KR20220076397A - Pharmaceutical composition for preventing or treating of inflammatory skin diseases comprising sargassum fusiforme extract as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the treatment of inflammatory skin diseases, comprising the extract of Japanese hibiscus as an active ingredient. Specifically, the extract or fraction of hibiscus according to the present invention has excellent antioxidant and anti-inflammatory activity, inhibits the growth of Staphylococcus aureus and Staphylococcus aureus found in patients with atopic dermatitis, and suppresses the expression of T cell-dependent cytokines And, by significantly suppressing the levels of IgE and IL-4 in serum in atopic dermatitis animal models, it can be usefully used in the treatment of inflammatory skin diseases including atopic dermatitis.

Description

Pharmaceutical composition for the treatment of inflammatory skin diseases, comprising extract of hibiscus extract as an active ingredient

The present invention relates to a pharmaceutical composition for the treatment of inflammatory skin diseases, comprising the extract of Japanese hibiscus as an active ingredient.

The skin is the outermost organ of the human body, and acts as a barrier to protect the body by protecting moisture and blocking intrusion factors from the outside. Factors that cause skin inflammation include physical and chemical stimuli, allergens, UV rays, oxidative stress, and infection by pathogens. The general pathway of the skin inflammatory response is an immune response to protect the human body from external stimuli.

Cytokines and chemokines generated during the infiltration of inflammatory cells such as T cells or eosinophils expressing skin lymphocyte-related antigens into the lesion are involved in the initiation and maintenance of an inflammatory response in skin inflammatory lesions. In addition, it is known that receptors related thereto are expressed in cells such as inflammatory cells, keratinocytes, and fibroblasts.

Currently, steroid preparations, topical immunosuppressants, topical antibiotics and antihistamines are used as therapeutic agents for inflammatory skin diseases, but when used for a long time, fattening striatum, skin atrophy, capillary dilatation, steroid acne, hirsutism, purpura, etc. side effects may occur. In particular, when a steroid is applied to a wide area, the drug is absorbed systemically through the skin, which may impede the growth of children, and may cause systemic side effects such as osteoporosis in adults. Therefore, the development of a material for effectively treating inflammatory skin disease with few side effects is being studied, and Korean Patent Registration No. 10-1847128 discloses that nipa palm flower stalk extract provides a continuous moisturizing effect and exhibits anti-inflammatory activity without side effects. As a result, it is disclosed that it can be used to treat inflammatory skin diseases.

Atopic dermatitis, one of such inflammatory skin diseases, is caused by genetic and environmental factors, and is accompanied by symptoms such as severe itching, dry skin, and skin lesions. In atopic dermatitis, when the skin barrier is damaged, various inflammatory cytokines are expressed in keratinocytes, and accordingly, an inflammatory response mediated by T helper type 2 cells is induced. Type 2 T helper cells secrete interleukin-4, interleukin-13, and the like, thereby increasing the secretion of immunoglobulin E (IgE). Afterwards, in a chronic state, various T cells penetrate the skin and an autoimmune reaction is added to cause permanent skin inflammation.

In this regard, Korean Patent Laid-Open No. 10-2020-0126882 discloses that 6-diazo-5-oxo-L-norleucine or a pharmaceutically acceptable salt thereof is used for the treatment of inflammatory skin diseases including atopic dermatitis. discloses that it is possible.

Korean Patent Publication No. 10-2020-0126882

SUMMARY OF THE INVENTION It is an object of the present invention to provide a use for treating inflammatory skin diseases of the extract and its fractions.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

In addition, the present invention provides a health functional food for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

In addition, the present invention provides a cosmetic composition for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

Furthermore, the present invention provides a skin external preparation for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

The extract or fraction of hibiscus according to the present invention has excellent antioxidant and anti-inflammatory activity, inhibits the growth of Staphylococcus aureus and Staphylococcus epidermis found in patients with atopic dermatitis, suppresses the expression of T cell-dependent cytokines, and suppresses atopic dermatitis. By significantly suppressing the levels of IgE and IL-4 in serum in an animal model of dermatitis, it can be usefully used in the treatment of inflammatory skin diseases including atopic dermatitis.

1 is a view showing the results of confirming the protein protection effect using a metal ion catalyzed reaction of an extract of Japanese daisy in an embodiment of the present invention.
Figure 2 is a view of the result of confirming the DPPH radical scavenging ability of the extract of Japanese daisy in an embodiment of the present invention.
3 is a view showing the results of confirming the DPPH radical scavenging ability of the extract and fractions of Japanese daisy in an embodiment of the present invention.
Figure 4 is a graph of the result of confirming the nitrogen monoxide inhibitory activity of the extract of Japanese daisy in an embodiment of the present invention.
5 is a graph showing the results of confirming the nitric oxide production inhibitory activity of Japanese shiitake extract and fractions in an embodiment of the present invention.
6 is a graph showing the results of confirming the inhibitory effect on the expression of inflammatory cytokines of the Shiitake extract in an embodiment of the present invention.
7 is a view showing the result of confirming the agarose gel electrophoresis effect on the inflammatory cytokine expression inhibitory effect of Shiitake extract and fractions in an embodiment of the present invention.
8 is a graph showing the results of confirming the inhibitory effect on the expression of inflammatory cytokines of the extract of Japanese daisy in an embodiment of the present invention.
9 is a graph showing the results of confirming the inhibitory effect on the expression of inflammatory cytokines of the shiitake fraction in an embodiment of the present invention.
10 is a graph showing the results of confirming the antibacterial activity against Staphylococcus aureus and Staphylococcus epidermidis of the shiitake fraction in an embodiment of the present invention.
11 is a graph showing the results of confirming the effect of inhibiting the expression of IL-4, IFNγ and IL-2, which are T cell-dependent cytokines, of a shiitake fraction in an embodiment of the present invention.
12 is a graph showing the results of confirming the effect of inhibiting the expression of T cell-dependent cytokines, IL-2 and CD25, of the extracts and fractions of Japanese daisy in an embodiment of the present invention.
13 is a graph showing the results of confirming the effect of inhibiting the expression of CD25, a T-cell-dependent cytokine, of a shiitake fraction in an embodiment of the present invention.
14 is a graph showing the results of confirming the inhibitory effect on the IgE and IL-4 levels in the serum of an atopic dermatitis animal model of an extract of the Japanese atopic dermatitis in an embodiment of the present invention.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

As used herein, the term " Hizikia fusiforme )" is a seaweed of the brown algae family Mosquito, meaning perennial seaweeds that live in the lower intertidal zone and exist only in the sexual generation. As it contains a lot of inorganic salts such as calcium, iodine, and iron, it can exhibit physiological activities such as preventing hyperthermia and hardening of the fetus and strengthening the bones of the fetus.

The shiitake extract may be prepared by a manufacturing method comprising the following steps:

1) preparing an extract by adding an extraction solvent to shiitake;

2) filtering the extract of step 1); and

3) drying the filtered filtrate of step 2) after concentration under reduced pressure.

In addition, the extraction solvent may be water, alcohol, or a mixture thereof. The alcohol may be a C ₁ to C ₂ lower alcohol, and specifically, the alcohol may be ethanol, methanol, or alcohol. The alcohol may be appropriately diluted and used as necessary. In one example, the alcohol is 5 to 95%, 5 to 90%, 5 to 80%, 5 to 70%, 5 to 60%, 5 to 50%, 5 to 40%, 5 to 30%, 5 to 20% , 5 to 15%, 15 to 95%, 15 to 90%, 15 to 80%, 15 to 70%, 15 to 60%, 15 to 40%, 15 to 30%, 15 to 20%, 30 to 95% , 30 to 90%, 30 to 80%, 30 to 70%, 30 to 60%, 30 to 50%, 30 to 40%, 40 to 95%, 40 to 90%, 40 to 80%, 40 to 70% , 40-60%, 40-50%, 50-95%, 50-90%, 50-80%, 50-70%, 50-60%, 60-95%, 60-90%, 60-80% , 60 to 70%, 70 to 95%, 70 to 90% or 70 to 80% may be included.

The extraction solvent may be added in an amount of 3 to 30 times, 3 to 25 times, 3 to 20 times, 7 to 30 times, 7 to 25 times, or 7 to 20 times the mass of hibiscus.

The extraction method may be shaking extraction, Soxhlet extraction or reflux extraction. In this case, the extraction time may be 1 to 70 hours, 1 to 60 hours, 1 to 50 hours, 1 to 40 hours, 1 to 30 hours, 1 to 20 hours, or 1 to 10 hours. The extraction may be repeated one or more times.

On the other hand, the vacuum concentration in step 3) may use a vacuum vacuum concentrator or a vacuum rotary evaporator. In addition, the drying may be reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, specifically, may be freeze drying.

The fraction may be a fraction obtained by adding an organic solvent to the extract of Japanese daisy. In this case, as the organic solvent, all kinds of organic solvents used in the preparation of fractions in the conventional technical field may be used. For example, the organic solvent may include any one or more selected from the group consisting of hexane, chloroform, acetate, and butanol. Specifically, the fraction may be obtained by sequentially fractionating the extract of Japanese hibiscus with hexane, chloroform and ethyl acetate. In this case, the organic solvent may be appropriately diluted if necessary. For example, the organic solvent is 5 to 95%, 5 to 90%, 5 to 80%, 5 to 70%, 5 to 60%, 5 to 50%, 5 to 40%, 5 to 30%, 5 to 20 %, 5-15%, 15-95%, 15-90%, 15-80%, 15-70%, 15-60%, 15-40%, 15-30%, 15-20%, 30-95 %, 30-90%, 30-80%, 30-70%, 30-60%, 30-50%, 30-40%, 40-95%, 40-90%, 40-80%, 40-70 %, 40-60%, 40-50%, 50-95%, 50-90%, 50-80%, 50-70%, 50-60%, 60-95%, 60-90%, 60-80 %, 60 to 70%, 70 to 95%, 70 to 90% or 70 to 80%.

In another aspect, the fraction may be obtained by fractionating the hibiscus extract into a mixture of hexane and chloroform, a mixture of hexane and ethyl acetate, a mixture of chloroform and ethyl acetate, or a mixture of hexane and ethyl acetate. In addition, the fraction may be obtained by fractionating the hibiscus extract into a mixture of hexane and chloroform, a mixture of hexane and ethyl acetate, a mixture of chloroform and ethyl acetate, or a mixture of hexane and ethyl acetate, and partitioning the obtained water layer with ethyl acetate. In another aspect, the fraction may be obtained by fractionation with a mixture of hexane, chloroform and ethyl acetate. When an organic solvent is mixed and used in the preparation of the fraction, the mixing ratio of the organic solvent may be appropriately determined by a person skilled in the art. In an embodiment of the present invention, when a mixture of hexane and chloroform is used, the hexane and chloroform are 1:0.1 to 1:5, 1:0.1 to 1:3, 1:0.1 to 1:2, 1:0.3 to 1:5, 1:0.3 to 1:3, or 1:0.3 to 1:2.

The fraction may be obtained by fractionating the hibiscus extract one or more times or 1 to 5 times. The fractions can be concentrated and dried as described above.

The inflammatory skin disease may be caused by a T cell-dependent inflammatory response or an autoimmune response. As an example, the inflammatory skin disease may be atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.

The pharmaceutical composition according to the present invention may contain 10 to 95% by weight of an active ingredient, such as a hibiscus extract, a fraction thereof, or a mixture thereof, based on the total weight of the composition. In addition, the pharmaceutical composition of the present invention may further include at least one active ingredient exhibiting the same or similar function in addition to the active ingredient.

The pharmaceutical composition of the present invention may include a carrier, diluent, excipient or a mixture thereof commonly used in biological agents. Any pharmaceutically acceptable carrier may be used as long as it is suitable for delivering the composition in vivo. Specifically, the carrier is Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, dextrose solution, maltodextrin solution, glycerol, ethanol, or mixtures thereof. In addition, conventional additives such as antioxidants, buffers, and bacteriostats may be added as needed.

When formulating the composition, commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents or excipients such as surfactants may be added.

The composition of the present invention may be formulated as an oral preparation or a parenteral preparation. Oral formulations may include solid formulations and liquid formulations. The solid preparation may be a tablet, pill, powder, granule, capsule, or troche, and the solid preparation may be prepared by adding at least one excipient to the composition. The excipient may be starch, calcium carbonate, sucrose, lactose, gelatin, or a mixture thereof. In addition, the solid formulation may contain a lubricant, examples of which include magnesium stearate, talc, and the like. Meanwhile, the liquid formulation may be a suspension, an internal solution, an emulsion, or a syrup. In this case, the liquid formulation may include excipients such as wetting agents, sweetening agents, fragrances, and preservatives.

The parenteral formulation may include injections, suppositories, powders for respiratory inhalation, aerosols for sprays, powders and creams, and the like. The injection may include a sterile aqueous solution, a non-aqueous solution, a suspension solution, an emulsion, and the like. In this case, as the non-aqueous solvent or suspension solution, vegetable oils such as propylene glycol, polyethylene glycol, and olive oil, or injectable esters such as ethyl oleate may be used.

The composition of the present invention may be administered orally or parenterally according to a desired method. Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular or intrathoracic injection.

The composition may be administered in a pharmaceutically effective amount. This may vary depending on the type of disease, severity, drug activity, patient's sensitivity to the drug, administration time, administration route, treatment period, drugs used at the same time, and the like. However, for a desirable effect, the amount of the active ingredient included in the pharmaceutical composition according to the present invention may be 0.0001 to 1,000 mg/kg, specifically 0.001 to 500 mg/kg. The administration may be several times a day.

The composition of the present invention may be administered alone or in combination with other therapeutic agents. When administered in combination, the administration may be sequential or simultaneous.

In addition, the present invention provides a health functional food for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

The extract, a fraction thereof, or a mixture thereof included as an active ingredient in the health functional food according to the present invention may have the characteristics as described above. As an example, the extract of Japanese hibiscus may be extracted with water, a C1 to C2 lower alcohol, or a mixture thereof. In addition, the fraction may be obtained by sequentially fractionating the extract of Japanese hibiscus with hexane, chloroform and ethyl acetate.

The shiitake extract of the present invention, a fraction thereof, or a mixture thereof may be added to food as it is, or used together with other food or food ingredients. In this case, the content of the added active ingredient may be determined according to the purpose, and may generally be 0.01 to 90 parts by weight based on the total weight of the food.

The form and type of health functional food is not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids and pills. The health functional food may include various flavoring agents, sweetening agents, or natural carbohydrates as additional ingredients. The sweetener may be a natural or synthetic sweetener, and examples of the natural sweetener include thaumatin, stevia extract, and the like. Meanwhile, examples of synthetic sweeteners include saccharin, aspartame, and the like. In addition, the natural carbohydrates may be monosaccharides, disaccharides, polysaccharides, oligosaccharides and sugar alcohols.

The health functional food of the present invention, in addition to the above-described additional ingredients, nutrients, vitamins, electrolytes, flavoring agents, colorants, pextan and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives , glycerin, alcohol, and the like may be further included. These components may be used independently or in combination. The proportion of the additive may be selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention provides a cosmetic composition for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

An extract, a fraction thereof, or a mixture thereof included as an active ingredient in the cosmetic composition according to the present invention may have the characteristics as described above. As an example, the extract of Japanese hibiscus may be extracted with water, a C1 to C2 lower alcohol, or a mixture thereof. In addition, the fraction may be obtained by sequentially fractionating the extract of Japanese hibiscus with hexane, chloroform and ethyl acetate.

The inflammatory skin disease may be atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, or papular urticaria.

In addition, the cosmetic composition may include 0.1 to 50% by weight, specifically, 1 to 10% by weight of the extract, a fraction thereof, or a mixture thereof according to the present invention, which is an active ingredient thereof. The cosmetic composition may be applied directly to the skin for the purpose of skin improvement.

The cosmetic composition may be formulated in a conventionally prepared cosmetic formulation. The cosmetic composition may be formulated as a solution, suspension, emulsion, paste, gel, lotion, cream, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation and spray. Specifically, it may be a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide or mixtures thereof. In addition, when the formulation of the cosmetic composition is powder or spray, it may include lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or a mixture thereof. In particular, in the case of a spray, chlorofluorohydrocarbon, propane/butane or dimethyl ether may be further included.

When the formulation of the cosmetic composition of the present invention is a solution or emulsion, it may include a solvent, a solvating agent, an emulsifying agent, or a mixture thereof as a carrier. Examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, sorbitan fatty acid ester, and the like.

When the formulation of the cosmetic composition of the present invention is a suspension, as a carrier, a liquid diluent such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester; microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth or mixtures thereof. In addition, when the formulation of the cosmetic composition is surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid as a carrier amide ether sulfates, alkalamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, ethoxylated glycerol fatty acid esters, or mixtures thereof.

In addition to the carrier component, the cosmetic composition of the present invention may include an antioxidant, a stabilizer, a solubilizer, a moisturizing agent, a pigment, a fragrance, a sunscreen, a color developer, a surfactant, or a mixture thereof as an adjuvant. The adjuvant may be used as long as it is a material commonly used in the preparation of a cosmetic composition.

Furthermore, the present invention provides a skin external preparation for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

The extract, a fraction thereof, or a mixture thereof included as an active ingredient in the external preparation for skin according to the present invention may have the characteristics as described above. As an example, the extract of Japanese hibiscus may be extracted with water, a C1 to C2 lower alcohol, or a mixture thereof. In addition, the fraction may be obtained by sequentially fractionating the extract of Japanese hibiscus with hexane, chloroform and ethyl acetate.

The external preparation for skin may include a pharmaceutically acceptable carrier and excipient. The carrier and excipient may include preservatives, stabilizers, wetting agents, emulsification accelerators and buffers, and the like. Specifically, the excipient may be lactose, dextrin, starch, mannitol, sorbitol, glucose, saccharose, microcrystalline cellulose, gelatin, polyvinylpyrrolidone, or a mixture thereof. The external preparation for skin may be appropriately prepared according to a method well known in the art. The external preparation for skin may be prepared in the form of powder, gel, ointment, cream, liquid and aerosol.

Hereinafter, the present invention will be described in detail by the following examples, provided that the following examples are only for illustrating the present invention, and the present invention is not limited thereto. Anything that has substantially the same configuration as the technical idea described in the claims of the present invention and achieves the same operation and effect is included in the technical scope of the present invention.

Example 1. Preparation of Ethanol Extract - (1)

The salt and sand of the collected hibiscus were washed with water, and then sterilized using ethanol. It was washed again with distilled water and dried completely. The dried hibiscus was crushed, and 100 g was immersed in 1 liter of 65% ethanol and extracted three times at room temperature with a cycle of 6 hours to obtain a 65% ethanol extract of hibiscus. The obtained extract was filtered with No. 1 filter paper (Whatmann, UK), concentrated with an evaporator, and then lyophilized and stored until use.

Example 2. Preparation of Ethanol Extract of Chickpea-(2)

Instead of 65% ethanol, except that 75% of ethanol was used, a 75% ethanol extract of Japanese chives was obtained under the same conditions and methods as in Example 1.

Example 3. Preparation of Ethanol Extract - (3)

Instead of 65% ethanol, except that 45% of ethanol was used, a 45% ethanol extract of chives was obtained under the same conditions and methods as in Example 1.

Example 4. Preparation of Ethanol Extract of Chickweed-(4)

Except for using 25% ethanol instead of 65% ethanol, the same conditions and methods as in Example 1 were used to obtain a 25% ethanol extract of chives.

Example 5. Preparation of Ethanol Extract of Chickweed-(5)

Instead of 65% ethanol, except that 10% ethanol was used, a 10% ethanol extract of hibiscus was obtained under the same conditions and method as in Example 1.

Example 6. Of Ethanol Extract hexane fraction Produce

After dissolving 10 g of the freeze-dried ethanol extract of Japanese daisy of Example 1 in 1 liter of distilled water, the volume of the solution and the same amount of hexane were mixed. A hexane fraction was prepared by taking only the supernatant of the mixed solution.

Example 7. Ethyl acetate of Ethanol Extract fraction Manufacturing-(1)

First, a fraction of a mixed solution of hexane and chloroform was obtained under the same conditions and methods as in Example 6, except that hexane and chloroform were mixed in a volume ratio of 7:3 instead of hexane. An ethyl acetate fraction was prepared by adding the same amount of ethyl acetate to the water layer remaining after obtaining the fraction, and taking the supernatant.

Example 8. Ethyl acetate of Ethanol Extract fraction Manufacturing-(2)

An ethyl acetate fraction was prepared under the same conditions and methods as in Example 7, except that hexane and chloroform were mixed in a volume ratio of 7:3 and used, but mixed in a volume ratio of 6:4.

Example 9. Ethyl acetate of Ethanol Extract fraction Manufacturing-(3)

An ethyl acetate fraction was prepared under the same conditions and methods as in Example 7, except that hexane and chloroform were mixed in a volume ratio of 7:3 and used instead of mixed in a volume ratio of 5:5.

Example 10. Ethyl acetate of Ethanol Extract fraction Manufacturing-(4)

An ethyl acetate fraction was prepared under the same conditions and methods as in Example 8, except that the extract of Example 3 was used instead of the extract of Example 1.

Example 11. Ethyl acetate of Ethanol Extract fraction Manufacturing-(5)

An ethyl acetate fraction was prepared under the same conditions and methods as in Example 8, except that the extract of Example 4 was used instead of the extract of Example 1.

Example 12. Ethyl acetate of Ethanol Extract fraction Manufacturing-(6)

An ethyl acetate fraction was prepared under the same conditions and methods as in Example 8, except that the extract of Example 5 was used instead of the extract of Example 1.

Example 13. Ethyl acetate of Ethanol Extract fraction of Manufacturing-(7)

The hexane fraction of Example 6 was obtained, and the same amount of ethyl acetate was added to the remaining water layer, and the supernatant was taken to prepare an ethyl acetate fraction.

Example 14. Ethyl acetate of Ethanol Extract fraction of Manufacturing-(8)

After obtaining the hexane fraction of Example 6, the same amount of chloroform was added to the remaining water layer, the water layer was recovered, and the same amount of ethyl acetate was added again. From this, the supernatant was taken to prepare an ethyl acetate fraction.

Example 15. Butanol from Ethanol Extract fraction of Produce

An equal amount of butanol was added to the ethyl acetate fraction of Example 8, and the supernatant was taken to prepare a butanol fraction.

Experimental example 1. Confirmation of antioxidant activity

Antioxidant activity of the extracts and fractions of hibiscus produced in the above example was confirmed by the following method.

1-1. Confirmation of protein protection effect of Ethanol Extract

Antioxidative activity was confirmed by performing a metal ion catalysis reaction with 75% ethanol extract of hibiscus produced in Example 2.

First, 100 μM of Cu ^{2+ and} 2.5 mM of H ₂ O ₂ were added to generate hydroxyl radicals. Here, 0.5 μg/ml of bovine serum albumin and the extract of Example 2 at concentrations of 1, 5, 10, 50, and 100 μg/ml were added. The result of confirming the degree of degradation of bovine serum albumin by electrophoresis of the reaction product on a 10% SDS-PAGE gel is shown in FIG. 1 . At this time, 50 μM of ascorbic acid (Asc) was used as a positive control.

As shown in FIG. 1 , when the extract of Example 2 was treated at a concentration of 5 μg/ml or higher, a significant protein protective effect was exhibited, which was superior to that of the positive control.

1-2. of Ethanol Extract DPPH radical extinction ability Confirm

Antioxidative activity was confirmed by confirming the DPPH radical scavenging ability with the 75% ethanol extract of Japanese daisy prepared in Example 2.

Specifically, the extract of Example 2 was added at a concentration of 1, 10, 50, 100, 500 or 1,000 μg/ml to an aqueous methanol solution containing 0.3 mM DPPH (1,1-diphenyl-2-picrylhydrazyl). After reacting this at room temperature for 10 minutes, absorbance was measured at a wavelength of 517 nm. The DPPH radical scavenging ability was calculated by a conventional method using the measured absorbance value, and the results are shown in FIG. 2 . At this time, ascorbic acid (Asc) was used as a positive control.

As shown in Figure 2, the extract of Example 2 increased the DPPH scavenging ability in a concentration-dependent manner.

1-3. shiitake extract and fraction of DPPH radical extinction ability Confirm

By confirming the DPPH radical scavenging ability with the extracts and fractions of Examples 1, 3 to 5, 8, and 10 to 12, antioxidant activity was confirmed. Experiments were carried out in Examples 1-2, except that the extracts or fractions of Examples 1, 3 to 5, 8, and 10 to 12 were added at a concentration of 1.25, 2.5, 5, 12.5, 50 or 100 μg/ml. was carried out under the same conditions and methods as At this time, ascorbic acid (Vit.C) was used as a positive control, and the results are shown in FIG. 3 .

As shown in FIG. 3 , both extracts and fractions of Japanese daisy exhibited DPPH radical scavenging activity in a concentration-dependent manner. In particular, the ethyl acetate fraction showed a more significant effect compared to the ethanol extract of Shiitake.

Experimental example 2. Confirmation of anti-inflammatory activity

The anti-inflammatory activity of extracts and fractions of Japanese hibiscus produced in the above example was confirmed by the following method.

2-1. Confirmation of nitrogen monoxide inhibitory activity of Japanese hibiscus extract

Nitrogen monoxide inhibitory activity was confirmed with the 75% ethanol extract of Hibiscus prepared in Example 2 as follows.

First, the RAW264.7 cell line, a mouse macrophage cell line (Korea Cell Line Bank, Korea), was prepared using αMEM (alpha minimum essential medium w/o nucleosides, Hyclone, USA) culture medium containing 10% fetal bovine serum at 37°C and 5 % CO ₂ incubated in an environment. The cultured cells were dispensed in a 96-well plate, and the extract of Example 2 was treated at a concentration of 10, 25, or 50 μg/ml. After 2 hours, 1 μg/ml of LPS was treated, and further cultured for 24 hours. After the culture was completed, the culture medium was mixed with the same amount of Griess reagent, reacted for 10 minutes, and absorbance was measured at 540 nm. The result of measuring the concentration of nitrite from the measured value using a standard curve using sodium nitrite is shown in FIG. 4 . In this case, as a control, a nitrogen monoxide inhibitor, L-NMMA (NG-methyl-L-arginine acetate) was used.

As shown in Figure 4, the production of nitric oxide was inhibited depending on the concentration of the extract of Example 2.

2-2. shiitake extract and fraction of Confirmation of nitric oxide inhibitory activity

By confirming the nitric oxide inhibitory effect with the extracts and fractions of Examples 1, 3 to 5, 8, and 10 to 12, anti-inflammatory activity was confirmed. The experiment was carried out under the same conditions and methods as in Experimental Example 2-1, except that the extracts or fractions of Examples 1, 3 to 5, 8, and 10 to 12 were added at a concentration of 25 or 50 μg/ml. . The degree of inhibition of nitric oxide was calculated by a conventional method from the measured absorbance value and shown as a fold in FIG. 5 .

As shown in FIG. 5 , the nitric oxide inhibitory activity was increased depending on the concentration of the extract and fractions of H. shiitake, but the extract of Example 5 did not show a significant effect.

2-3. Confirmation of inhibition of expression of inflammatory cytokines by shiitake extract

Inhibition of expression of inflammatory cytokines was confirmed with the 75% ethanol extract of H. chives prepared in Example 2 as follows.

First, the RAW264.7 cell line cultured as described above was dispensed in a 6-well plate, and the extract of Example 2 was treated at a concentration of 10, 25 or 50 μg/ml. After 2 hours, 1 μg/ml of LPS was treated, and further cultured for 24 hours. After incubation, 1 ml of trizol reagent was added to lyse the cells, and after 5 minutes, 200 μl of chloroform was added. This was centrifuged at 13,500 rpm for 15 minutes to obtain a supernatant. An equal amount of isopropyl alcohol was added to the obtained supernatant and centrifuged at 13,500 rpm for 10 minutes to obtain an RNA pellet. The pellet was washed with 70% ethanol diluted with distilled water treated with DEPC (Sigma-Aldrich, USA) and dried to obtain total RNA. Using 1 μg of the obtained RNA as a template, a reverse transcription reaction was performed using Improm-II reverse transcription system (Promega) and oligo dT primers, and the primers shown in Table 1 were The expression levels of the inflammatory cytokines IL-1β, IL-6, iNOS and TNFα using a Rotor-Gene 6000 (Rotor-Gene 6000, Qiagen, USA) device was used to perform quantitative PCR in a conventional manner. The gene expression level was normalized to the expression level of the β-actin gene, and the results are shown in FIG. 6 .

primer Sequence (5'→3') SEQ ID NO: IL-6_forward TTCCATCCAGTTGCCTTCTT SEQ ID NO: 1 IL-6_reverse GTTGGGAGTGGTATCCTCTG SEQ ID NO: 2 IL-1β_forward AGCAACGACAAAATACCTGT SEQ ID NO: 3 IL-1β_reverse GGAACTCTGCAGACTCAAAC SEQ ID NO: 4 iNOS_forward GATGACCCTAAGAGTCACCA SEQ ID NO: 5 iNOS_reverse TTTGCCTCTTTAAAGGAGCC SEQ ID NO: 6 TNFα_forward GATTATGGCTCAGGGTCCAA SEQ ID NO: 7 TNFα_reverse GAGACAGAGGCAACCTGACC SEQ ID NO: 8 β-actin_forward TACAGCTTCACCACCACAGC SEQ ID NO: 9 β-actin_reverse AAGGAAGGCTGGAAAAGAGC SEQ ID NO: 10 IL-4_forward ATATCCACGGATGCGACAAA SEQ ID NO: 11 IL-4_reverse AAGCCCGAAAGAGTCTCTGC SEQ ID NO: 12 IL-2_forward CACTAGCTCCACTTCAA SEQ ID NO: 13 IL-2_reverse AGTCAAATCCAGAACATGCC SEQ ID NO: 14 INFγ_forward TGAAAATCCTGCAGAGCCAG SEQ ID NO: 15 INFγ_reverse TGGACCTGTGGGTTGTTGAC SEQ ID NO: 16 CD25_forward AGCAACTCCCATGACAAATC SEQ ID NO: 17 CD25_reverse TGCGATTCCTCACTAGCCAG SEQ ID NO: 18

As shown in Figure 6, the expression of the inflammatory cytokines IL-1β, IL-6, iNOS and TNFα gene was significantly inhibited depending on the concentration of the extract of Example 2.

2-4. shiitake extract and fraction of Confirmation of inhibition of inflammatory cytokine expression

Examples 1, 3 to 5, 8, and by confirming the inflammatory cytokine expression inhibitory effect with the extracts and fractions of 10 to 12, the anti-inflammatory activity was confirmed. The experiment was performed under the same conditions and methods as those of Experimental Example 2-3, except that the extracts or fractions of Examples 1, 3 to 5 and 15 to 18 were added at a concentration of 25 or 50 μg/ml. As a result, the electrophoresis photo of the PCR product is shown in FIG. 7, the result graph by the extract treatment of Examples 1 and 3 to 5 is shown in FIG. 8, and the result graph by the fraction treatment of Examples 8 and 10 to 12 is shown. 9 is shown.

7 to 9 , the expression of inflammatory cytokines IL-1β, IL-6, iNOS and TNFα genes was significantly inhibited depending on the treatment concentration of the extract or fractions of Hibiscus.

Experimental example 3. tchi fraction of Confirmation of antibacterial activity against atopic dermatitis-related strains

Staphylococcus aureus ( staphylococcus aureus ) and Staphylococcus epidermidis ) are detected at a high rate of 70-80% in all patients with atopic dermatitis, and especially in eczema lesions, it is reported that more than 95% of these strains form colonies has been As such, the antibacterial activity of the shiitake fraction against Staphylococcus aureus and Staphylococcus epidermidis, which is the cause of severe atopic dermatitis and the main culprits causing chronic intractable atopic dermatitis and diseases, was confirmed as follows.

First, Staphylococcus aureus and Staphylococcus aureus were cultured in a conventional manner using a 15 ml round-bottom tube, and the activity of the strain was maintained by subculture at least twice. The strain was inoculated to exhibit 0.063 at an absorbance of 600 nm based on a McFarland standard turbidity of 0.5, and the ethyl acetate fraction of Example 8 was treated thereto at a concentration of 125, 250 or 500 μg/ml. After inoculation, absorbance was measured at 0, 4, 6, 8, 12 and 24 hours to confirm the growth degree of the strain, and a graph is shown in FIG. 10 . At this time, ampicillin (AMP) was used as a positive control.

As shown in FIG. 10 , the growth of Staphylococcus aureus and Staphylococcus epidermis was inhibited in a concentration-dependent manner when the ethyl acetate fraction of Example 8 was treated.

Experimental example 4. tchi fraction of Confirmation of T cell-dependent cytokine regulation

4-1. Ethyl acetate or butanol of shiitake fraction of check active

It was confirmed whether the Hichigan fractions of Examples 8 and 15 inhibited the expression of IL-4, IFNγ and IL-2, which are T cell-dependent cytokines.

First, splenocytes were treated with anti-CD3 antibody to obtain activated splenocytes. Here, 1, 10, or 25 μg/ml concentration of the hibiscus fraction of Example 8 or 15 was treated, and quantitative PCR was performed using the primers listed in Table 1 as described above. The gene expression level was normalized to the expression level of the β-actin gene, and the results are shown in FIG. 11 .

As shown in FIG. 11 , the Hichigan fractions of Examples 8 and 15 inhibited T cell-dependent cytokine expression in a concentration-dependent manner.

4-2. extract or fraction of check active

It was confirmed whether the Hichigan fractions of Examples 1, 13, 14 and 7 inhibited the expression of IL-2 and CD25, which are T cell-dependent cytokines. The experiment was conducted using the Hichigan fractions of Examples 1, 13, 14, and 7 instead of using the Hibiscus fractions of Examples 8 and 15, and except that primers specific for the IL-2 and CD25 genes described in Table 1 were used. , was performed under the same conditions and methods as those of Experimental Example 4-1. At this time, cyclosporine (CsA) was used as a positive control. As a result, the gene expression level was normalized to the expression level of the β-actin gene, and the results are shown in FIG. 12 .

As shown in FIG. 12 , the hibiscus fractions of Examples 1, 13, 14 and 7 inhibited the expression of IL-2 and CD25, and in particular, the fraction showed a more significant effect compared to the extract.

4-3. Ethyl acetate of Totchi fraction of check active

In the process of preparing a fraction from the hibiscus extract by mixing hexane and chloroform, the activity change according to the mixing ratio of hexane and chloroform was confirmed. The experiment was carried out using the hibiscus fractions of Examples 6 to 9 and 14 instead of using the hibiscus fractions of Examples 1, 13, 14, and 7, and the same conditions and methods as those of Experimental Example 4-2. At this time, cyclosporine (CsA) was used as a positive control. As a result, the gene expression level was normalized to the expression level of the β-actin gene, and the results are shown in FIG. 13 .

As shown in FIG. 13 , the hibiscus fractions of Examples 6 to 9 and 14 inhibited the expression of CD25, and in particular, a mixed solution in which hexane and chloroform were mixed at 6:4 in the fractionation process (Example 8) was the most An excellent effect was exhibited.

Experimental example 5. Confirmation of treatment effect of atopic dermatitis in animal model of shiitake extract

In a mouse model induced by atopic dermatitis, the therapeutic effect of Japanese shiitake extract was confirmed as follows.

First, the hairs of NC/Nga mice were completely removed, and 150 μl of 4% sodium dodecyl sulfate (SDS) was sprayed to destroy the skin barrier. Here, 100 mg of Dfb (dermatophagoides farinae body) extraction ointment (Biostir, Japan) was applied twice a week. After 4 weeks, it was confirmed that atopic dermatitis lesions were induced on the back of the mouse, and 0.5 or 1% of the extract of Example 2 of Example 2 was applied daily for 3 weeks. At this time, 0.1% tacrolimus ointment was used as a positive control. After 3 weeks, serum from the mice was collected and the levels of IgE and IL-4 in the serum were measured using an ELISA kit (Abcam, USA) according to the manufacturer's protocol, and the results are shown in FIG. 14 .

As shown in FIG. 14 , the Hibiscus extract significantly inhibited the increased levels of IgE and IL-4 in atopic dermatitis lesions in a concentration-dependent manner.

Therefore, it can be seen from the above results that the extract or fraction of Japanese daisy according to the present invention can be used for the treatment of atopic dermatitis.

<110> Huscion Co., Ltd. <120> PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING OF INFLAMMATORY SKIN DISEASES COMPRISING SARGASSUM FUSIFORME EXTRACT AS AN ACTIVE INGREDIENT <130> DP-2020-0267-EN-1 <150> KR 10-2020-0164435 <151> 2020-11-30 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-6_forward primer <400> 1 ttccatccag ttgccttctt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-6_reverse primer <400> 2 gttgggagtg gtatcctctg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1 beta_forward primer <400> 3 agcaacgaca aaatacctgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-1 beta_reverse primer <400> 4 ggaactctgc agactcaaac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS_forward primer <400> 5 gatgacccta agagtcacca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOS_reverse primer <400> 6 tttgcctctt taaaggagcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF alpha_forward primer <400> 7 gattatggct cagggtccaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF alpha_reverse primer <400> 8 gagacagagg caacctgacc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_forward primer <400> 9 tacagcttca ccaccacagc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin_reverse primer <400> 10 aaggaaggct ggaaaagagc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-4_forward primer <400> 11 atatccacgg atgcgacaaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-4_reverse primer <400> 12 aagcccgaaa gagtctctgc 20 <210> 13 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> IL-2_forward primer <400> 13 cactagctcc acttcaa 17 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-2_reverse primer <400> 14 agtcaaatcc agaacatgcc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> INF gamma_forward primer <400> 15 tgaaaatcct gcagagccag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> INF gamma_reverse primer <400> 16 tggacctgtg ggttgttgac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD25_forward primer <400> 17 agcaactccc atgacaaatc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CD25_reverse primer <400> 18 tgcgattcct cactagccag 20

Claims (9)

A pharmaceutical composition for the prevention or treatment of inflammatory skin diseases, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.
The pharmaceutical composition for preventing or treating inflammatory skin disease according to claim 1, wherein the extract is extracted with water, C ₁ to C ₂ lower alcohol or a mixture thereof.
The pharmaceutical composition for preventing or treating inflammatory skin diseases according to claim 2, wherein the C ₁ to C ₂ lower alcohol is ethanol, methanol or alcohol.
The pharmaceutical composition for the prevention or treatment of inflammatory skin diseases according to claim 1, wherein the fraction is obtained by sequentially fractionating the extract of hibiscus with hexane, chloroform and ethyl acetate.
The pharmaceutical composition for the prevention or treatment of inflammatory skin diseases according to claim 1, wherein the fraction is obtained by sequentially fractionating the hibiscus extract with a mixed solution of hexane and chloroform and ethyl acetate.
According to claim 1, wherein the inflammatory skin disease is atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, lupus erythematosus or papular urticaria. The pharmaceutical composition for preventing or treating inflammatory skin disease.
A health functional food for the prevention or improvement of inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.
A cosmetic composition for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.
A skin external preparation for preventing or improving inflammatory skin disease, comprising the extract, a fraction thereof, or a mixture thereof as an active ingredient.

Images