KR20220046343A - Method for producing 3-hydroxypropionic acid using low-cost substrate - Google Patents

Abstract

Provided are: a method for producing 3-hydroxypropionic acid (3-HP) using inexpensive unrefined glycerol; and a composition for producing 3-HP prepared using the unrefined glycerol. According to the present invention, it is possible to lower the production cost of 3-HP by using unrefined glycerol, and it is possible to contribute to the prevention of environmental pollution through recycling of waste glycerol.

Description

Method for producing 3-hydroxypropionic acid using low-cost substrate

The present invention relates to a method for producing 3-hydroxypropionic acid (3-HP) using unrefined glycerol, and more particularly, to a step of pre-treating crude glycerol and using the crude glycerol It relates to a method for producing 3-HP, comprising the step of culturing a strain having 3-HP-producing ability.

Biodiesel is one of the eco-friendly alternative energy sources, and its production has been steadily increasing in recent years. Biodiesel is manufactured by chemically treating vegetable oil, etc. In the process of biodiesel, which is a methyl ester of fatty acids, produced by transesterification, glycerol present in fat is produced as a by-product. What is not treated with the generated by-product is usually called crude glycerol.

Unrefined glycerol, a by-product from the production of biodiesel, is being sought for application in various fields due to its low price, and has recently attracted attention as a new feed-stock in the microbial fermentation process. However, since unrefined glycerol contains impurities such as methanol, soap, ash, and fatty acids in addition to glycerol, when used as it is for culturing microorganisms, the growth and activity of microorganisms decreases, and a large amount of foam ), there are several problems, such as limiting its use in microbial culture.

Accordingly, a method of purifying the crude glycerol to a high concentration of glycerol through a process such as filtering, acid treatment, and organic solvent extraction has been used. Although these methods can obtain glycerol of high concentration and purity, there is a problem in that the economic advantage of crude glycerol is lowered because the process cost increases as a number of processes are applied.

Therefore, there is a demand for technology development that does not inhibit the growth and activity of microorganisms by removing impurities in unrefined glycerol while maintaining economical efficiency.

On the other hand, 3-hydroxypropionic acid is a platform compound that can be converted into various chemical substances such as acrylic acid, methyl acrylate, and acrylamide. Since it was selected as Top 12 value-added bio-chemical by the US Department of Energy (DOE) in 2004, it has been actively studied in academia and industry.

The production of 3-HP is largely carried out in two ways: a chemical method and a biological method. However, in the case of the chemical method, it is pointed out that the initial material is expensive and it is not eco-friendly due to the fact that toxic substances are generated during the production process. Bio-processing is in the spotlight.

Since glycerol is mainly used as a substrate for 3-HP biosynthesis using microorganisms, the development of a technology for producing 3-HP by removing impurities of the above-mentioned unrefined glycerol is required.

An object of the present invention, the step of pre-treating the crude glycerol; and culturing a strain having 3-hydroxypropionic acid (3-HP) producing ability in a medium containing the pre-treated unrefined glycerol to produce 3-HP; to provide a method for producing 3-HP comprising; .

Another object of the present invention is to provide a composition for production of 3-HP and/or a medium for production of 3-HP (eg, fermentation medium) comprising the pre-treated crude glycerol.

The present invention, the step of pre-treating the unrefined glycerol; and culturing a strain having 3-hydroxypropionic acid (3-HP) producing ability in a medium containing the pre-treated unrefined glycerol to produce 3-HP; provides a 3-HP production method comprising.

The present invention also provides a composition for production of 3-HP and/or a medium for production of 3-HP (eg, fermentation medium) comprising the pre-treated crude glycerol.

Hereinafter, the present invention will be described in detail.

The term "unrefined glycerol" used in the present invention means that it is formed as a by-product during the production of biodiesel, and may be used interchangeably with "waste glycerol". In general, it is known that when 100 kg of biodiesel is produced, about 10 kg of unrefined glycerol is produced as a by-product. The crude glycerol generally comprises 80 to 85 wt % of glycerol.

The present invention, the step of pre-treating the unrefined glycerol; and culturing (eg, fermentation culture) a strain having 3-hydroxypropionic acid (3-HP) producing ability in a medium containing the pre-treated unrefined glycerol to produce 3-HP; -Provides HP production methods.

The method of pre-treating the crude glycerol may include the following method:

(i) adjusting the pH of the crude glycerol solution to 2 to 8; and

(ii) recovering the aqueous layer by layer separation of the pH-adjusted crude glycerol solution.

The crude glycerol solution may refer to a mixture of unrefined glycerol and/or unrefined glycerol with a solvent. In one example, the solvent may be water, but may include secondary or more distilled water, but is not limited thereto.

In one example, the unrefined glycerol solution may be a solution prepared by adding water to glycerol so that the concentration of glycerol in the total solution becomes 10 to 70% (w/w), but is not limited thereto. In one example, the glycerol concentration in the crude glycerol solution is 10-85% (w/w, hereinafter the same), 10-80%, 10-70%, 10-60%, 10-50%, 10-45%, 30-85%, 30-80%, 30-70%, 30-60% 30-50%, 30-45%, 40-85%, 40-80%, 40-70%, 40-60%, 40 to 50%, or 40 to 45%, but is not limited thereto.

When the unrefined glycerol is used as it is for the fermentation culture of microorganisms, bubbles are generated and the operation of the fermenter is impossible due to the high pH.

In the production method of 3-HP provided by the present invention, the method of pretreating crude glycerol includes adjusting the pH of the crude glycerol to 2 to 8. The crude glycerol solution generally has a strong basic pH of 11 or higher.

The step of adjusting the pH of the unrefined glycerol solution to 2 to 8 is, for example, the pH of the unrefined glycerol solution is 2 to 7.5, 2 to 7, 4 to 8, 4 to 7.5, 4 to 7, 6 to It may be to adjust to 8, 6 to 7.5 or 6 to 7, but is not limited thereto.

The pH may be adjusted by adding an acid, and the type of acid may be selected without limitation within the target range for pH adjustment. For example, the acid may be, but is not limited to, hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, boric acid, hydrogen fluoride (HF), or oxalic acid.

In the production method of 3-HP provided by the present invention, the method of pretreating the crude glycerol includes the step of separating the layers of the crude glycerol solution to recover the aqueous layer.

In one embodiment, the method of pretreating crude glycerol may further include adding a calcium salt to the pH-adjusted crude glycerol solution. The step of adding the calcium salt may be performed before the layer separation step.

Among the impurities contained in unrefined glycerol, the soap component and fatty acid play a role in interfering with the culture of microorganisms, and when calcium salt is added, the functional group of the negative charge possessed by the soap component and the fatty acid is Ca ² It aggregates while combining with ⁺ so that the impurities can be separated from the aqueous solution layer. The calcium salt may be selected without limitation within the range for the purpose of separation of the soap and/or fatty acid described above, for example, the calcium salt may be CaCl ₂ , CaO, Ca(NO ₃ ) ₂ , Ca(OH) ₂ , or It may be CaS.

The amount of the calcium salt added may be freely selected within the range for the purpose of separation of soap and/or fatty acids, and in one embodiment, 1 to 100 g, 1 to 50 g, 1 to 30 g, or 1 to 1 kg of glycerol in the crude glycerol solution It may be 10 g.

As described above, when a calcium salt is added to the unrefined glycerol solution, the soap component and fatty acid among the impurities contained in the unrefined glycerol agglomerate, and the layer separation proceeds immediately. Layer separation is complete. Therefore, the treatment step of the calcium salt is useful for pretreatment of unrefined glycerol in which layer separation does not occur after pH adjustment.

The reaction time for layer separation may be adjusted without limitation within the range of the purpose of completion of layer separation, for example, 5 minutes or more, 15 minutes or more, 30 minutes or more, 60 minutes or more, 5 to 360 minutes, 5 to 180 minutes. minutes, 5 to 60 minutes, 15 to 360 minutes, 15 to 180 minutes, 15 to 60 minutes, 30 to 360 minutes, 30 to 180 minutes, or 30 to 60 minutes.

In one embodiment, when not including the step of adding the calcium salt, the reaction time for layer separation can be adjusted without limitation within the range for the purpose of layer separation completion, for example, 30 minutes or more, 60 minutes or more, 90 minutes or more, 120 minutes or more, 30-600 minutes, 30-300 minutes, 30-240 minutes, 60-600 minutes, 60-300 minutes, 60-240 minutes, 120-600 minutes, 120-300 minutes, or 120 to 240 minutes.

The recovery method of the aqueous layer is not particularly limited, and may be performed, for example, by decanting and/or filtration.

The method for producing 3-HP provided by the present invention comprises culturing a strain having 3-hydroxypropionic acid (3-HP) producing ability in a medium containing the pre-treated unrefined glycerol (eg, fermentation culture). producing 3-HP.

The 3-hydroxypropionic acid producing strain may include one or more selected from the group consisting of glycerol dehydratase and aldehyde dehydrogenase, or a gene encoding the two types of proteins. In one example, the 3-HP production strain may further include a gene (gdrAB) encoding a glycerol dehydratase reactivating enzyme (GdrAB). In one example, the 3-HP production strain may be a strain capable of further biosynthesizing vitamin B12.

The glycerol dehydratase may be encoded by a dhaB (GenBank accession no. U30903.1) gene, but is not limited thereto. The dhaB gene may be an enzyme derived from Klebsiella pneumonia, but is not limited thereto. The gene encoding the glycerol dehydratase may include a gene encoding dhaB1, dhaB2 and/or dhaB3. The glycerol dehydratase protein and the gene encoding it have a gene and/or amino acid sequence within the range of maintaining the enzyme activity for decomposing glycerol into 3-hydroxypropanal (3-HPA) and water (HO). may contain mutations.

The gene (aldH) encoding the aldehyde dehydrogenase (ALDH) is, for example, Escherichia coli or aldH (GenBank Accession no. U00096.3; EaldH) derived from the E. coli K12 MG1655 cell line. gene, a puuC gene derived from K. pneumoniae, and/or a KGSADH gene derived from Azospirillum brasilense, but is not limited thereto. The aldehyde dehydrogenase protein and the gene encoding the same may include mutations in the gene and/or amino acid sequence within a range that maintains the activity for producing 3-HP from 3-HPA.

The 3-HP production strain includes a recombinant vector comprising a gene encoding one or more, two or more, or all three types of proteins selected from the group consisting of glycerol dehydrogenase, aldehyde dehydrogenase, and glycerol dehydratase reactivase. can do.

The recombinant vector is a glycerol dehydrogenase, aldehyde dehydrogenase, and one or more selected from the group consisting of glycerol dehydrogenase reactivase, two or more, or all three types of proteins encoding genes within the target range for expression within the cell. Promoters and regulatory regions may be substituted by methods known in the art.

In one embodiment, the method for producing 3-HP provided by the present invention may further include, before the step of producing 3-HP, the step of isolating a strain having 3-HP producing ability at a high concentration by culturing.

The high-concentration culture may be performed using any method known in the art without limitation within the purpose range for securing a large amount of 3-HP production strain, and in one example, the culture is performed as a fed-batch culture it may be

In one embodiment, the fed-batch culture may be performed in a pH-stat method, a continuous feeding culture method, or a combination thereof. In one embodiment, when fed-batch culture of the pH-stat method is performed, glucose may be added at a concentration of 1 to 5 g/L. In one embodiment, when fed-batch culture of a constant rate culture method is performed, glucose may be injected at a rate of 10 to 20 g/L/h.

In one example, the pH during the high concentration culture may be maintained at 5 to 7.5, 5 to 7, 5.5 to 7.5, 5.5 to 7, 6 to 7.5, or 6.5 to 6, but is not limited thereto.

In one example, the carbon source in the high-concentration culture may be used without limitation by selecting monosaccharides, disaccharides and/or polysaccharides within the target range for high-concentration culture. For example, the carbon source is glucose (glucose), fructose (fructose), galactose (galactose), mannose (mannose), arabinose (arabinose), xylose (xylose), ribose (riboase), sucrose (sucrose), maltose (maltose), lactose (lactose), and cellobiose (cellobiose) may be one or more, two or more, three or more, four or more, five or more, ten or more, or a combination of all 11 types selected from the group consisting of.

In one example, the cell concentration after the high concentration culture is OD ₆₀₀ 10 or more, 50 or more, 100 or more, 150 or more, 200 or more, 10-500, 10-400, 10-300, 10-250, 50-500, 50-400 , 50 to 300, 50 to 250, 100 to 500, 100 to 400, 100 to 300, 100 to 250, 150 to 500, 150 to 400, 150 to 300, 150 to 250, 200 to 500, 200 to 400, 200 to 300, or 200 to 250, but is not limited thereto.

Separation of the high-concentration cultured cells is at least one selected from the group consisting of centrifuging the cells, removing the supernatant, and resuspending the pellet with a buffer, two or more or all of the above steps may include. In one example, the buffer may be phosphate buffered saline (PBS), but is not limited thereto.

Inoculation of the high-concentration cultured cells can be appropriately changed by those skilled in the art within the range of 3-HP production purpose. In one example, the cell concentration (based on dry cell weight (DCW)) at the time of inoculation is 1 to 20 g/L, 1 to 16 g/L, 1 to 12 g/L, 1 to 9 g/L , 2-20 g/L, 2-16 g/L, 2-12 g/L, 2-9 g/L, 4-20 g/L, 4-16 g/L, 4-12 g/L, or 4 to 9 g/L, but is not limited thereto.

In the production method of 3-HP provided by the present invention, in the step of producing 3-HP, the growth of the strain may not occur. The glycerol contained in the pre-treated glycerol may be used only for the production of 3-HP and not used as a carbon source for cell growth. By inhibiting cell growth, it is possible to suppress the yield loss of 3-HP as glycerol is used for cell growth.

At the end of the production phase, the number of cells is 150% or less, 130% or less, 100% or less, 90% or less, 80% or less, 50 to 150%, 50 to 130%, 50 to 100%, 50 of the number of inoculated cells. to 90%, 50 to 80%, 70 to 150%, 70 to 130%, 70 to 100%, 70 to 90%, or 70 to 80%, but is not limited thereto.

The 3-HP production method provided by the present invention may not produce by-products and/or foam according to 3-HP production. The by-product may be acetate and/or lactate. In one example, the concentration in the total culture solution of the by-product is within 1% (v / v), within 0.5% (v / v), within 0.1% (v / v), within 0.01% (v / v), or within 0.001% (v/v) may be within the range.

The method for producing 3-HP using unrefined glycerol provided by the present invention has an equivalent or higher 3-HP production compared to the use of purified glycerol and/or a synthetic medium. In one example, the 3-HP production (g/L) of the 3-HP production method provided by the present invention is 70% compared to the 3-HP production (g/L) in the control group using purified glycerol and/or synthetic medium is 70% or more, 80% or more, 90% or more, 100% or more, 70 to 150%, 70 to 130%, 80 to 150%, 80 to 130%, 90 to 150%, 90 to 130%, 100 to 150%, or It may be 100 to 130%, but is not limited thereto.

The present invention also provides a composition for production (production) of 3-HP and/or a fermentation medium for production of 3-HP prepared by pretreatment of crude glycerol.

The method of pre-treating the unrefined glycerol is the same as described above.

In one example, the concentration of the crude glycerol pretreated in the fermentation medium is 1-300 g/L, 1-250 g/L, 1-200 g/L, 1-150 g/L, 10-300 g/L, 10-250 g/L, 10-200 g/L, 10-150 g/L, 25-300 g/L, 25-250 g/L, 25-200 g/L, 25-150 g/L, 50 to 300 g/L, 50 to 250 g/L, 50 to 200 g/L, or 50 to 150 g/L, but is not limited thereto.

The 3-HP production (production) composition and/or 3-HP production fermentation medium may further include vitamin B12.

In one embodiment, the 3-HP preparation (production) composition and/or the fermentation medium for 3-HP production may be composed of the pre-treated unrefined glycerol, water, and/or vitamin B12.

In one embodiment, the 3-HP production (production) composition and/or the fermentation medium for 3-HP production further include a carbon source, a nitrogen source, a coenzyme, and/or a mineral as needed in the production purpose range of 3-HP can do. The carbon source may be glucose (glucose), but is not limited thereto.

As described above, the method for culturing microorganisms according to the present invention removes impurities contained in unrefined glycerol in a simple and quick way, and culturing microorganisms using them, thereby suppressing the generation of bubbles generated during culturing microorganisms, and also It has the effect of improving the growth and activity of microorganisms.

The production method of 3-HP provided by the present invention uses pre-treated unrefined glycerol to reduce the raw material cost during 3-HP production and has a similar level of 3-HP production capacity to the case of using a synthetic medium. , and by-products are not generated, so it is possible to reduce the refining cost.

1 is a result of confirming whether the layer separation in the pre-treated waste glycerol solution according to one preparation example.
Figure 2 is a graph of the result of measuring the production of 3-HP according to the fermentation culture for 3-HP production in waste glycerol and synthetic medium according to an example of the present invention.

Hereinafter, the present invention will be described in more detail by way of Examples. However, the following examples are only for illustrating the contents of the present invention, and the scope of the present invention is not limited by the following examples.

Unless otherwise specified herein, all temperatures are based on degrees Celsius, and nucleic acid sequences are described from the 5' end to the 3' end unless otherwise specified.

Preparation Example 1. Pretreatment of waste glycerol

In order to prepare a 40% (w/w) glycerol solution from crude glycerol containing about 80 to 85% glycerol, 480 g of crude glycerol is dissolved in 1 L of distilled water to obtain a crude glycerol solution was prepared. The pH of the prepared crude glycerol solution was measured to be about 11 to 12. Then, the pH of the crude glycerol solution was lowered to 6.8 using 5N hydrochloric acid.

1L of the crude glycerol solution of pH 6.8 was put in a separatory funnel, 200 g/L of CaCl ₂ solution (8 mL) was added, mixed, and left for about 30 minutes. As shown in FIG. 1, it was confirmed that the layer separation occurred, and only the aqueous layer was recovered (pre-treated waste glycerol) and then used for cell culture.

Preparation Example 2. Preparation of strains for 3-HP production

2-1. Preparation of 3-HP Production Strain

Recombinant introducing genes encoding glycerol dehydratase and aldehyde dehydrogenase, which are known to produce 3-hydroxypropionic acid (3-HP) using glycerol as a substrate A vector was prepared. The recombinant vector prepared above was introduced into the E. coli W3110 strain to prepare a 3-HP producing strain.

Specifically, the gene encoding glycerol dehydratase (dhaB), the gene encoding aldehyde dehydrogenase (aldH), and the gene encoding glycerol dehydratase reactivase (gdrAB) were cloned into plasmid pCDF, A recombinant vector for 3HP production (pCDF_J23101_dhaB_gdrAB_J23100_aldH) was constructed.

The pCDFDuetJ23 vector used to construct the recombinant vector is a vector in which the promoter portion of the pCDFDuet-1 vector is substituted with promoters J23101 and J23100. The dhaB (about 2.7 kb; including dhaB1, dhaB2 and dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) inserted into the vector were amplified from the chromosome of Krebsiella pneumoniae using the primers in Table 1 below. . Since the dhaB123 and gdrA genes were located side by side on the chromosome of Krebsiella pneumoniae, they were amplified together, and only gdrB was amplified separately because gdrB was located in the opposite direction to dhaB123 and gdrA.

The aldH gene was amplified and isolated from the genome of the E. coli K12 MG1655 strain using a promoter pair consisting of the nucleic acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 of Table 1 below. The nucleic acid sequences of the primers used for each gene amplification are shown in Table 1 below. Among the names, '-F' means a forward promoter and '-R' means a reverse promoter.

SEQ ID NO: name Nucleic acid sequence (5'>3') One dhaB-gdrA-F GAATTCATGAAAAGATCAAAACGATTTGCAGTCCT 2 dhaB-gdrA-R AAGCTTGATCTCCCACTGACCAAAGCTGG 3 gdrB-F AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG 4 gdrB-R CTTAAGTCAGTTTCTCTCACTTAACGGC 5 aldH-F ggtaccatgaattttcatcatctggc 6 aldH-R catatgtcaggcctccaggcttat

After amplification of each gene, the dhaB123 and gdrA genes were cloned downstream of the J23101 promoter of the pCDFDuetaJ23 vector using restriction enzymes EcoRI and HindIII, and the gdrB gene using restriction enzymes HindIII and AflII. aldH was cloned under the J23108 promoter using restriction enzymes KpnI and NdeI. The cloning method of each gene was performed by a method known in the art. The plasmid was introduced into E. coli W3110 (KCCM 40219) by electroporation to prepare a 3HP-producing strain.

2-2. High-concentration culture and isolation of cells for 3-HP production

The prepared 3-HP production strain was subjected to high-concentration cell culture in a 5L fermenter (working volume 2L) by a fed-batch culture method.

Specifically, MR medium (KH ₂ PO ₄ 6.67 g per 1 L, (NH ₄ ) ₂ HPO _{4 4} g, MgSO ₄ 7H ₂ O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL; here, Trace metal solution Silver per 1L of 5M HCl _5mL , FeSO4· _7H2O10g , _CaCl22g , ZnSO4· _7H2O2.2g , _MnSO4 · _4H2O0.5g , _CuSO4 · _5H2O1g , _{( NH4} ) ₆ Cell culture by adding 20 g/L of glucose and 25 mg/L of antibiotic (streptomycin) for selection to Mo ₇ O ₂ ·4H ₂ O 0.1g, and Na ₂ B ₄ O ₂ ·10H ₂ O 0.02g) It was used as a medium and maintained at a temperature of 35 degrees Celsius. The pH was maintained at 6.95 using ammonia water, the dissolved oxygen amount (DO) was maintained at 20% while increasing the stirring speed stepwise up to 900 rpm, and the aeration was maintained at 1vvm.

After completing the high-concentration cell culture, the cell culture medium was centrifuged at 6,000 rpm at 4° C. for 10 minutes to recover cells. The recovered cells were suspended in PBS (phosphate-buffered saline) and used in the next step.

Example 1. Production of 3-HP using waste glycerol

As a medium for 3-HP production, 70 g/L aqueous solution of pre-treated waste glycerol prepared in Preparation Example 1 and 50 uM of vitamin B12 were added. 3-HP production medium was inoculated with the cell suspension prepared in Example 1-2 so that the cell inoculation amount was 5 g/L (based on dry cell weight), and the 3-HP production step was performed in a 5L fermenter (working volume 2L). .

Fermentation culture conditions for 3-HP production were maintained at a temperature of 35° C., agitation speed of 300 rpm, aeration was maintained at 1 vvm, and pH was maintained at 7.0 using Ca(OH) ₂ .

Comparative Example 1. 3-HP production in synthetic medium (M9 medium)

A synthetic medium for 3-HP production was prepared by adding 70 g/L of glycerol and 50 uM of vitamin B12 to M9 medium that does not contain glucose. 3-HP production medium was inoculated with the cell suspension prepared in Example 1-2 so that the cell inoculation amount was 5 g/L (based on dry cell weight), and the 3-HP production step was performed in a 5L fermenter (working volume 2L). .

Fermentation culture conditions for 3-HP production were maintained at a temperature of 35° C., agitation speed of 300 rpm, aeration was maintained at 1 vvm, and pH was maintained at 7.0 using Ca(OH) ₂ .

Example 2. Comparison of 3-HP production of Example 1 and Comparative Example 1

The 3-HP concentration according to the fermentation culture in Example 1 and Comparative Example 1 was measured using HPLC. Figure 2 shows a graph showing the measurement result of 3-HP production in Example 1 and Comparative Example 2.

As a result of the 16-hour fermentation culture, in Example 1 fermented using pre-treated waste glycerol, 3-HP of 46.2 g/L was confirmed, and in Comparative Example 1 fermented in M9 medium, 3-HP of 45.6 g/L has been produced

Therefore, it was confirmed that even when using the waste glycerol pretreated by the above method, 3-HP production equal to or higher than that of the synthetic medium is possible.

In addition, the production of foam or the production of by-products due to waste glycerol during the fermentation culture in Example 1 was not confirmed, confirming that the production efficiency and / or quality of 3-HP is excellent.

<110> LG CHEM, LTD. <120> Method for producing 3-hydroxypropionic acid using low-cost substrate <130> DPP20202129KR <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-F <400> 1 gaattcatga aaagatcaaa acgatttgca gtcct 35 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> dhaB-gdrA-R <400> 2 aagcttgatc tcccactgac caaagctgg 29 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> gdrB-F <400> 3 aagcttagag ggggccgtca tgtcgctttc accgccag 38 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> gdrB-R <400> 4 cttaagtcag tttctctcac ttaacggc 28 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> aldH-F <400> 5 ggtaccatga attttcatca tctggc 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> aldH-R <400> 6 catatgtcag gcctccaggc ttat 24

Claims (10)

(One)
i) adjusting the pH of the crude glycerol solution to 2 to 8; and
ii) pretreating crude glycerol as a method of pre-treating crude glycerol comprising; and
(2) producing 3-HP by culturing a strain having 3-hydroxypropionic acid (3-HP) producing ability in a medium containing the pre-treated crude glycerol (crude glycerol); HP production methods. The method of claim 1, wherein the glycerol concentration in the crude glycerol solution is 10-85% (w/v). The method of claim 1,
Further comprising the step of adding a calcium salt to the pH-adjusted crude glycerol solution after step i) and before step ii),
The calcium salt is CaCl ₂ , CaO, Ca(NO ₃ ) ₂ , Ca(OH) ₂ , and at least one salt selected from the group consisting of CaS, the method. The method according to claim 3, wherein the amount of the calcium salt added is 1 to 100 g per 1 kg of the amount of glycerol in the crude glycerol. The method of claim 1 , wherein the medium comprises pretreated crude glycerol, water and vitamin B12. The method according to claim 1, further comprising the step of isolating a strain having 3-HP producing ability at a high concentration before producing the 3-HP. The method according to claim 1, wherein the production of 3-HP does not produce one or more by-products selected from the group consisting of lactate and acetate. The method of claim 1, wherein the 3-HP production amount produced by the method is 70% or more of the 3-HP production amount in the control group using purified glycerol instead of the crude glycerol. i) adjusting the pH of the crude glycerol solution to 2 to 8; and
ii) separating the layers of the crude glycerol solution whose pH is adjusted to recover the aqueous layer; . 10. The composition of claim 9, wherein the composition further comprises vitamin B12.

Images