KR20220029828A - A composition for improving insulin sensitivity comprising extract of broussonetia kazinoki - Google Patents

Abstract

The present invention relates to a composition for alleviating insulin sensitivity containing an extract of Broussonetia kazinoki. The composition according to the present invention alleviates insulin sensitivity by reducing the expression of ITIH1, thereby being able to be usefully used as a therapeutic agent for diabetes, diabetic complications, impaired glucose tolerance, and insulin resistance syndrome.

Description

Composition for improving insulin sensitivity comprising mulberry extract {A COMPOSITION FOR IMPROVING INSULIN SENSITIVITY COMPRISING EXTRACT OF BROUSSONETIA KAZINOKI}

The present invention relates to a composition for improving insulin sensitivity comprising a mulberry extract, and more particularly, to a composition for improving insulin sensitivity by reducing the expression of ITIH1 (Inter-alpha Trypsin Inhibitor Heavy chain 1). .

In normal cases, the body maintains homeostasis by regulating the blood glucose concentration, but in metabolic diseases and diseases accompanied by insulin resistance, blood sugar is excessively increased.

Insulin resistance refers to a case in which the sensitivity to insulin is reduced compared to the normal standard, and an increase in insulin in muscle and adipose tissue is not detected or the action of insulin does not occur effectively even if it is detected. In this case, the blood sugar cannot be lowered, and the balance of cell metabolism and metabolism cannot be effectively maintained.

In order to improve insulin sensitivity, methods of increasing the secretion of insulin itself from pancreatic beta (ß) cells or amplifying the signal transmitted by the insulin receptor binding to insulin in the metabolic pathway are mainly considered. Based on the biological mechanism that induces blood sugar, studies on how to control hyperglycemia by regulating the activity of the protein itself involved in it are insufficient.

ITIH1 (Inter-alpha Trypsin Inhibitor Heavy chain 1) is a protein that is produced in hepatocytes and secreted into the blood, and its concentration and secretion in cells increases by glucose stimulation (Science Translational Medicine, Vol. 11, Issue 513, eaan4735, 2019). Specifically, the increase in ITIH1 is achieved by a decrease in G13, a type of G protein, and an increase in the expression level of OGT (O-GlcNAc transferase) enzyme in hyperglycemia. In a hyperglycemic environment, OGT causes O-GlcNAcylation modification on the serine residue of ITIH1 to increase the stability of ITIH1.

On the other hand, the mulberry ( Broussonetia kazinoki ) is a deciduous broad-leaved tree of the Morus family of the Nettle family, and it is a male and female tree, and the leaves appear in spring and flowers bloom at the same time. The fruit is a ball-shaped drupe, similar to strawberry, and ripens around September. It is mainly grown around cultivated land or in sunny areas at the foot of the mountain. The bark is a material for making paper in Korea, China, and Japan, and the fruit is called 'jeosil' or 'gusuja' and is used medicinally, and the young leaves are also eaten.

Although the effects of mulberry are known to improve inflammatory acne skin, inhibit angiogenesis, and strengthen immune function (Korean Patent Publication No. 10-1827771, Korean Patent Publication No. 10-1693725, Korean Patent Publication No. 10-1039110) No.), the effect of improving insulin sensitivity is not known.

In this regard, the inventors of the present invention have completed the present invention by discovering that the mulberry extract can improve insulin sensitivity by inhibiting the expression of ITIH1.

1) Korean Patent Publication No. 10-1827771 (2018.02.09) 2) Korean Patent Publication No. 10-1693725 (2017.01.09) 3) Korean Patent Publication No. 10-1039110 (June 15, 2011)

Science Translational Medicine, Vol. 11, Issue 513, eaan4735 (2019.10.09)

An object of the present invention is to provide a composition comprising a mulberry extract, capable of improving insulin sensitivity by reducing the expression of ITIH1.

In order to achieve the above object, the present invention provides a composition for improving insulin sensitivity comprising a mulberry extract.

The composition may be a pharmaceutical composition, a food composition, or a feed composition for animals.

In one embodiment, the composition has the effect of increasing insulin sensitivity and decreasing insulin resistance.

In one embodiment, the composition may be for preventing, treating or ameliorating one or more diseases selected from the group consisting of diabetes, diabetic complications, impaired glucose tolerance, and insulin resistance syndrome.

In one embodiment, the diabetic complications may be one or more diseases selected from the group consisting of diabetic retinopathy, diabetic cataract, diabetic nephropathy, and diabetic neuropathy.

In one embodiment, the insulin resistance syndrome may be one or more diseases selected from the group consisting of insulin resistance-induced obesity, hypertension, arteriosclerosis, hyperlipidemia, hyperinsulinemia, nonalcoholic fatty liver, and type 2 diabetes.

In one embodiment, the mulberry extract may be a mulberry root extract, a leaf extract, a fruit extract, an eggplant extract or a stem extract, preferably a mulberry leaf extract.

In one embodiment, the mulberry extract may reduce the expression of itih1 (Inter-alpha Trypsin Inhibitor Heavy chain 1) mRNA or ITIH1 protein.

In one embodiment, the mulberry extract may reduce the expression of ogt (O-GlcNAc Transferase) mRNA.

In one embodiment, the extract may be extracted with a solvent selected from the group consisting of water, C ₁ to C ₆ alcohol, and a mixed solvent thereof, and may be a methanol extract.

In one embodiment, the extract may be extracted with an aqueous solution of methanol 10 times the weight of mulberry, but is not limited thereto.

In one embodiment, the extract may be ultrasonic extraction at 40 to 50 ℃, but is not limited thereto.

The composition comprising the mulberry extract according to the present invention has the effect of improving insulin sensitivity by reducing the expression of ITIH1. Therefore, the composition of the present invention can be usefully used as a therapeutic agent for diabetes, diabetic complications, impaired glucose tolerance, and insulin resistance syndrome.

1 shows the cytotoxicity of mulberry extract.
2 shows an increase in itih1 mRNA expression under high glucose conditions.
3 shows the inhibitory effect of itih1 mRNA expression when treated with mulberry extract.
Figure 4 shows the inhibitory effect of ITIH1 protein expression when treated with mulberry extract.
5 shows an increase in ogt mRNA expression upon MGO treatment in a high glucose condition.
6 shows the inhibitory effect of ogt mRNA expression when treated with mulberry extract.

Hereinafter, embodiments and examples of the present invention will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art to which the present invention pertains can easily carry out. However, the present application may be embodied in various forms and is not limited to the embodiments and examples described herein.

Throughout this specification, when a part "includes" a component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

The present invention relates to a composition for improving insulin sensitivity comprising an extract of mulberry ( Broussonetia kazinoki ).

The composition has the effect of inhibiting the expression of ITIH1 (Inter-alpha Trypsin Inhibitor Heavy chain 1). ITIH1 is a protein produced by hepatocytes and secreted into the blood. The intracellular concentration and secretion of ITIH1 increases by glucose stimulation, and it binds to hyaluronic acid and decreases insulin sensitivity in muscle and fat cells.

In addition, the composition inhibits the expression of O-GlcNAc transferase (OGT). OGT increases the stability and concentration of ITIH1 by causing an O-GlcNAcylation modification on the serine residue of the ITIH1 protein. Therefore, the composition of the present invention has the effect of improving insulin sensitivity by reducing the expression of ITIH1 and OGT.

The insulin sensitivity improvement effect means an increase in insulin sensitivity and a decrease in insulin resistance. Insulin sensitivity refers to the degree to which a person responds to insulin, and a decrease in insulin sensitivity, that is, insulin resistance, refers to a decrease in the response to insulin compared to a normal standard, so that the function of insulin to lower blood sugar is reduced, so that cells cannot effectively burn glucose do.

As the extraction method of the mulberry extract of the present invention, conventional methods in the art such as stirring extraction, filtration, hot water extraction, immersion extraction, reflux cooling extraction and ultrasonic extraction may be used.

The pharmaceutical composition of the present invention may be administered parenterally or orally according to a desired method, and the dosage may vary depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of disease, etc. Its scope is diverse. In addition, the therapeutically effective amount of the composition may vary depending on the method of administration, the target site, and the condition of the patient.

The pharmaceutical composition of the present invention may be prepared according to a conventional method according to a conventional method, respectively, in oral formulations such as powders, granules, tablets, soft or hard capsules, suspensions, emulsions, syrups and aerosols, external preparations for skin such as ointments and creams, suppositories, injections and It can be formulated and used in any form suitable for pharmaceutical preparations, including sterile injection solutions.

Excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, and diluents commonly used for the formulation may be further included. For example, excipients that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate , cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil and the like may be used, but is not limited thereto. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like can be used.

The food composition of the present invention may be a health functional food, and the "health functional food" means a food manufactured and processed using raw materials or ingredients useful for the human body, and "functionality" means the structure and function of the human body It refers to ingestion for the purpose of obtaining useful effects for health purposes, such as regulating nutrients or physiological effects.

Food compositions can be manufactured and processed into health functional foods in the form of tea bags, leached teas, health drinks, etc., and can also be processed into other breads, confectionery, ice cream, noodles, and the like. In addition, the above 　 food 　 composition may be a health supplement 　 or a 　 food additive, and the suitability as a "food additive" is evaluated on the item according to the general rules and general test methods of the Food Additives Code, etc. approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the relevant standards and standards.

The present invention will be described in more detail through the following examples, but the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[Production Example]

Preparation of mulberry extract

10 times of 99.9% methanol was added to 100 g of dried powder for each part of the stem and leaf branch of mulberry ( Broussonetia kazinoki ) sold from the Korea Plant Extracts Bank, and ultrasonic extraction was performed at 45°C. The process of stopping the ultrasonic extractor for 2 hours after operating the ultrasonic extractor for 15 minutes was defined as one time, and the extraction solution was obtained by performing a total of 30 times for 3 days. The extract was filtered and concentrated under reduced pressure at 45° C. to obtain a powder, and the following experiment was performed.

[Example 1]

Confirmation of cell cytotoxicity of mulberry extract

In order to determine whether the mulberry extract was cytotoxic, MTT analysis was performed as follows. HepG2 cells were aliquoted in a 96-well plate so as to become 4×10 ⁴ cell/ml, and then cultured for 24 hours for adhesion and stabilization. After culturing for 24 hours, the final extraction concentration of the mulberry stem, leaf, and eggplant extracts was 10 μg/ml, diluted in the culture solution, supplied to the cell line, and cultured for 24 hours. After 24 hours, the medium was removed, and 100 μl of MTT solution (0.5 mg/ml in PBS) was dispensed and reacted for 30 minutes to reduce MTT in a carbon dioxide wet incubator (CO ₂ Incubator) at 37° C. and 5% conditions. Formazan crystals generated in each well were dissolved in 200 μl of dimethyl sulfoxide (DMSO). Each sample was measured for absorbance at 570 nm using a multimode plate reader (Varioskan LUX multimode plate reader, Thermo Scientific, Vantaa, Finland). was confirmed and shown in FIG. 1 .

As shown in FIG. 1 , as a result of measuring cytotoxicity in the HepG2 cell line, all of the mulberry extracts showed a cell viability of 90% or more compared to the control, confirming that there was no cytotoxicity.

[Example 2]

under high glucose conditions tih1 Confirmation of increased mRNA expression

It is known that ITIH1 binds to hyaluronic acid and is deposited in hepatocytes and decreases the insulin sensitivity of cells.

Primary cells isolated from cell lines or animals were cultured in cell culture medium containing low concentration (5 mM) and high concentration (25 mM) glucose, respectively, for 24 hours. At this time, it was confirmed that the expression of ITIH1 increased while the O-GlcNAc modification (CTD 110.6 clone) increased in the medium containing high concentration of glucose.

Additionally, HepG2 cells were cultured in cell culture medium containing glucose, fructose, methylglyoxal (MGO), glyoxal (GO), glyceraldehyde 3-phosphate (G3P), glyceraldehyde, and glycolaldehyde for 24 hours, respectively. and the expression level of itih1 mRNA was measured and shown in FIG. 2 .

As shown in FIG. 2 , the expression of itih1 mRNA was increased about 1.5-fold in cells cultured in a cell culture medium containing high concentration (25 mM) glucose compared to the normal group. Therefore, in the following, the expression of ITIH1 in HepG2 cells grown in a high glucose medium according to the treatment of the mulberry extract was confirmed at the mRNA and protein levels.

[Example 3]

of mulberry extract tih1 Confirmation of mRNA Expression Inhibition Effect

After the HepG2 cells were treated with the mulberry extract, a real-time polymerase chain reaction (quantitative PCR, qPCR) was performed as follows to confirm the effect of inhibiting itih1 mRNA expression.

After culturing the cells in a cell culture medium containing high concentration (25 mM) glucose for 24 hours, dilute the culture medium so that the final extraction concentration of the mulberry stem, leaf, and eggplant extracts becomes 10 μg/ml, and supply it to the cell line for 24 hours. cultured. After 24 hours, the medium was removed, washed with PBS, and then the adhered cells were scraped off with a scraper and collected by a centrifuge. Total RNA was extracted from the cells using a miRNA extraction kit (mirVana miRNA Isolation Kit), cDNA was synthesized using ReverTra Ace® qPCR RT Master Mix with gDNA Remover, and the transcript expression level was determined using this as template DNA. used to confirm. To check the expression of itih1 mRNA, the primer pair of itih1-qpcr1 and itih1-qpcr2 was used, and the qPCR reaction was performed using the primer pair of gapdh-qpcr1 and gapdh-qpcr2 as a reference gene, respectively. It was confirmed whether the gene sequence was amplified at the cadaver level. The sequences of each primer pair are shown in Table 1 below.

primer sequence (5' → 3' direction) itih1-qpcr1 (SEQ ID NO: 1) TGGACACTTCAGTCAATGGTGT itih1-qpcr2 (SEQ ID NO: 2) GATGAAGGCTGTCTTGGGGA gapdh-qpcr1 (SEQ ID NO: 3) AGGCTGCTTTTAACTCTGGT gapdh-qpcr2 (SEQ ID NO: 4) CCCCACTTGATTTTGGAGGGA

3 shows the expression levels of itih1 mRNA in cells treated with mulberry stem, leaf, and branch extracts.

As can be seen in FIG. 3 , the itih1 mRNA expression in the case of treatment with the mulberry extract was decreased compared to the high glucose condition not treated with the extract, and in particular, in the case of the mulberry leaf extract, the itih1 mRNA expression was normal not treated with the high concentration of glucose. It was confirmed to have a significant effect of recovering to a level similar to that of the group.

[Example 4]

Confirmation of ITIH1 protein expression inhibition effect of mulberry extract

It was confirmed whether the ITIH1 protein was expressed in the cells obtained in Example 3 through western blot. Specifically, cell lysis buffer (RIPA lysis buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS), 120 mM, Protease Inhibitor Cocktail (AEBSF, Aprotinin, Cell lysates were obtained by lysing cells with Bestatin, E64, Leupeptin, and Pepstatin A), Phosphatase Inhibitor Cocktail (sodium fluoride, sodium pyrophosphate, β-glycerophosphate, and sodium orthovanadate), and the cell lysate was mixed with sample buffer (60 mM). Tris-HCl (pH 6.8), 25% glycerol, 0.1% bromophenol blue, 2% SDS, 2% mercapto ethanol) was mixed and incubated for 10 minutes in a heating block at 100°C. The supernatant was collected by centrifugation at 13,000 rpm and 4° C. for 5 minutes, and each sample was loaded and electrophoresed at 120 V by making an SDS PAGE gel (12%). After transferring the entire protein separated in the SDS PAGE gel to the NC membrane, ITIH1 (matured form) and ITIH1 protein expression were confirmed using an antibody against β-actin, and the result is shown in FIG. 4 , the protein band of FIG. The numerical results are shown in Table 2 below.

division Fold value untreated 1.03 High concentration glucose treatment group 1.54 High concentration of glucose + 1 μg/ml of mulberry leaf 0.51 High concentration of glucose + 10 μg/ml of mulberry leaf 0.35

As shown in FIG. 4 and Table 2, when the mulberry leaf extract was treated at a concentration of 1 and 10 μg/ml, respectively, in a cell line in which the expression of ITIH1 protein was increased by 1.5 times or more in a medium containing high concentration of glucose, the amount of ITIH1 protein in all It was confirmed that it decreased significantly.

As a result, it can be seen that the mulberry extract has an effect of improving insulin sensitivity and treating diseases related to insulin resistance by excellently inhibiting both mRNA expression and protein expression of ITIH1, which lowers insulin sensitivity in a hyperglycemic environment.

[Example 5]

under high glucose conditions ogt Confirmation of increased mRNA expression

It is known that an increase in OGT (O-GlcNAc transferase) according to a decrease in G13 (G protein alpha-13) in a hyperglycemic state increases the stability of ITIH1, thereby increasing the intracellular concentration and secretion of ITIH1, and suppressing ogt mRNA as follows. The evaluation method of efficacy was confirmed.

HepG2 cells were cultured in a cell culture medium containing glucose, fructose, methylglyoxal (MGO), glyoxal (GO), glyceraldehyde 3-phosphate (G3P), glyceraldehyde, and glycolaldehyde for 24 hours, respectively, and ogt mRNA The expression level was measured and shown in FIG. 5 .

As shown in FIG. 5 , when MGO, which is known to induce diabetes and diabetic complications, was treated as a precursor of the final glycation product, the expression of ogt mRNA was nearly doubled compared to that of the control group. Therefore, in the following, ogt mRNA expression according to the treatment of the mulberry extract was confirmed in HepG2 cells under high glucose and MGO treatment conditions.

[Example 6]

of mulberry extract ogt Confirmation of mRNA Expression Inhibition Effect

After treating the HepG2 cells with the mulberry extract, real-time polymerase chain reaction (quantitative PCR, qPCR) was performed as follows to confirm the effect of inhibiting ogt mRNA expression.

After culturing HepG2 cells for 24 hours in a cell culture medium containing high concentration (25 mM) glucose, 500 μM MGO was induced for 1 hour. After treatment, the final extraction concentration of the mulberry leaf extract was diluted in the culture solution to 10 μg/ml, supplied to the cell line, and cultured for 24 hours. After 24 hours, the medium was removed, washed with PBS, and then the adhered cells were scraped off with a scraper and collected by a centrifuge. Total RNA was extracted from the cells using a miRNA extraction kit (mirVana miRNA Isolation Kit), cDNA was synthesized using ReverTra Ace® qPCR RT Master Mix with gDNA Remover, and the transcript expression level was determined using this as template DNA. used to confirm. To check the expression of ogt mRNA, the primer pair of ogt-qpcr1 and ogt-qpcr2 was used, and the qPCR reaction was performed using the primer pair of gapdh-qpcr1 and gapdh-qpcr2 as a reference gene, respectively. It was confirmed whether the gene sequence was amplified at the cadaver level. The sequences of each primer pair are shown in Table 3 below.

primer sequence (5' → 3' direction) ogt-qpcr1 (SEQ ID NO: 5) CTTTAGCACTCTGGCAATTAAACAG ogt-qpcr2 (SEQ ID NO: 6) TCAAATAACATGCCTTGGCTTC gapdh-qpcr1 (SEQ ID NO: 3) AGGCTGCTTTTAACTCTGGT gapdh-qpcr2 (SEQ ID NO: 4) CCCCACTTGATTTTGGAGGGA

6 shows the expression level of ogt mRNA in cells treated with mulberry leaf extract.

As shown in FIG. 6 , the expression of ogt mRNA in the high glucose and MGO-treated group increased 1.41 times compared to the normal group, but when the mulberry leaf extract was treated, the ogt mRNA expression decreased to 0.13 times the level of the normal group, resulting in significant OGT It was confirmed that it has an inhibitory effect.

As a result, it can be seen that the mulberry extract has an effect of improving insulin sensitivity and a therapeutic effect of insulin resistance-related diseases by remarkably reducing OGT, which acts to increase ITIH1.

<110> MTera Pharma Co., Ltd. apharma <120> A COMPOSITION FOR IMPROVING INSULIN SENSITIVITY COMPRISING EXTRACT OF BROUSSONETIA KAZINOKI <130> MTR20P-0006-KR <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> itih1-qpcr1 <400> 1 tggacacttc agtcaatggt gt 22 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> itih1-qpcr2 <400> 2 gatgaaggct gtcttgggga 20 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> gapdh-qpcr1 <400> 3 agggctgctt ttaactctgg t 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> gapdh-qpcr2 <400> 4 ccccacttga ttttggaggg a 21 <210> 5 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> ogt-qpcr1 <400> 5 ctttagcact ctggcaatta aacag 25 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> ogt-qpcr2 <400> 6 tcaaataaca tgccttggct tc 22

Claims (15)

A pharmaceutical composition for improving insulin sensitivity, comprising an extract of mulberry tree ( Broussonetia kazinoki ).
The pharmaceutical composition for improving insulin sensitivity according to claim 1, characterized in that it has effects of increasing insulin sensitivity and decreasing insulin resistance.
According to claim 1, Diabetes, diabetes complications, impaired glucose tolerance, and insulin resistance syndrome (Insulin resistance syndrome) characterized in that for preventing or treating one or more diseases selected from the group consisting of, the pharmaceutical composition.
The pharmaceutical composition according to claim 3, wherein the diabetic complications are at least one disease selected from the group consisting of diabetic retinopathy, diabetic cataract, diabetic nephropathy, and diabetic neuropathy.
The method of claim 3, wherein the insulin resistance syndrome is one or more diseases selected from the group consisting of insulin resistance-induced obesity, hypertension, arteriosclerosis, hyperlipidemia, hyperinsulinemia, nonalcoholic fatty liver, and type 2 diabetes. , pharmaceutical composition.
The pharmaceutical composition according to claim 1, wherein the mulberry extract is a mulberry stem extract, a mulberry leaf extract, or a mulberry branch extract.
The pharmaceutical composition according to claim 6, wherein the mulberry extract is a mulberry leaf extract.
The pharmaceutical composition according to claim 1, wherein the mulberry extract is characterized in that it reduces the expression of ITIH1 (Inter-alpha Trypsin Inhibitor Heavy chain 1) mRNA or protein.
The pharmaceutical composition according to claim 1, wherein the mulberry extract reduces the expression of ogt (O-GlcNAc Transferase) mRNA.
A food composition for improving insulin sensitivity, comprising a mulberry extract.
The food composition for improving insulin sensitivity according to claim 10, characterized in that it has effects of increasing insulin sensitivity and decreasing insulin resistance.
11. The method of claim 10, diabetes, diabetic complications, impaired glucose tolerance, and insulin resistance syndrome (Insulin resistance syndrome) characterized in that for preventing or ameliorating one or more diseases selected from the group consisting of, the food composition.
A feed composition for animals for improving insulin sensitivity, comprising a mulberry extract.
The feed composition for animals for improving insulin sensitivity according to claim 13, characterized in that it has effects of increasing insulin sensitivity and decreasing insulin resistance.
According to claim 13, Diabetes, diabetic complications, impaired glucose tolerance, and insulin resistance syndrome (Insulin resistance syndrome) characterized in that for preventing or improving at least one disease selected from the group consisting of, animal feed composition.

Images