineral or an electrolyte, synthetic flavoring agent, a coloring agent and improving agent in case of cheese, chocolate et al., pectic acid and the salt thereof, alginic acid and the salt thereof, organic acid, protective colloidal adhesive, pH controlling agent, stabilizer, a preservative, glycerin, alcohol, carbonizing agent used in carbonate beverage et al. The other component than aforementioned ones may be fruit juice for preparing natural fruit juice, fruit juice beverage and vegetable beverage, wherein the component can be used independently or in combination. The ratio of the components is not so important but is generally range from about 0 to 20 w/w % per 100 w/w % present composition. Examples of addable food comprising aforementioned extract or compound therein are various food, beverage, gum, vitamin complex, health improving food and the like.
Inventive extract of the present invention has no toxicity and adverse effect therefore; they can be used with safe.
It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, use and preparations of the present invention without departing from the spirit or scope of the invention.
The present invention is more specifically explained by the following examples. However, it should be understood that the present invention is not limited to these examples in any manner.
As described in the present invention, the present inventors demonstrated that inventive compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases
Fig. 1 shows the inhibitory effect of the APC-311, Luteolin 7-gluruconid, Apigenin 7-glucuronide on the proliferation of CD4+ T cell;
Fig. 2 presents the inhibitory effect of the 8 compounds isolated from Agrimonia coreana NAKAI prepared in Example on ORAI1.
The above and other objects, features and other advantages of the present invention will more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which;
Fig. 1 shows the inhibitory effect of the APC-311, Luteolin 7-gluruconid, Apigenin 7-glucuronide on the proliferation of CD4+ T cell;
Fig. 2 presents the inhibitory effect of the 8 compounds isolated from Agrimonia coreana NAKAI prepared in Example on ORAI1.
Best Mode for Carrying Out the Invention
It will be apparent to those skilled in the art that various modifications and variations can be made in the compositions, use and preparations of the present invention without departing from the spirit or scope of the invention.
The present invention is more specifically explained by the following examples. However, it should be understood that the present invention is not limited to these examples in any manner.
EXAMPLES
The following Reference Example, Examples and Experimental Examples are intended to further illustrate the present invention without limiting its scope.
Reference Example 1. Analysis reagent/apparatus
Melting points was determined by apparatus(Koflermicrohostage) without correction and Optical rotation was determined by apparatus(Jasco P-1020 polarimeter). UV data was determined by apparatus (UV-VIS 2450 spectrometer) and FT-IR spectra was determined by apparatus (Jasco FT/IR-4200). NMR spectra was recorded by apparatus (Varian UNITY 400 MHz FT-NMR spectrometer) using a tetramethylsilane as an internal standard and HRESIMS was determined by apparatus (Waters Q-TOF Premier spectrometer). HPLC analysis was performed by apparatus (Gilson) using UV/VIS-155 detector and pump 305.
Example 1. Identification of origin of test sample through gene analysis
In order to identify the origin of test sample procured from conventional company (Minkyunhmulsann Co. Ltd. Korea, 143, dong-ro, Jeongneungcheondong-ro, Dongdaemun-gu, Seoul, Republic of Korea), Korean gene analysis company (Geno Tech Corp., www.genotech.co.kr/26-69, Gajeongbuk-ro, Yuseong-gu, Daejeon, Republic of Korea,T;82-42-862-8404) has performed gene analysis to determine whether the leaf of test sample is Agrimonia coreana NAKAI or not according to following procedure.
1-1. Test procedure
1-1-1. DNA extraction and purification
The DNA extraction and purification from test sample was performed according to CTAB method (Schlaeger TM et al., Proc. Natl. Acad. Sci. USA, 94(7), pp.3058-3063, 1997 cetyl trimethylammonium bromide method, Adam Healey, Agnelo Furtado, Tal Cooper & Robert J Henry. Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species. Plant Methods 2014, 10:21) using by conventional reagents provided from company according to instruction manual of the company.
(1) pre-treatment of test sample
100g of dried test sample was poured to mortar and pulverized to be very fine powder using liquid nitrogen for DNA extraction.
(2) DNA extraction using by CTAB method
The dried powder was transferred to 2ml of tube and 500μL of lysis buffer (K-3021, BIONEER Corp.,Korea), 20 mM Tris-HCl (pH 8.0), 2 mM sodium EEDTA, 1.2% Triton X-100, 20 mg/mL of lysozyme and 10 μL of proteinase K solution (K-3031, BIONEER Corp.,Korea, more than 600 mAU/mL) were added thereto to mix thoroughly and reacted together for 1 hour at 37 ℃ in pyrostat (BS-31, Vison Lab Science Co. Ltd, Korea).
400 μL of CTAB (cetyl trimethylammonium bromide) buffer solution (C2007, Biosesang Co. Ltd. Korea) containing 0.1M Tris (pH 8.0), 1.4M NaCl, 0.02M EDTA (pH8.0), 2% hexadecyltrimethylammonium bromide and 0.2% 2-mercaptoethanol, was added thereto and reacted together for 30 mins at 65 ℃ in pyrostat (BS-31, Vison Lab Science Co. Ltd, Korea).
600 μL of solvent mixture (Phenol:Chloroform:Isoamylalcohol = 25: 24: 1) and 300 μL of distilled water were added to the reactant, mixed thoroughly and centrifuged for 10 mins at 20 ℃ at the speed of 14,000 rpm.
600 μL of supernatant was added to new 1.5 mL tube and 600 μL of isopropanol was added thereto to mix together, react for 10 mins at room temperature and centrifuged for 10 mins at 20 ℃ at the speed of 14,000 rpm.
After removing the remaining supernatant, the precipitated DNA was washed with 500 μL of 70% ethanol three times and left alone to dry purified DNA at room temperature.
The purified DNA was dissolved in 20 - 30 μL of sterilized triple distilled water to left alone for 1 hour at 4 ℃ and 2 μL of RNase enzyme (100mg/mL, 7,000 units/mL, K-3031, BIONEER Corp., Korea) was added thereto to react together for 30 mins at 37℃. ,
(3) Determination of DNA purity and DNA content.
After confirming the extracted DNA through electrophoresis using by 1% agarose gel (54801, Takara Korea Biomedical Inc.), DNA was stained with staining agent (EtBr: Ethidium Bromide, E1510, Sigma-Aldrich Co. Ltd.) and the purity and content of DNA were determined using by UV spectrophotometer (Nanodrop, USA) under UV light (Absorbance: 260nm and 280 nm, Gel Doc XR, Bio-RAD) to DNA quantification.
1-1-2. PCR condition for DNA barcode analysis
(1) DNA barcode primer.
The DNA barcode primers shown in Table 1 was used in the experiment and the specific DNA barcode for Agrimonia coreana NAKAI was developed by comparing with barcode information listed in GenBank DB.
DNA bar-code primers used in DNA analysis
*DNA bar-code primers used in DNA analysis
Target region Primer Primer Sequence Sequence I.D.
cpDNA Coding
region		 matK* 3F_KIM f CGTACAGTACTTTTGTGTTTACGAG 1
1R_KIM r CCCATTCATCTGGAAATCTTGGTTC 2
rbcL* rbcLa_R GTAAAATCAAGTCCACCGCG 3
rbcLa_F ATGTCACCACAAACAGAGACTAAAGC 4
Non-
coding
region		 atpF-atpH* atpF f TCGCTTAACACTCCCCTTCC 5
atpH r GCTTTCATGGAAGCTTTAACAAT 6
psbA-trnH* psbA3 F GTTATGCATGAACGTAATGCTC 7
trnHf_05 CGCGCGTGGTGGATTCACAATCC 8
psbK-psbI* psbK f TTAGCCTTTGTTTGGCAAG 9
psbI r ATAGTTTAAGAGTAAGCAT 10
trnL-intron** trn c CGAAATCGGTAGACGCTACG 11
trn d GGGGATAGAGGGACTTGAAC 12
trnL-trnF** trn e GGTTCAAGTCCCTCTATCCC 13
trn f ATTTGAACTGGTGACACGAG 14
*, CBOL; A CBOL Plant working group(2009) A DNA barcode for land plants. Proc Nati Acad Sci USA. 106(31): 12794-12797.
**, trnT-trnL; trnL-intron, trnL-trnF; Taberlet et al.(1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.
※ underlined character : specific base sequences of Agrimonia genus
(2) PCR (Polymerase Chain Reaction)
For PCR condition using by the barcode primers, the mixture of 2 μL of forward primer (10pmole/ μL ), 2 μL of reverse primer (10pmole/ μL ) and 20ng/μL of fixed quantity of stranded DNA was mixed with PCR premix (K-2115, Bioneer Corp., Korea) and added with distilled water to the extent that the final reaction volume has reached to be 30 μL.
The isolated DNA was amplified by PCR [(pre-denaturation at 95℃ for 5min, denaturation at 95℃ for 45sec, annealing at 55℃ for 45sec and extension at 72℃ for 1 min.)Х35 cycles and final-extension at 72℃ for 5mins] to afford the amplified DNA product.
5 μL of the amplified DNA product was dropped into 1% agarose gel to be electrophoresed and treated with EtBr (Ethidium Bromide) staining method to confirm the presence of amplified products.
(3) DNA barcode sequencing analysis
The PCR product prepared from the above-step was purified to be used for performing following DNA barcode sequencing analysis.
The analyzed DNA sequence of each sample by each DNA barcode was aligned by multiple alignment method according to Bioedit program (version 7.0.5.3 Tom Hall Ibis Biosciences, USA) as well as Clustal method (D Thompson, DG Higgins, TJ Gibson. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994 Nov. 11;22(22):4673-80).
The difference between each species of plant has been confirmed by analyzing the positions of insertion, deletion and substitution of each DNA based on the sequencing result.
(4) Blast analysis: NCBI GenBank DB
The analyzed DNA sequence of each sample by each DNA barcode was analyzed by comparing with 7 barcode region of Chloroplast DNA (cpDNA) of sample. i.e. matK, rbcL, atpF-atpH, psbA-trnH, psbK-psbI, trnL-intron, trnL-trnF.
It has been confirmed that 7 barcode region of Chloroplast DNA (cpDNA) of sample (matK, rbcL, atpF-atpH, psbA-trnH, psbK-psbI, trnL-intron, trnL-trnF) are same as those of Agrimonia coreana NAKAI, of which result confirmed that the leaf of test sample is identified as Agrimonia coreana NAKAI.
Example 2. The preparation of active compounds ( APH13211, APH13212 )
2-1. Preparation of crude extract (APE)
1kg of dried leaf of Agrimonia coreana NAKAI of which species has been identified in Example 1 was cut into small pieces and mixed with 20 fold volume of 70% ethanol(v/w). The mixture was extracted with reflux extraction at 70℃ for 4 hours to collect the filtrate, three times. The extract was filtered with filtration apparatus (R5PPMF01ES, Kajika Co.,) to remove the debris, five times. The collected filtrate was concentrated by rotary vacuum evaporator (Buchi, Ratavapor, R-300) at 55~65℃ under reduced pressure and dried with freezing dryer to obtain 460g of dried crude extract (designated as 'APE" hereinafter).
2-2. Preparation of purified extract and compounds ( APH13211, APH13212 )
The crude extract (APE) preppared in Example 2-1, was performed to successive fractionation with the identical volume of hexane and ethylacetate to afford 3 fractions (hexane fraction, ethylacetate fraction and water fraction) to be analyzed on HPLC with HPLC condition as shown in Table 2. The water fraction showing the most potent activity was adsorbed on highly porous styrene non-polar adsorbent (Diaion HP20) as a stationary phase and eluted with three eluting solvents, i. e, 3L of 30%, 70% and 100% methanol, successively. The resulting 3 purified fractions (HP-pass, HP-30M and HP70M) were performed to HPLC analysis. HP70M fraction showing the most potent activity and most abundant active ingredients among them was adsorbed on reverse phase (ODS) MPLC with eluting the suspension using by eluting solvent (distilled water: ethanol= 50:50*?*to afford 4 purified fractions, i.e., MPLC 1, 2, 3 and 4 fractions. The MPLC-1 fraction was performed to the 1st Sephadex LH-20 column chromatography eluting with 70% methanol to afford 10 sub-fractions, i. e, LH-1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 and to be analyzed on HPLC.
The LH-3 sub-fraction among them was concentrated was performed to the 2nd Sephadex LH-20 column chromatography eluting with 50% methanol to afford 5 sub-fractions, i.e, Fr. I, II, III, IV and V and to be analyzed on HPLC. The Fr. II sub-fraction among them was concentrated and performed to preparative reverse phase (ODS) MPLC with eluting the suspension using by eluting solvent (distilled water: methanol= 100:0*?*0:100) to afford 3 purified fractions, i.e., PMPLC 1, 2 and 3 fractions. The final PMPLC 1 among them was performed again to preparative reverse phase (ODS) MPLC to afford APH13211 compound. The final PMPLC 3 among them was performed again to preparative reverse phase (ODS) MPLC to afford APH13212 compound.
The HPLC condition on the analysis of APH13211 compound and APH13212 compound was shown in Table 2.
zed result on HPLC of highly porous styrene non-polar adsorbent (Diaion HP20) as a stationary phase and eluted
HPLC condition (APH13211, APH13212)
HPLC analysis condition
Apparatus HITACHI Chromaster, HITACHI , Japan
Analysis condition
Column TSK-gel 100V (4.6 mmХ250 mm, 5 ㎛), TOSOH, Japan
Column Temperature 25 ℃
Mobile phase A : 5% MeOH (0.04% TFA)
B : MeOH
Gradient Time Mobile phase A (%) Mobile phase B (%)
0 90 10
2 90 10
20 0 100
22 0 100
23 90 10
26 90 10
Injection volume 10 ㎕
Flow rate 1ml/min
2-3. structure analysis of APH13211 and APH13212
To the structure analysis of APH13211 and APH13212 prepared in the above, the compounds were dissolved in DMSO-d 6 to determine 1H- NMR and 13C- NMR, (JEOL JNM-ECA600 600MHz FT-NMR spectrometer(JAPAN).
At the result, APH13211 was identified as Luteolin 7-glucuronide showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Tsukasa Iwashina and Hiroaki Setoguchi et al. Flavonoids from the Leaves of Vitex rotundifolia (Verbenaceae), and their Qualitative and Quantitative Comparison between Coastal and Inland Populations. Bull. Natl. Mus. Nat. Sci., Ser. B, 37(2), pp. 87-94.; Ufuk Ozgen et al. A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)
a. Luteolin 7-glucuronide:
Figure PCTKR2021014021-appb-C000001
<compound APH13211>
1H- NMR: (500 MHz, DMSO-d 6, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 12.80 (1H, -COOH), 9.96 (1H, OH), 9.38 (1H, OH), 7.44 (1H, dd, J = 8.5, 2.5 Hz, H-6'), 7.42 (1H, d, J = 2.5 Hz, H-2'), 6.91 (1H, d, J = 8.5 Hz, H-5'), 6.80 (1H, d, J = 2.0 Hz, H-8), 6.74 (1H, s, H-3), 6.46 (1H, d, J = 2.0 Hz, H-6), 5.28 (1H, d, J = 7.5 Hz, H-1''), 4.04-3.30 (sugar protons, 4H, H-2'', H-3'', H-4'', H-5'').
13C -NMR: (125 MHz, DMSO-d 6, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 181.8 (C-4), 170.0 (C-6''), 164.5 (C-2), 162.5 (C-7), 161.2 (C-5), 156.9 (C-9), 149.9 (C-4'), 145.7 (C-3'), 121.3 (C-1'), 119.1 (C-6'), 116.0 (C-5'), 113.5 (C-2'), 105.4 (C-10), 103.2 (C-3), 99.4 (C-6), 99.2 (C-1''), 94.5 (C-8), 75.6 (C-3''), 75.4 (C-5''), 72.8 (C-2''), 71.2 (C-4'').
b. Apigenin 7-glucuronide :
APH13212 was identified as Apigenin 7-glucuronide ) showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Hui-Ling Cheng and Li-Jie et al. Antiinflammatory and Antioxidant Flavonoids and Phenols from Cardiospermum halicacabum (倒地鈴 Dao Di Ling). J Tradit Complement Med. 2013 Jan-Mar; 3(1): 33-40; Ufuk Ozgen et al. A New Sulfated α-Ionone Glycoside from Sonchus erzincanicus Matthews. Molecules 2010, 15, 2593-2599; Jing Hui Feng. Antinociceptive Effect of Single Components Isolated from Agrimonia pilosa Ledeb. Extract. Sci. Pharm. 2019, 87, 18.)
Figure PCTKR2021014021-appb-C000002
<compound APH13212>
1H- NMR: (500 MHz, DMSO-d 6, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 12.96 (1H, -COOH), 10.39 (1H, OH), 7.93 (2H, d, J = 8.5 Hz, H-2'/6'), 6.93 (2H, d, J = 8.5 Hz, H-3'/5'), 6.84 (1H, d, J = 2.0 Hz, H-8), 6.83 (1H, s, H-3), 6.45 (1H, d, J = 2.0 Hz, H-6), 5.26 (1H, d, J = 7.5 Hz, H-1''), 4.05-3.31 (sugar protons, 4H, H-2'', H-3'', H-4'', H-5'').
13C NMR: (125 MHz, CD3OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 182.0 (C-4), 170.0 (C-6''), 164.3 (C-2), 162.5 (C-7), 161.4 (C-4'), 161.2 (C-5), 157.0 (C-9), 128.6 (C-2'/6'), 121.0 (C-1'), 116.0 (C-3'/5'), 105.5 (C-10), 103.1 (C-3), 99.4 (C-6), 99.2 (C-1''), 94.7 (C-8), 75.6 (C-3''), 75.4 (C-5''), 72.8 (C-2''), 71.2 (C-4'').
Example 3. The preparation of active compounds ( APC-311, APC-312 )
3-1. Preparation of crude extract (APE)
1kg of dried leaf of Agrimonia coreana NAKAI of which species has been identified in Example 1 was cut into small pieces and mixed with 20 fold volume of 70% ethanol(v/w). The mixture was extracted with reflux extraction at 70℃ for 4 hours to collect the filtrate, three times. The extract was filtered with filtration apparatus (R5PPMF01ES, Kajika Co.,) to remove the debris, five times. The collected filtrate was concentrated by rotary vacuum evaporator (Buchi, Ratavapor, R-300) at 55~65℃ under reduced pressure and dried with freezing dryer to obtain 460g of dried crude extract (designated as 'APE" hereinafter).
3-2. Preparation of purified extract and compounds ( APH13211, APH13212 )
The crude extract (APE) prepared in Example 3-1, was performed to successive fractionation with the identical volume of hexane and chloroform to afford 3 fractions (hexane fraction, chloroform fraction and water fraction) to be analyzed on HPLC with HPLC condition as shown in Table 2. The chloroform fraction showing the most potent activity, was performed to Silica gel column chromatography eluting with eluting solvents (hexane: ethylacetate: 10:1→0:1, v/v) to afford 7 fractions (AP-C-1, 2, 3, 4, 5, 6 and 7) through TLC analysis (developing solvents: hexane: ethylacetate: 1:1, v/v).
The AP-C-3 fraction showing the most potent activity among them, was concentrated and performed to the 1st Sephadex LH-20 column chromatography (eluting solvent: chloroform: methanol= 1:1, v/v) to afford 4 fractions (APC3-1, APC3-2, Fr.32-38 and APC3-5) through TLC analysis (developing solvents: hexane: ethylacetate: 1:1, v/v).
The Fr.32-38 fraction showing the abundant amount of active ingredients among them, was concentrated was performed to the 2nd Sephadex LH-20 column chromatography to isolate further purified 2 sub-fractions and then to be grouped,5 sub-groups, i.e, APC3-1, APC3-2, APC3-3, APC3-4 and APC3-5through TLC analysis (developing solvents: hexane: ethylacetate: 1:1, v/v).
The APC3-3 sub-fraction among them was concentrated and performed to preparative reverse phase (ODS) MPLC with eluting the suspension using by eluting solvent (distilled water: methanol= 30:70→0:100) to afford 4 purified fractions, i.e., MPLC-1, MPLC-2, MPLC-3 and MPLC-4 fractions. The MPLC-3 showing the most potent activity among them was concentrated and performed again to preparative HPLC (ODS column, 70~100% aq. acetonitrile, 1 ml/min) to afford APC-311 compound (2.8mg) and APC-312 compound (4.5mg).
The HPLC condition on the analysis of APC-311 compound and APC-312 compound was shown in Table 3.
HPLC condition (APC-311 compound and APC-312)
HPLC analysis condition
Analysis HITACHI Chromaster, HITACHI , Japan
Analysis condition
Column TSK-gel 100V (4.6 mmХ250 mm, 5 ㎛), TOSOH, Japan
Column Temperature 25 ℃
Mobile phase A : 3rd distilled water
B : Acetonitrile
Gradient Time Mobile phase A (%) Mobile phase B (%)
0 30 70
2 30 70
20 0 100
26 0 100
27 30 70
30 30 70
Injection volume 10 ㎕
Flow rate 1ml/min
3-3. structure analysis of APC-311 and APC-312
To the structure analysis of APC-311 and APC-312 prepared in the above, the compounds were dissolved in CD3OD to determine 1H- NMR and 13C- NMR (JEOL JNM-ECA600 600MHz FT-NMR spectrometer, JAPAN).
At the result, APC-311 was identified as Alphitolic acid showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature (Bae G.W et al., isolation of betulic acid and alphitolic acid from Ziziphus jujuba var. inermis , Archives of Pharmacal Research, 40(4), pp558-562, 1998; Sang-Myung Lee et al. Anti-complementary Activity of Triterpenoides from Fruits of Zizyphus jujuba. Biol. Pharm. Bull. 27(11) 1883-1886 (2004); Somin Park et al. Expedient Synthesis of Alphitolic Acid and Its Naturally Occurring 2-O-Ester Derivatives. J. Nat. Prod. 2019, 82, 895-902.)
Figure PCTKR2021014021-appb-C000003
<compound APC-311>
1H- NMR: (500 MHz, CD3OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 4.70 (1H, br s, H-29), 4.58 (1H, br, s, H-29), 3.60 (1H, m, H-2), 3.03 (1H, m, H-19), 2.88 (1H, d, J = 9.5 Hz, H-3), 2.33 (1H, m, H-13), 2.23 (1H, dt, J = 13.0, 3.0 Hz, H-16), 1.99 (1H, dd, J = 12.5, 4.5 Hz, H-1), 1.94 (1H, m, H-21), 1.89 (1H, m, H-22), 1.73 (1H, m, H-12), 1.69 (3H, s, H-30), 1.61 (1H, t, J = 11.5 Hz, H-18), 1.54 (1H, m, H-15), 1.53 (1H, m, H-6), 1.45 (1H, H-11), 1.44 (1H, H-7), 1.42 (1H, H-6), 1.42 (1H, H-22), 1.41 (1H, H-16), 1.38 (1H, H-7), 1.38 (1H, H-9), 1.38 (1H, H-21), 1.29 (1H, dd, J = 12.5, 4.5 Hz, H-11), 1.16 (1H, m, H-15), 1.07 (1H, m, H-12), 1.00 (3H, s, H-27), 0.98 (3H, s, H-23), 0.96 (3H, s, H-26), 0.91 (3H, s, H-25), 0.83 (1H, t, J = 12.0, H-1), 0.77 (3H, s, H-24), 0.79 (1H, m, H-5).
13C- NMR: (125 MHz, CD3OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 48.4 (C-1), 69.8 (C-2), 84.4 (C-3), 40.5 (C-4), 56.8 (C-5), 19.5 (C-6), 35.5 (C-7), 42.0 (C-8), 52.0 (C-9), 39.5 (C-10), 22.2 (C-11), 26.8 (C-12), 39.6 (C-13), 43.6 (C-14), 30.8 (C-15), 33.4 (C-16), 57.6 (C-17), 50.5 (C-18), 48.5 (C-19), 152.1 (C-20), 31.7 (C-21), 38.2 (C-22), 29.1 (C-23), 17.2 (C-24), 17.9 (C-25), 16.7 (C-26), 15.1 (C-27), 180.4 (C-28), 110.1 (C-29), 19.6 (C-30).
b. 2α,3β-dihydroxyolean-13(18)-en-28-oic acid :
APC-312 was identified as 2α,3β-dihydroxyolean-13(18)-en-28-oic acid showing following physio-chemical properties, which was confirmed by those disclosed in the previous literature.
Figure PCTKR2021014021-appb-C000004
<compound APC-312>
1H- NMR: (500 MHz, CD3OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 3.64 (1H, m, H-2), 2.91 (1H, d, J = 9.5 Hz, H-3), 2.79 (1H, m, H-12), 2.44 (1H, dd, J = 14.0, 2.0 Hz, H-19), 2.14 (1H, H-22), 2.06 (1H, dd, J = 12.5, 4.5 Hz, H-1), 1.90 (1H, m, H-16), 1.89 (1H, m, H-12), 1.76 (1H, m, H-15), 1.75 (1H, br d, J = 14.0 Hz, H-19), 1.57 (1H, H-9), 1.54 (1H, m, H-6), 1.54 (1H, H-11), 1.53 (1H, m, H-16), 1.46 (1H, H-7), 1.41 (1H, H-7), 1.38 (1H, m, H-11), 1.37 (1H, H-6), 1.31 (1H, H-21), 1.31 (1H, H-22), 1.21 (1H, H-21), 1.19 (3H, s, H-27), 1.13 (1H, m, H-15), 1.00 (3H, s, H-23), 0.96 (3H, s, H-25), 0.93 (1H, t, J = 12.0, H-1), 0.93 (3H, s, H-26), 0.92 (3H, s, H-29), 0.86 (1H, m, H-5), 0.78 (3H, s, H-24), 0.74 (3H, s, H-30).
13C- NMR: (125 MHz, CD3OD, JEOL JNM-ECZ500R 500 MHz FT-NMR spectrometer, Japan) δ (ppm) 48.4 (C-1), 69.7 (C-2), 84.5 (C-3), 40.5 (C-4), 56.8 (C-5), 19.5 (C-6), 36.1 (C-7), 42.7 (C-8), 52.1 (C-9), 39.6 (C-10), 22.9 (C-11), 26.3 (C-12), 139.1 (C-13), 45.6 (C-14), 28.3 (C-15), 34.3 (C-16), 49.5 (C-17), 129.9 (C-18), 42.0 (C-19), 33.6 (C-20), 38.0 (C-21), 36.9 (C-22), 29.2 (C-23), 17.4 (C-24), 18.2 (C-25), 18.4 (C-26), 21.5 (C-27), 180.7 (C-28), 32.7 (C-29), 24.7 (C-30).
Experimental Example 1. inhibition effect on T cell proliferation
In order to determine the anti-immunological activity of inventive extract, following inhibition test of proliferation of T cell isolated from human blood was performed according to the procedure disclosed in the literature ( J. Immunol. July 15, 2002, 169 (2) pp.802-808).
1-1. Preparation of test samples
In order to prepare the sufficient amount and various kinds of test samples, several compounds for test samples, i.e., Apigenin 7-glucuronide (Sigma-Aldrich, 04490590), luteolin 7-glucuronide (Sigma-Aldrich, 04480585), luteolin (Sigma-Aldrich, L9283), Apigenin (Sigma-Aldrich, 42251), Kaempferol (Sigma-Aldrich, K0133), Quercetin (Sigma-Aldrich, Q4951) were obtained from the company and Alphitolic acid was dissolved in DMSO to use in following test samples.
1-2. Isolation of T cell from human blood
In order to evaluate the anti-immunological activity of inventive extract, PBMC(peripheral blood mononuclear cell) and T cell which had been used in the various immunological analysis, were prepared from human blood using Fiicoll (GE17-5442-02, GE Healthcare) according to the previous literature (BIOPRESERVATION AND BIOBANKING, Volume 14, Number 5, 2016).
CD4+ T cell was carefully isolated from the isolated PBMC using by T cell isolation kit (130-096-533, Miltenyi biotec.) according to the manufacture's manual instruction.
1-3. Evaluation of inhibitory effect on T cell proliferation using by CFSE
The anti-immunological effect on T cell was evaluated by the inhibition effect on the proliferation of CD4+ T cell.
CFSE (Carboxyfluorescein diacetate succinimidyl ester, C34570, ThermoFisher Scientific) was treated to the isolated T cell to be 1μM to incubate for 30 mins at room temperature in an anti-glare condition and washed with DPBS (Dulbecco's Phosphate-Buffered Saline, LB 001-01, welgene) twice to finish staining the cell.
The stained T cells with CFSE were inoculated into 96 well plates (2 x 105 cells/well) and stimulated with anti-CD3 and anti-CD 28.
In order to determine the inhibition effect on the proliferation of T cell of inventive compounds, the compounds in DMSO were inoculated into the well plate to be 100 μg/mL with the stimuli of anti-CD3 and anti-CD 28.
10 μM BTP2( [N-{4-[3,5-bis(Trifluoromethyl)-1H-pyrazol-1-yl]phenyl}-4-methyl-1,2,3-thiadiazole-5-carboxamide] , 203890-M, Calbiochem) was used as a control group.
The T cell treated with test sample was incubated at 37℃ for 72 hours in 5% CO2 incubator (MCO-18AC, Panasonic) and then the cell was collected to be analyzed using Flow cytometry (BD LSRFortessa, BD Biosciences).
As can be seen in Fig. 1, it has been confirmed that there has no proliferation of T cell in the group treated without anti-CD3 and anti-CD 28 ((-)CD3, CD28) whereas there has sufficient proliferation of T cell in the group treated with anti-CD3 and anti-CD 28 ((+)CD3, CD28).
Additionally, it has been confirmed that there has sufficient proliferation of T cell in the group treated with BTP2, similarly to the result in the group treated without anti-CD3 and anti-CD 28 ((-)CD3, CD28).
Finally, it has been confirmed that the proliferation of CD4+ T cell in the group treated with the inventive compounds isolated from Agrimonia coreana NAKAI has been unexpectedly inhibited (Alphitolic acid: 0.3μM : 10.55±2.35%, 1μM : 29.98±0.914%, 3μM : 80.18±7.11%/ Apigenin 7-glucuronide: 10μM : 24.1±3.949%, 100μM : 91.16±1.144%/ Luteolin 7-glururonide: 10μM : 41.1±3.286%, 100μM : 95.8±0.118%/ Kaempferol: 10μM : 89.52±0.632%, 100μM : 96.42±0.516%, See Table 4)
inhibition effect on CD4+ T cell proliferation (compounds)
Compound concentration Inhibition ratio on the proliferation of CD4+ T cell (%)
Alphitolic acid 0.3 μM 10.55 ± 2.35
1 μM 29.98 ± 0.914
3 μM 80.18 ± 7.11
Apigenin 7-glucuronide 10 μM 24.1 ± 3.949
100 μM 91.16 ± 1.144
Luteolin 7-glururonide 10 μM 41.1 ± 3.286
100 μM 95.8 ± 0.118
Kaempferol 10 μM 89.52 ± 0.632
100 μM 96.42 ± 0.516
Experimental Example 2. inhibition effect on ORAI1 ion channel regulating calcium signaling in cell
In order to determine the anti-immunolgical activity of inventive compouds, following inhibition test of ORAI1 ion channel was performed according to the procedure disclosed in the literature (The American Journal of Chinese Medicine, Vol. 47, No. 7, 1-15).
It has been reported that the activation of an immune cell such as the proliferation of T cell, the reproduction and release of cytokines etc, is induced by the increased calcium level in cells through ORAI1 ion channel and an increase in intracellular levels of calcium ions (Ca2+) results from the engagement of immunoreceptors, such as the T-cell receptor, B-cell receptor and Fc receptors, as well as chemokine and co-stimulatory receptors. T (Nat Rev Immunol. 2007 Sep;7(9):690-702.).
The inhibition effect on ORAI1 ion channel which can increase the cellular calcium signaling pathway, an important pathway to induce the proliferation of T cell.
The extracellular fluid for patch clamp analysis was prepared to contain 135mM NaCl, 3.6mM KCl, 1mM MgCl2, 10mM CaCl2, 5mM D-glucose, 10mM HEPES(H3375, Sigma) and adjusted to pH 7.4 with NaOH. The intracellular fluid for patch clamp analysis was prepared to contain 130mM Cs-glutamate, 20mM BAPTA, 1mM MgCl2, 3mM MgATP, 0.002mM sodium pyruvate, 20mM HEPES (H3375, Sigma) and adjusted to pH 7.2 with CsOH (C8518, Sigma).
The ORAI1 electric current was determined by using Axopatch 200B amplifier (Axon Axopatch 200B Microelectrode Amplifier, Molecular Devices) and Digidata 1440A(Axon digidata 1440A, Molecular Devices) and the data was analyzed by pClamp10.4(pClamp10.4, Molecular Devices).
The ramp-pulse for recording electric current was changed to -130mV ~ 50mV for 100msec and the voltage of cellular membrane was fixed to -10mM to record every 20 seconds, repeatedly.
In order to compare the inhibition degree of test samples showing anti-immunological activity, 10 μM BTP2 (2038890-M, Calbiochm), a ORAI1 inhibitor, was poured into the chamber to confirm the inhibition of electric current at the end of determination.
As can be seen in Fig. 2, it has been confirmed that the activated ORAI1 electric current in the group treated with the inventive compounds isolated from Agrimonia coreana NAKAI has been unexpectedly inhibited (Luteolin 7-glucuronide : 51.31±5.293%/Apigenin 7-glucuronide : 51.5±5.083%/Alphitolic acid: 1 μM : 34.46±6.067%, 10 μM : 76.88±2.923%/ 2α,3β-dihydroxyolean-13(18)-en-28-oic acid : 39.22±9.920%/Apigenin : 38.95±6.851%/Kaempferol : 53.29±5.125%/Luteolin : 20.16±2.361%/Quercetin : 32.33±4.642%, See Table 5).
inhibition effect on activated ORAI1 electric current
compound concentration ORAI1 inhibition ratio (%)
Alphitolic acid 1 μM 34.46 ± 6.067
10 μM 76.88 ± 2.923
2α,3β-dihydroxyolean-13(18)-en-28-oic acid 100 μM 39.22 ± 9.920
apigenin 7-glucuronide 100 μM 51.5 ± 5.083
luteolin 7-glucuronide 100 μM 51.31 ± 5.293
Apigenin 100 μM 38.95 ± 6.851
Luteolin 100 μM 20.16 ± 2.361
Kaempferol 100 μM 53.29 ± 5.125
Quercetin 100 μM 32.33 ± 4.642
Statistics analysis
All data were expressed in mean and standard deviation (mean±SD), and statistical significance verification was determined to be significant (P < 0.05 ), using one-way ANOVA and Dunnett's multiple comparison test as a post hoc test.
Hereinafter, the formulating methods and kinds of excipients will be described, but the present invention is not limited to them. The representative preparation examples were described as follows.
Preparation of injection
APH13211 compound: 100mg
Sodium metabisulfite : 3.0mg
Methyl paraben : 0.8mg
Propyl paraben : 0.1mg
Distilled water for injection : optimum amount
Injection preparation was prepared by dissolving active component, controlling pH to about 7.5 and then filling all the components in 2㎖ ample and sterilizing by conventional injection preparation method.
Preparation of powder
APH13212 compound: 500mg
Corn Starch : 100mg
Lactose : 100mg
Talc : 10mg
Powder preparation was prepared by mixing above components and filling sealed package.
Preparation of tablet
APH-311 compound: 200mg
Corn Starch 100mg
Lactose 100mg
Magnesium stearate optimum amount
Tablet preparation was prepared by mixing above components and entabletting.
Preparation of capsule
APH-312 compound: 100mg
Lactose : 50mg
Corn starch : 50mg
Talc : 2mg
Magnesium stearate optimum amount
Tablet preparation was prepared by mixing above components and filling gelatin capsule by conventional gelatin preparation method.
Preparation of liquid
APH13211 compound : 1000mg
Sugar : 20g
Polysaccharide : 20g
Lemon flavor : 20g
Liquid preparation was prepared by dissolving active component, and then filling all the components in 1000㎖ ample and sterilizing by conventional liquid preparation method.
Preparation of health food
APH13212 compound: 1000mg
Vitamin mixture : optimum amount
Vitamin A acetate : 70g
Vitamin E : 1.0mg
Vitamin B10 : 13mg
Vitamin B2 : 0.15mg
Vitamin B6 : 0.5mg
Vitamin B1 : 20.2g
Vitamin C : 10mg
Biotin : 10g
Amide nicotinic acid : 1.7mg
Folic acid : 50g
Calcium pantothenic acid : 0.5mg
Mineral mixture : optimum amount
Ferrous sulfate : 1.75mg
Zinc oxide : 0.82mg
Magnesium carbonate : 25.3mg
Monopotassium phosphate : 15mg
Dicalcium phosphate : 55mg
Potassium citrate : 90mg
Calcium carbonate : 100mg
Magnesium chloride : 24.8mg
The above mentioned vitamin and mineral mixture may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention.
Preparation of health beverage
APH-311 compound: 1000mg
Citric acid : 1000mg
Oligosaccharide : 100g
Apricot concentration : 2g
Taurine : 1g
Distilled water : 900㎖
Health beverage preparation was prepared by dissolving active component, mixing, stirred at 85oC for 1 hour, filtered and then filling all the components in 1000㎖ ample and sterilizing by conventional health beverage preparation method.
The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the present invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.
As described in the present invention, the inventive compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, showed potent immune-modulating activity through various tests such inhibition effect on T cell proliferation (Experimental Example 1), inhibition effect on ORAI1 ion channel regulating calcium signaling in cell (Experimental Example 2) and therefore the compounds can be useful in treating or inhibiting effect on various immune involved diseases.

Claims (9)

  1. A pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin as an active ingredient in an effective amount to treat and prevent immune involved diseases.
  2. A pharmaceutical composition comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin, as an active ingredient and the pharmaceutically acceptable carriers or excipients, for the treatment and prevention of immune involved diseases.
  3. The pharmaceutical composition according to claim 1 or 2,
    wherein said immune involved diseases is (a) immune-sensitivity syndrome caused by impaired immune system such as autoimmune diseases, organ rejection, hypersensitivity allergic diseases etc; and (b) immune deficiency syndrome such as the immuno-deficiency syndrome caused by chemotherapy or radiation therapy; or immuno-deficiency syndrome caused by bone marrow transplantation, HIV infection, cancer disease, etc, specifically, (a) immune-sensitivity syndrome such as autoimmune, atopic dermatitis, acute or chronic urticarial; (b) immune deficiency syndrome such as bacterial/viral infections in older adults, chronic respiratory infections, chronic urinary tract infections, bedsores, flu, pneumonia, pox, measles, sudden rash, foot-and-mouth disease, rubella, or Crohn's disease.
  4. A health functional food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin for the prevention or alleviation of immune involved diseases.
  5. The pharmaceutical composition according to claim 4,
    wherein said immune involved diseases is (a) immune-sensitivity syndrome caused by impaired immune system such as autoimmune diseases, organ rejection, hypersensitivity allergic diseases etc; and (b) immune deficiency syndrome such as the immuno-deficiency syndrome caused by chemotherapy or radiation therapy; or immuno-deficiency syndrome caused by bone marrow transplantation, HIV infection, cancer disease, etc, specifically, (a) immune-sensitivity syndrome such as autoimmune, atopic dermatitis, acute or chronic urticarial; (b) immune deficiency syndrome such as bacterial/viral infections in older adults, chronic respiratory infections, chronic urinary tract infections, bedsores, flu, pneumonia, pox, measles, sudden rash, foot-and-mouth disease, rubella, or Crohn's disease.
  6. The health functional food according to claim 4, wherein said health functional food is provided as powder, granule, tablet, capsule, pill, suspension, emulsion, syrup, tea bag, leached tea, or beverage type.
  7. A health care food comprising the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin together with a sitologically acceptable additive for the prevention or alleviation of immune involved diseases.
  8. A use of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin, for manufacture of medicines employed for treating or preventing immune involved diseases.
  9. A method of treating or preventing immune involved diseases in a mammal comprising administering to said mammal an effective amount of the compounds isolated from the extract of Agrimonia coreana NAKAI, a Korean native plant, selected from luteolin 7-glucuronide (APH13211), apigenin 7-glucuronide (APH132122), α,3β-dihydroxyolean-13(18)-en-28-oic acid (APC-312), Alphitolic acid (APC-311), luteolin, apigenin, kaempferol or quercetin, into the mammal suffering from immune involved diseases.
PCT/KR2021/014021 2020-10-19 2021-10-12 A composition comprising the compounds isolated from an extract of agrimonia coreana nakai as an active ingredient for preventing or treating immune-involved disease and the use thereof WO2022086020A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0135544 2020-10-19
KR20200135544 2020-10-19
KR1020210061187A KR20220052260A (en) 2020-10-19 2021-05-12 a composition comprising the compound isolated from an extract of Agrimonia corana NAKAI as an active ingredient for preventing or treating immune-involved disease
KR10-2021-0061187 2021-05-12

Publications (1)

Publication Number Publication Date
WO2022086020A1 true WO2022086020A1 (en) 2022-04-28

Family

ID=81290803

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/014021 WO2022086020A1 (en) 2020-10-19 2021-10-12 A composition comprising the compounds isolated from an extract of agrimonia coreana nakai as an active ingredient for preventing or treating immune-involved disease and the use thereof

Country Status (2)

Country Link
KR (1) KR20220098094A (en)
WO (1) WO2022086020A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120003317A (en) * 2010-07-02 2012-01-10 성균관대학교산학협력단 Composition for inhibiting the degranulation of mast cell comprising plant extracts
KR20160096851A (en) * 2015-02-06 2016-08-17 대구가톨릭대학교산학협력단 A composition comprising compounds isolated from Agrimonia pilosa Ledeb. for preventing or treating metabolic disorder

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120003317A (en) * 2010-07-02 2012-01-10 성균관대학교산학협력단 Composition for inhibiting the degranulation of mast cell comprising plant extracts
KR20160096851A (en) * 2015-02-06 2016-08-17 대구가톨릭대학교산학협력단 A composition comprising compounds isolated from Agrimonia pilosa Ledeb. for preventing or treating metabolic disorder

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KUBÍNOVÁ RENATA, JANKOVSKÁ DAGMAR, BAUEROVÁ VERONIKA: "Antioxidant and α-glucosidase inhibition activities and polyphenol content of five species of agrimonia genus", ACTA FYTOTECHNICA ET ZOOTECHNICA, 1 January 2012 (2012-01-01), pages 38 - 41, XP055923240 *
KUBÍNOVÁ RENATA, ŠVAJDLENKA EMIL, JANKOVSKÁ DAGMAR: "Anticholinesterase, antioxidant activity and phytochemical investigation into aqueous extracts from five species of Agrimonia genus", NATURAL PRODUCT RESEARCH, vol. 30, no. 10, 18 May 2016 (2016-05-18), GB , pages 1174 - 1177, XP009535892, ISSN: 1478-6419, DOI: 10.1080/14786419.2015.1043552 *
NAM, H.-H.: "Antioxidant and anti-inflammatory effect in LPS-induced RAW264.7 cells of Agrimonia coreana extracts", 1 January 2014 (2014-01-01), Korea, pages 1 - 28, XP009541446 *

Also Published As

Publication number Publication date
KR20220098094A (en) 2022-07-11

Similar Documents

Publication Publication Date Title
WO2013176512A1 (en) Panax spp. plant extract with increased content ratio of ginsenoside rg3, rg5, and rk1 produced by microwave irradiation, a method of preparing the panax spp. plant extract, and a composition including the panax spp. plant extract
WO2014104672A1 (en) A purified extract isolated from pseudolysimachion rotundum var. subintegrum containing abundant amount of active ingredient, the preparation thereof, and the composition comprising the same as an active ingredient for preventing or treating inflammation, allergy and asthma
WO2011062354A2 (en) Method for preparing gintonin, which is a novel glycolipoprotein from panax ginseng, and gintonin, which is a novel glycolipoprotein, prepared by the method
WO2015160219A1 (en) Pharmaceutical composition comprising pistacia weinmannifolia extract, fraction of same or compound separated from same for preventing or treating chronic obstructive pulmonary disease (copd)
WO2022035115A1 (en) Composition for prevention and treatment of skeletal muscle-related diseases containing alnus japonica extract or compound isolated therefrom and use thereof
WO2010079914A2 (en) A composition comprising the compound isolated from the extract of rubiae radix for preventing and treating inflammatory diseases
WO2014027832A1 (en) Composition for preventing or treating colitis
WO2014175543A1 (en) Composition for preventing, relieving or treating colitis, containing complex extracts
WO2015037778A1 (en) Composition containing lignan compound as active ingredient for preventing or treating cancer
WO2012043949A1 (en) Composition for enhancing immunity containing compounds represented by chemical formulas 1-8 or sophora flavescens extract as active ingredient
WO2012067316A1 (en) Composition for prevention or treatment of metabolic diseases or complications thereof containing pterocarpan-based compounds or pharmaceutically acceptable salts thereof as active ingredient, or composition for antioxidation
WO2010090498A2 (en) Pharmaceutical composition and health food composition containing youngia denticulata extract, fraction thereof, or compound isolated therefrom as active ingredient for improving liver function
WO2021080297A1 (en) Composition containing evening primrose flower extract as active ingredient for preventing or treating obesity or metabolic syndromes induced thereby
WO2018106002A1 (en) Composition for preventing and treating male infertility, containing compound combination comprising flavonoid derivative and iridoid derivative as active ingredient, and use thereof
WO2022086020A1 (en) A composition comprising the compounds isolated from an extract of agrimonia coreana nakai as an active ingredient for preventing or treating immune-involved disease and the use thereof
WO2018221922A1 (en) Composition for preventing and treating muscle-related diseases, containing coptidis rhizoma extract, and use thereof
WO2012093787A2 (en) Composition for activating gabaa benzodiazepine receptor and composition for anxiety alleviation, convulsion reduction, sedation and sleep induction and improvement containing phloroglucinol, phlorotannin or brown algae extract
WO2018105998A1 (en) Composition for preventing and treating male infertility, containing flavonoid derivative compound as active ingredient, and use thereof
WO2022086019A1 (en) A purified extract isolated from agrimonia coreana nakai containing abundant amount of active ingredient, the preparation thereof, the composition comprising the same as an active ingredient for preventing or treating inflammation, allergy and atopic dermatitis and the use thereof
WO2012081831A2 (en) Composition comprising the extract of loranthus yadoriki sieb having monoamine oxidase-inhibiting activity
WO2015002430A1 (en) Pharmaceutical composition for preventing or treating asthma comprising pistacia weinmannifolia j. poiss. ex franch extract or fraction thereof
WO2016204493A1 (en) A novel compound (ks 513) isolated from pseudolysimachion rotundum var. subintegrum, the composition comprising the same as an active ingredient for preventing or treating allergy disease, inflammatory disease, asthma or chronic obstructive pulmonary disease and the use thereof
WO2009151236A2 (en) The composition comprising extracts or fractions of magnolia obovata thunb for treating and preventing inflammation disease
WO2018105999A1 (en) Composition for preventing and treating male infertility, containing iridoid derivative compound as active ingredient, and use thereof
WO2010143825A2 (en) Anti-arthritic agent using cyathula officinalis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21883091

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21883091

Country of ref document: EP

Kind code of ref document: A1