KR102542396B1 - Method for culturing microorganism by reusing fermented liquid of microorganism - Google Patents

Abstract

It relates to a method for culturing microorganisms by removing the organic solvent remaining in the microbial fermentation broth remaining after organic solvent extraction and reusing it as a microbial fermentation broth. In addition, it relates to a method for culturing microorganisms by removing impurities contained in unpurified glycerol together and utilizing it for culturing microorganisms.

Description

Method for culturing microorganisms by reusing fermented liquid of microorganisms {Method for culturing microorganisms by reusing fermented liquid of microorganisms}

It relates to a method for culturing microorganisms by removing the organic solvent remaining in the microbial fermentation broth remaining after organic solvent extraction and reusing it as a microbial culture broth. In addition, it relates to a method for culturing microorganisms in which impurities contained in unrefined glycerol are removed together and utilized as a substrate for microbial fermentation.

A microbial fermentation process can produce bio-based products such as biochemicals, biofuels, or bioplastics. One of the methods for recovering such bio-based products is an extraction method such as liquid-liquid extraction or reactive extraction.

However, when a bio-based product is extracted from a microbial fermentation broth using an organic solvent, the microbial fermentation broth is separated into an organic solvent layer (organic phase) in which the bio-based product is dissolved and an aqueous solution layer (aqueous phase), even if the organic solvent layer is removed. The organic solvent still remains in the layer, resulting in a large amount of fermentation waste. Therefore, in order to reuse the aqueous solution layer, which is the residual phase from the microbial fermentation broth after bioproduct recovery through extraction, in the fermentation process without treating it as waste, it is necessary to remove the organic solvent remaining in the aqueous solution layer to a level that is not toxic to fermentation. To this end, a process of distilling water or an organic solvent or removing it using an adsorbent is applied, but this requires an additional process, resulting in an increase in process cost.

On the other hand, biodiesel, one of the eco-friendly alternative energies, has recently been steadily increasing in production. Biodiesel is produced by chemically treating vegetable oil, etc., and biodiesel, which is a methyl ester of fatty acids, is produced by transesterification. In this process, glycerol existing in fat is produced as a by-product, and What has not been treated is commonly referred to as crude glycerol.

Unrefined glycerol, a by-product from the production of such biodiesel, is inexpensive and has been sought for application in various fields, and has recently attracted attention as a new feed-stock in the microbial fermentation process. However, since unrefined glycerol contains impurities such as methanol, soap, ash, and fatty acids in addition to glycerol, when it is used as it is for microbial culture, the growth and activity of microorganisms is reduced and a large amount of foam is generated. Several problems arise.

Accordingly, a method of purifying unrefined glycerol into high-concentration glycerol through a process such as filtering, acid treatment, and organic solvent extraction has been used. Although these methods can obtain glycerol of high concentration and purity, there is a problem in that the economic advantage of unrefined glycerol is reduced because the process cost increases as a number of processes are applied.

Therefore, after the bio-based product produced through the microbial fermentation process is extracted through organic solvent extraction, the remaining organic solvent is removed from the remaining microbial fermentation broth to be reused in the fermentation process, and at the same time, impurities in unrefined glycerol are removed to improve the microbial fermentation process. Development of a technology to be used as a fermentation substrate is required.

Domestic Patent Publication No. 10-2010-0100916 (2010.09.15)

The present invention removes the organic solvent remaining in the microbial fermentation broth remaining after organic solvent extraction, reuses it as a microbial culture medium, and simultaneously removes impurities contained in unrefined glycerol to utilize glycerol for microbial culture. to provide.

For example, mixing by adding crude glycerol to a microbial fermentation broth containing an organic solvent; adjusting the pH of the mixed solution to 2 to 8; adding a calcium salt to the solution; recovering an aqueous solution layer by layer separation of the solution; And it provides a microorganism culture method comprising culturing microorganisms in the recovered aqueous solution layer.

According to one aspect of the present invention, there is provided a method for culturing microorganisms comprising the following steps:

Adding and mixing crude glycerol to a microbial fermentation broth containing an organic solvent (Step 1);

adjusting the pH of the mixed solution to 2 to 8 (step 2);

adding a calcium salt to the solution (step 3);

recovering an aqueous solution layer by layer separation of the solution (step 4); and

Cultivating microorganisms in the recovered aqueous solution layer (step 5).

Hereinafter, the present invention will be described in detail for each step.

(Step 1)

Step 1 is a step of mixing by adding crude glycerol to a microbial fermentation broth containing an organic solvent.

Here, the microbial fermentation broth containing the organic solvent may be an aqueous phase remaining after fermenting the microorganisms and extracting and removing the material produced from the microorganisms with the organic solvent. When substances produced by microorganisms are extracted from a microbial fermentation broth using an organic solvent, the microbial fermentation broth is separated into an organic solvent layer (organic phase) in which substances produced by microorganisms are dissolved and an aqueous solution layer (aqueous phase). Even if removed, the organic solvent still remains in the aqueous layer, resulting in a large amount of fermentation waste. Accordingly, one example of the present invention is to reuse the microbial fermentation broth remaining after removing the organic solvent layer in a new microbial fermentation process when the microbial fermentation broth is extracted using an organic solvent. However, the present invention is not limited to the above examples, and for any reason, including organic solvents, in order to use them in a microbial fermentation process, it is necessary to remove organic solvents to a level that is not toxic to fermentation, microbial culture medium or microbial culture medium can be applied to

Here, the material produced from microorganisms is biofuels including alcohols such as isobutanol or biobutanol; bioplastics such as polylactic acid (PLA), polyhydroxyalkanoate (PHA) or bio-nylon; Or biochemicals containing organic acids such as lactic acid or succinic acid may be exemplified, but are not limited thereto. For example, the material produced from microorganisms may be 3-hydroxypropionic acid (3-HP).

The term 'unrefined glycerol' refers to glycerol which is a byproduct of industrial processes such as saponification, high pressure hydrolysis or transesterification of natural oils and fats with alcohols, e.g. biodiesel from vegetable oils and/or animal fats. As a by-product from manufacturing, recovered crude glycerol can be exemplified. In general, it is known that about 10 kg of unrefined glycerol is produced as a by-product when 100 kg of biodiesel is produced. Unrefined glycerol contains impurities such as methanol, soap, ash, and fatty acids in addition to glycerol, and generally contains 80 to 85 wt% of glycerol.

For example, the unpurified glycerol may be used as it is, but is preferably used as a non-purified glycerol solution having a concentration of 10 to 70% of glycerol by adding water. At this time, the concentration of glycerol means the weight of glycerol relative to the weight of water.

(Step 2)

Step 2 is a step of adjusting the pH of a solution in which a microbial fermentation broth containing an organic solvent and non-purified glycerol are mixed to between 2 and 8.

Unpurified glycerol solutions are strongly basic and generally have a pH of 11 or higher. Accordingly, in the present invention, the pH of the unpurified glycerol solution is adjusted to 2 to 8, more preferably to 6 to 7. The pH can be adjusted by adding an acid, for example, by adding hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, boric acid, hydrogen fluoride (HF), or oxalic acid, but is limited thereto A suitable acid may be added without

(Step 3)

Step 3 is a step of adding a calcium salt to a mixture of a microbial fermentation broth containing an organic solvent and unrefined glycerol, the pH of which is adjusted in step 2 above.

Although not limited theoretically, when culturing microorganisms, soap components and fatty acids among impurities contained in unrefined glycerol interfere with microbial culture. When calcium salt is added, these soap components and fatty acids have a negative charge. is aggregated while combining with Ca ²⁺ , and can be rapidly separated from the aqueous solution layer.

The calcium salt may be added by adding CaCl ₂ , CaO, Ca(NO ₃ ) ₂ , Ca(OH) ₂ , or CaS. In addition, the added amount of the calcium salt may be 1 to 10 g relative to 1 kg of glycerol in unrefined glycerol.

(Step 4)

Step 4 is a step of recovering an aqueous solution layer by layer separation of a mixture of a microbial fermentation broth containing an organic solvent and unrefined glycerol to which calcium salt is added in step 3.

As described above, when calcium salt is added in step 3, soap components and fatty acids among impurities contained in crude glycerol are aggregated and separated from the aqueous solution layer. When the calcium salt is added, the layer separation proceeds immediately, and after about 30 minutes from the addition of the calcium salt, the layer separation is substantially completed into a lipid layer containing impurities and an aqueous solution layer containing glycerol. At this time, the organic solvent remaining in the microbial fermentation broth can be extracted and removed as a lipid layer in which soap components and fatty acids are aggregated by adding calcium salt.

The recovery of the aqueous solution layer is not particularly limited, and may be recovered by, for example, decanting or filtration.

(Step 5)

Step 5 is a step of culturing microorganisms in the aqueous solution layer recovered in step 4. In the recovered aqueous solution layer, the organic solvent is reduced or removed to a level that is not toxic to fermentation, and glycerol from which impurities are removed from unrefined glycerol is included as a fermentation substrate, so that microorganisms can be cultured.

The microorganism is not particularly limited as long as it is a microorganism that can be cultured using glycerol as a fermentation substrate. For example, the microorganism is Escherichia genus, Pseudomonas genus, Bacillus genus , Streptomyces genus, Serratia genus, Corynebacterium genus, Salmonella genus, Clostridium genus, Lactobacillus genus, Krebsiella ( A microorganism of the genus Klebsiella or the genus Saccharomyces may be used. As specific examples, Escherichia coli DH5a, E. coli JM109, E. coli K12, E. coli W3110, E. coli X1776, E coli B or E. coli XL1-Blue may be used.

In addition, the microorganism may be a microorganism that produces biofuel, bioplastic, or biochemical. To this end, the microorganism may be a microorganism genetically engineered to introduce or remove a specific gene in order to more efficiently produce a desired biofuel, bioplastic, or biochemical.

For example, the microorganism may be a strain genetically engineered to have 3-HP producing ability or to have 3-HP producing ability. The production of 3-HP includes production in a strain, production in a cell and secretion to the outside of the cell, or a combination thereof. Several pathways are known for the biosynthesis of 3-HP from a carbon substrate such as glycerol, but representative examples are as follows: First, glycerol is dehydrated by glycerol dehydratase (GDH) to form an intermediate Phosphorus is converted into 3-hydroxypropionaldehyde (3-HPA), and 3-hydroxypropionaldehyde (3-HPA) is oxidized by aldehyde dehydrogenase (ALDH) to form 3-HP becomes

Therefore, the microorganism may be a microorganism in which genes of enzymes involved in the biosynthetic pathway of 3-HP are additionally introduced in order to further increase 3-HP production. For example, it may be a microorganism into which a gene encoding glycerol dehydratase and/or a gene encoding aldehyde dehydrogenase has been further introduced.

The term “glycerol dehydratase” or “diol dehydratase” refers to a polypeptide having an enzymatic activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA). says Glycerol dehydratase or diol dehydratase may be coenzyme B12 dependent or independent. The enzyme is, but is not limited to, Klebsiella pneumoniae, Citrobacter freundii, Clostridium pasteurianum, Salmonella typhimurium ), Klebsiella oxytoca, or Clostridium butyricum. The enzyme, regardless of its origin, is included in the scope of the present application as long as it has an enzyme activity that catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HPA), and the gene encoding it is exemplified by dhaB can do.

The term "aldehyde dehydrogenase" is an enzyme that converts an aldehyde to a carboxylic acid, herein from 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP). Refers to a polypeptide having an enzymatic activity that catalyzes the conversion of Aldehyde dehydrogenase, regardless of its origin, is within the scope of the present application as long as it has an enzymatic activity that catalyzes the conversion of 3-hydroxypropionaldehyde (3-HPA) to 3-hydroxypropionic acid (3-HP). included

In addition, in the present application, in order to further increase 3-HP production in microorganisms, a gene encoding a glycerol dehydratase reactivase for reactivating glycerol dehydratase may be further included.

The term "glycerol dehydratase reactivase" is an enzyme that acts to maintain the catalytic activity by re-activating what was irreversibly inactivated during the action of glycerol dehydratase. Any generally known glycerol dehydratase reactivator can be used, for example, Klebsiella sp., Citrobacter sp., Lactobacillus sp. ), Salmonella sp. strains, etc., but is not limited thereto. Glycerol dehydratase reactivase may be DhaFG, GdrAB, DdrAB, etc., and the gene encoding it may be exemplified by dhaFG, gdrAB, ddrAB, etc.

The microorganism may be cultured according to a medium and culture conditions known in the art, except that unpurified glycerol from which impurities are removed according to the present invention is used.

For example, the medium used for culture must suitably satisfy the conditions according to the microorganism. To this end, the medium may contain various carbon sources, nitrogen sources, phosphorus and trace element components. The specific type of medium is a medium such as LB (Luria Bertani) broth, SD (Sabouraud Dextrose) broth, YM (Yeast medium) broth, SA (Sabouraud agar) medium, YT (Yeast extract tryptone) broth, M9 minimal medium, M17 medium Can be used, but is not limited thereto.

A carbon source in the medium may include glycerol. In addition, monosaccharides, oligosaccharides, polysaccharides, single carbon substrates, or mixtures thereof may be exemplified. monosaccharides such as, for example, glucose and fructose; oligosaccharides such as sucrose, maltose or lactose; polysaccharides such as starch or cellulose; Single carbon substrates such as methanol, formaldehyde or formate can be exemplified. In addition, lower alcohols such as ethanol, propanol, and butanol; polyhydric alcohols such as glycerol; organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid, and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, and dodecanoic acid may be exemplified, but are not limited thereto. These materials may be used individually or as a mixture.

Examples of nitrogen sources in the medium include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean wheat, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, It is not limited thereto. Nitrogen sources may also be used individually or as a mixture.

Persons in the medium include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. In addition, the culture medium may include metal salts such as magnesium sulfate or iron sulfate necessary for growth, or may include essential growth substances such as amino acids and vitamins, but is not limited thereto. The above raw materials may be added in a batchwise or continuous manner by a method suitable for the culture during the cultivation process.

In addition, if necessary, the pH of the culture may be adjusted using a basic compound such as sodium hydroxide, potassium hydroxide, or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, antifoaming agents such as fatty acid polyglycol esters may be used to suppress foam formation.

In addition, during cultivation, the formation of bubbles can be suppressed by using an antifoaming agent such as a fatty acid polyglycol ester. In addition, fermentation conditions may be cultured under aerobic, micro-aerobic, or anaerobic conditions, and oxygen or oxygen-containing gas (eg, air) may be injected into the culture to maintain the aerobic condition of the culture. can The incubation temperature and incubation time may be appropriately selected and performed in consideration of the characteristics of the host cell to be used.

In addition, the microbial culture includes, but is not limited to, batch culture, continuous culture, or fed-batch culture.

Methods for recovering product substances (eg, 3-HP) from fermentation media are known in the art. For example, 3-HP can be obtained from the cell medium by performing centrifugation, chromatography, extraction, filtration, precipitation, or a combination thereof.

(repeat steps 1 to 5)

Meanwhile, in step 5, microorganisms may produce materials such as biofuel, bioplastic, or biochemical by microbial culture, and the microbial fermentation broth may be extracted with an organic solvent to recover these materials.

In this case, substances produced by microorganisms can be extracted from the microbial fermentation broth by the organic solvent extraction method, and the microbial fermentation broth remaining after the organic solvent extraction is used as the "microbial fermentation broth containing the organic solvent" in step 1, and steps 1 to 4 are used again. A new microbial fermentation process comprising 5 can be initiated.

Therefore, in step 1 of the present application, "microbial fermentation broth containing an organic solvent" may be an aqueous phase remaining after fermenting microorganisms and extracting and removing a material produced from microorganisms with an organic solvent. In addition, fermentation of the microorganism may be performed in a medium containing glycerol.

In addition, the medium containing the glycerol,

Adjusting the pH of the crude glycerol solution to 2 to 8;

adding a calcium salt to the crude glycerol solution; and

Recovering an aqueous solution layer by layer separation of the non-purified glycerol solution

It may be a medium containing an aqueous solution layer obtained by a method comprising

At this time, each of the above steps may include the features of steps 2 to 5 described above as they are.

As described above, the microbial culture method according to the present invention is a simple and fast method to simultaneously remove impurities of unrefined glycerol and the organic solvent present in the aqueous phase of the microbial fermentation broth, and directly reuse the glycerol and microbial fermentation broth in a new fermentation process There are effects that can be done.

It is a process chart illustrating a microbial culture process according to an embodiment of the present application.

Hereinafter, the present invention will be described in more detail by the following examples. However, these are only for exemplifying the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Preparation of 3-HP fermentation broth

A plasmid pCDF containing a gene encoding glycerol dehydratase (dhaB), a gene encoding aldehyde dehydrogenase (aldH), and a gene encoding glycerol dehydratase reactivase (gdrAB) was prepared. The plasmid used was pCDF_J23101_dhaB_gdrAB_J23100_aldH, and the pCDFDuetJ23 vector was a vector in which the promoter part of the pCDFDuet-1 vector was substituted with the J23101 and J23100 promoters. The dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB genes (about 2.2 kb; gdrA, gdrB) used here are provided by NEB using the following primers and NEB Q5 DNA polymerase on the chromosome of Krebsiella pneumoniae. Amplification was performed using the following conditions:

- dhaB-gdrA-F Primer: GAATTCATGAAAAGATCAAAACGATTTGGCAGTCCT (SEQ ID NO: 1)

- dhaB-gdrA-R Primer: AAGCTTGATCTCCCACTGACCAAAGCTGG (SEQ ID NO: 2)

- gdrB-F primer: AAGCTTAGAGGGGGCCGTCATGTCGCTTTCACCGCCAG (SEQ ID NO: 3)

- gdrB-R primer: CTTAAGTCAGTTTCTCTCACTTAACGGC (SEQ ID NO: 4)

Since the dhaB123 and gdrA genes are located side by side on the Krebsiella pneumoniae chromosome, they were amplified together, and since gdrB is located in the opposite direction to dhaB123 and gdrA, only gdrB was separately amplified. At this time, NEB Q5 DNA polymerase was used. , conditions provided by NEB were used. Thereafter, the dhaB123 and gdrA genes were cloned using restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned under the J23101 promoter using restriction enzymes HindIII and AflII. aldH was cloned under the J23100 promoter and amplified from the E. coli K12 MG1655 chromosome using the promoter below, using the following primers and NEB Q5 DNA polymerase, conditions provided by NEB were used. .

- aldH-F primer: ggtaccatgaattttc atcatctggc (SEQ ID NO: 5)

- aldH-R primer: catatgtcaggcctccaggcttat (SEQ ID NO: 6)

aldH was cloned under the J23108 promoter using restriction enzymes KpnI and NdeI. Through the above cloning, pCDF_J23101_dhaB_gdrAB_J23100_aldH plasmid was prepared. The plasmid was introduced into E. coli W3110 (KCCM 40219) by electroporation using an electroporation device (Bio-Rad, Gene Pulser Xcell) to prepare a 3-HP production strain according to an embodiment of the present application.

The medium contained Na ₂ HPO ₄ 6 g/L, KH ₂ PO ₄ 3 g/L, NaCl 0.5 g/L, NH ₄ Cl 1 g/L, 1M MgSO ₄ 2 mL, and 1M CaCl ₂ 0.1 mL. M9 medium was used and 70 g/L of glycerol was used as a substrate. 3-HP was produced by fermentation (2L) for 24 hours at 30° C. and pH 7.0 at 500 rpm and 1 vvm. Ca(OH) ₂ was used as a neutral agent. The 3-HP fermentation product produced through the fermentation was centrifuged at 6000 rpm for 10 minutes to remove microbial cells. In order to further purify the fermentation broth containing 3-HP from which cells were removed, 2 to 3% by weight activated carbon was added and stirred, and then a purified 3-HP activated carbon solution was obtained through centrifugation or filtration. The final 3-HP yield of the 3-HP fermentation broth was 57.0 g/L.

Example 2. Reaction extraction of 3-HP fermentation broth

The 3-HP fermentation broth in the form of Ca salt produced in Example 1 was titrated with sulfuric acid to remove Gypsum and converted to organic acid 3-HP (pH3). The 3-HP fermentation broth (about 56.5 g/L, 2L) and the reaction extraction solvent (octanol: 1.4L, trioctylamine: 0.6L) were mixed and stirred, and then the fermentation broth and the solvent were separated into layers. The 3-HP reaction extraction efficiency was about 42.3%, and the concentration of the 3-HP fermentation broth remaining in the aqueous phase was about 32.6 g/L.

Example 3. Reuse study for fermentation of new microorganisms

200 g of crude glycerol containing about 80 to 85% of glycerol was mixed with 2 L of the aqueous phase recovered after reaction extraction in Example 2 and dissolved. The pH of the crude glycerol mixture was lowered to 6.8 using 5N hydrochloric acid. The crude glycerol solution was put into a separatory funnel, and a 200 g/L CaCl ₂ solution (16 mL) was added thereto, mixed, and allowed to stand for about 30 minutes. Layer separation was confirmed, and only the aqueous layer was recovered. After mixing the recovered aqueous solution layer with sterilized M9 medium, distilled water was added until the glycerol concentration reached 70 g/L. Here, 3-HP fermentation was performed by inoculating and culturing the 3-HP production strain E. coli W3110 prepared in Example 1.

As a comparative example, crude glycerol containing about 80 to 85% of glycerol was pretreated through pH adjustment and calcium salt addition in the same manner as above to obtain 500 - 600 g/L of crude glycerol (crude glycerol ) To obtain an aqueous solution (300ml), which was mixed with 1.5L of the aqueous phase and sterilized M9 medium recovered after reaction extraction in Example 2, distilled water until the glycerol concentration reached 70 g / L (total volume 2L) was added and mixed. Here, 3-HP fermentation was performed by inoculating and culturing the 3-HP production strain E. coli W3110 prepared in Example 1.

As a result, in the case of the fermentation broth of 3-HP in which impurities and residual organic solvents in unrefined glycerol were removed through pH adjustment and calcium salt addition, the concentration of 3-HP, which was 17.3 g/L before fermentation, increased to 67.0 g after 24 hours of fermentation. It was confirmed that it rose to /L. On the other hand, in the case of the comparative example, the 3-HP concentration, which was 17.3 g / L before fermentation, was 17.3 g / L after fermentation, and as a result, it was confirmed that 3-HP was not produced at all.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be embodied in other specific forms without changing its technical spirit or essential features. Therefore, the embodiments described above should be understood as illustrative in all respects and not limiting. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later and equivalent concepts rather than the detailed description above are included in the scope of the present invention.

<110> LG CHEM, LTD. <120> Method for culturing microorganism by reusing fermented liquid of microorganism <130> DPP20181917KR <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 35 <212> DNA <213> artificial sequence <220> <223> dhaB-gdrA-F primer <400> 1 gaattcatga aaagatcaaa acgatttgca gtcct 35 <210> 2 <211> 29 <212> DNA <213> artificial sequence <220> <223> dhaB-gdrA-R primer <400> 2 aagcttgatc tcccactgac caaagctgg 29 <210> 3 <211> 38 <212> DNA <213> artificial sequence <220> <223> gdrB-F primer <400> 3 aagcttagag ggggccgtca tgtcgctttc accgccag 38 <210> 4 <211> 28 <212> DNA <213> artificial sequence <220> <223> gdrB-R primer <400> 4 cttaagtcag tttctctcac ttaacggc 28 <210> 5 <211> 26 <212> DNA <213> artificial sequence <220> <223> aldH-F primer <400> 5 ggtaccatga attttcatca tctggc 26 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> aldH-R primer <400> 6 catatgtcag gcctccaggc ttat 24

Claims (10)

Adding and mixing crude glycerol to a microbial fermentation broth containing an organic solvent (Step 1);
adjusting the pH of the mixed solution to 2 to 8 (step 2);
adding a calcium salt to the solution (step 3);
recovering an aqueous solution layer by layer separation of the solution (step 4); and
Including the step of culturing microorganisms in the recovered aqueous solution layer (step 5),
Microbial culture method. According to claim 1,
The microbial fermentation broth containing the organic solvent,
Characterized in that the aqueous phase remaining after fermenting microorganisms and extracting and removing substances produced from microorganisms with an organic solvent, a microbial culture method. According to claim 2,
Wherein the fermentation of the microorganism is carried out in a medium containing glycerol. According to claim 3,
The medium containing the glycerol,
Adjusting the pH of the crude glycerol solution to 2 to 8;
adding a calcium salt to the crude glycerol solution; and
Recovering an aqueous solution layer by layer separation of the non-purified glycerol solution
Characterized in that the medium containing the aqueous solution layer obtained by a method comprising a, microorganism culture method. According to claim 2,
The material produced from the microorganism is a biochemical, biofuel or bioplastic, microbial culture method. According to claim 2,
The material produced from the microorganism is 3-hydroxypropionic acid (3-HP), microorganism culture method. According to claim 1 or 4,
The pH adjustment is performed by adding hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, boric acid, hydrogen fluoride (HF), or oxalic acid,
Microbial culture method. According to claim 1 or 4,
To adjust the pH of the mixed solution to 6 to 7, microbial culture method. According to claim 1 or 4,
The calcium salt is CaCl ₂ , CaO, Ca(NO ₃ ) ₂ , Ca(OH) ₂ , or CaS,
Microbial culture method. According to claim 1 or 4,
The amount of the calcium salt added is 1 to 10 g relative to 1 kg of glycerol in unrefined glycerol, microbial culture method.

Images