KR20220005351A - Composition for diagnosing polycystic kidney disease comprising agent for detecting TNFSF13 and use thereof - Google Patents

Abstract

The present invention provides a composition for diagnosing polycystic kidney disease (PKD) including an agent capable of detecting the expression of TNFSF13, a kit for diagnosing polycystic kidney disease including the composition, and a method for screening a therapeutic agent for polycystic kidney disease including a step of measuring the expression level of TNFSF13. Polycystic kidney disease can be diagnosed in an early stage and prognosis can be predicted from a sample obtained by a non-invasive method such as urine from a patient by using the polycystic kidney disease marker TNFSF13 provided in the present invention.

Description

Composition for diagnosing polycystic kidney disease comprising agent for detecting TNFSF13 and use thereof

The present invention provides a composition for diagnosing and/or predicting polycystic kidney (PKD), comprising an agent capable of detecting the expression of TNFSF13 protein and/or a gene encoding the same, polycystic kidney diagnosis and/or comprising the composition It relates to a method for screening a composition for preventing or treating polycystic kidney using a kit for predicting prognosis and an agent for detecting the expression of TNFSF13 protein and/or a gene encoding the same.

Polycystic kidney disease or polycystic kidney disease is a genetic disease in which the kidney is deformed into a honeycomb shape due to multiple fluid-filled cysts, and is classified into autosomal dominant polycystic kidney (ADPKD) and autosomal recessive polycystic kidney (ARPKD).

Autosomal dominant polycystic kidney (ADPKD, hereinafter referred to as "polycystic kidney") is the most common hereditary kidney disease in the kidney, with an incidence of 1 in 1,000 people. In patients with polycystic kidney, multiple cysts develop in both kidneys, and the size and number of cysts increase, eventually leading to death due to renal failure in the 50s and 60s. The cyst progresses as the cyst epithelial cell proliferates and then the cyst fluid fills the cyst, causing the cyst to increase in size.

Polycystic kidney accounts for about 2% of domestic dialysis patients, and is the second most common cause after diabetes, hypertension, and glomerulonephritis. Polycystic kidney not only causes structural and functional defects in both kidneys, but also can be accompanied by various kidney complications, so management is required from the relatively early stage of the disease.

The causative genes of polycystic kidney are PKD1 and PKD2 genes, which encode proteins called polycystin-1 and polycystin-2, respectively. It is known that 85% of patients diagnosed with polycystic kidney are due to a defect in the PKD1 gene and the remaining 15% to a defect in the PKD2 gene.

Currently, there is no known cure method for polycystic kidney, and recent research is being conducted in the direction of reducing disease morbidity and death due to complications. this is required

It is an object of the present invention to provide a composition for diagnosing and/or predicting prognosis of polycystic kidney, comprising an agent for detecting tumor necrosis factor ligand superfamily member 13 (TNFSF13).

Another object of the present invention is to provide a kit for diagnosis and/or prognosis prediction of polycystic kidney, or a method for providing information necessary for diagnosis and/or prognosis prediction, comprising the composition for diagnosis.

Another object of the present invention is to provide a screening method for the prevention or treatment of polycystic kidney, comprising the step of measuring the amount of TNFSF13.

In order to achieve the above object of the present invention, the present inventors confirmed that the transcription amount of the TNFSF13-encoding gene and/or the expression level of the TNFSF13 protein in the cystic epidermal cells and culture medium of a polycystic kidney patient decreased, The present invention was completed by confirming the function as a marker.

The present invention provides a composition for diagnosis and/or prognosis prediction of polycystic kidney, comprising an agent for detecting tumor necrosis factor ligand superfamily member 13 (TNFSF13), diagnosis of polycystic kidney comprising the composition, and Provides a method for providing information necessary for diagnosing polycystic kidney and/or prognosis, comprising measuring the amount of transcription and/or the expression of TNFSF13 protein of a kit for predicting / or prognosis, and TNFSF13 gene.

The present invention also provides a method for screening a composition for alleviation or treatment of polycystic kidney, comprising the step of treating the cell with a candidate substance and examining the transcription amount of the TNFSF13 gene and/or the expression level of the TNFSF13 protein.

Hereinafter, the present invention will be described in more detail.

In the present invention, the term “diagnosis” refers to ascertaining the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to determine whether the polycystic kidney mutant gene is present or has the onset.

In the present invention, the term "polycystic kidney" refers to polycystic kidney disease or polycystic kidney disease, for example, it may be autosomal dominant polycystic kidney disease or autosomal recessive polycystic kidney disease, preferably autosomal dominant polycystic kidney disease. may be a disease.

In the present invention, the term “gene” refers to genetic material including DNA, RNA, and the like, and may refer to genetic material including exons and introns, cDNA, and/or mRNA.

In the present invention, the “control group” may refer to a population other than a healthy group (or normal group) and/or polycystic kidney patients, or a patient group known to have a good prognosis among polycystic kidney patients, but is not limited thereto.

In the present invention, "TNFSF13 gene" refers to a gene encoding TNFSF13 protein, and "TNFSF13 expression" includes both transcription and/or expression of a gene encoding TNFSF13 protein, and expression of TNFSF13 protein.

The composition for diagnosis of polycystic kidney provided by the present invention includes a gene encoding TNFSF13 protein and/or an agent detecting TNFSF13 protein.

The agent for detecting the gene can be freely selected and used by those skilled in the art as long as the expression level of the gene can be measured, for example, it may be an oligonucleotide, primer or probe that specifically binds to the TNFSF13 gene. The primer may be a primer pair consisting of SEQ ID NOs: 1 and 2.

The agent for detecting the TNFSF13 protein can be selected and used without limitation as long as it is an agent capable of measuring the expression or activity level of the protein, for example, an antibody, peptide, aptamer or nucleotide that specifically binds to the TNFSF13 protein. can be The agent for measuring the expression of the protein refers to all kinds of antibodies within the target range for specifically binding to the protein, for example, polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof. Including all, but not limited thereto.

The detection agent can be used without limitation in the range of purposes for detecting a gene encoding TNFSF13 protein and/or TNFSF13 protein from a biological sample, and the biological sample is a patient's tissue, blood, cell, plasma, serum, urine, It may be one or more selected from the group consisting of cyst fluid, and saliva, but is not limited thereto. In one example, the biological sample may be a sample isolated from a patient by a non-invasive method.

In one embodiment of the present invention, total RNA is extracted from renal epithelial cells isolated from polycystic kidney patients, cDNA is prepared through RT-PCR, and PCR is performed again using the cDNA as a template to generate TNFSF13 gene in the control group and the patient group. mRNA expression levels were compared. After PCR, each sample was electrophoresed and band intensities were compared. As a result, the mRNA expression level of TNFSF13 in the epithelial cells of the renal cysts of patients with autosomal dominant polycystic kidney was statistically significantly lower than that of the control group. Therefore, the TNFSF13 gene or the TNFSF13 protein encoded by the gene can be utilized as a biomarker for diagnosing polycystic kidney, for example, autosomal dominant polycystic kidney (see Example 2).

In one embodiment of the present invention, the expression pattern of TNFSF13 protein in renal epidermal cells isolated from polycystic kidney patients was confirmed by Western blot. As a result, it was confirmed that the TNFSF13 protein band appeared remarkably faint compared to the control cells, and the expression level of the TNFSF13 protein was also reduced in the patient group like mRNA. Therefore, TNFSF13 protein can be utilized as a biomarker for diagnosing polycystic kidney, for example, autosomal dominant polycystic kidney (see Example 3).

In one embodiment of the present invention, the amount of TNFSF13 protein in the renal epidermal cell culture medium isolated from polycystic kidney patients was measured by ELISA. As a result, the amount of TNFSF13 protein in the culture medium was decreased in all patient samples statistically significantly compared to the culture medium of the control cells. Therefore, it was confirmed that the amount of extracellularly secreted TNFSF13 was also significantly lower in polycystic kidney patients, and through this, it can be seen that polycystic kidney, for example, autosomal dominant polycystic kidney, can be diagnosed by detecting TNFSF13 using a non-invasive method ( see Example 4).

In one embodiment of the present invention, the TNFSF13 content in urine of the Non-progressor group known to have a good prognosis among polycystic kidney patients and the Progressor group known to have a poor prognosis among polycystic kidney patients was measured. As a result, the TNFSF13 content in the group known to have a good prognosis was higher than the TNFSF13 content in the group known to have a poor prognosis. It was confirmed that it is possible (refer to Example 5). Another embodiment of the present invention relates to a kit for diagnosing polycystic kidney, comprising a gene encoding TNFSF13 protein and/or an agent for detecting TNFSF13 protein.

The diagnostic kit is an agent for detecting the gene encoding the TNFSF13 protein and/or the TNFSF13 protein, for example, a primer, a probe, an antisense oligonucleotide, an aptamer, and an antibody It contains one or more agents selected from the group consisting of In addition, one or more other component compositions, solutions, and/or devices suitable for analytical methods may be included.

As a specific example, the kit for measuring the expression level of the gene encoding the TNFSF13 protein in the present invention may be a kit including essential components necessary to perform real-time polymerase chain reaction (RT-PCR). The RT-PCR kit contains, in addition to each primer pair specific for the gene encoding the TNFSF13 protein, a test tube or other suitable container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase, and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like. It may also include a pair of primers specific for a gene used as a quantitative control.

Also, in one example, the kit of the present invention may be a diagnostic kit including essential components necessary to perform a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, a reagent for preparing a fluorescently-labeled probe, an agent, an enzyme, and the like. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

As another specific example, the kit for measuring the expression level of TNFSF13 protein in the present invention includes a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent material, a chromogenic substrate, etc. for immunological detection of the antibody. may include In the above, as the substrate, a nitrocellulose membrane, a 96-well plate synthesized from a polyvinyl resin, a 96-well plate synthesized from a polystyrene resin, and/or a glass slice glass may be used, and the chromogenic enzyme is peroxidase , Alkaline Phosphatase may be used, FITC, RITC, etc. may be used as a fluorescent material, and ABTS (2,2'-azino-bis(4-ethylbenzothiazoline-6-sulfonyl) as a color development substrate. phonic acid)) or OPD (o-phenylenediamine), TMB (tetramethyl benzidine) may be used.

Each material exemplified in the composition of the kit is for illustration only, and a person skilled in the art may appropriately change the composition as needed.

Another example of the present invention is a method of providing information necessary for diagnosing polycystic kidney and/or predicting the prognosis of polycystic kidney, comprising measuring the expression level of a gene encoding TNFSF13 protein and/or TNFSF13 protein from a sample it's about

The sample may be at least one selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient and/or control group.

The method comprises the steps of measuring the expression level of the TNFSF13 gene and / or TNFSF13 protein from a sample isolated from the patient, and the expression level of the TNFSF13 gene and / or TNFSF13 protein in the control sample. Expression of the TNFSF13 gene and / or TNFSF13 protein It may include a step of comparing with the degree. The method for measuring the TNFSF13 gene expression level is, for example, reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction, real time reverse transcriptase polymerase chain reaction (Real time RT-PCR), RNase At least one method selected from the group consisting of a protection assay, Northern blotting, and a DNA chip may be used.

In the reverse transcriptase polymerase chain reaction, by confirming the band pattern and the thickness of the band by electrophoresis after the reaction, it is possible to check the presence and level of TNFSF13 gene expression, and by comparing it with the control group, the onset or progression of polycystic kidney can be diagnosed. have. Specifically, when the TNFSF13 gene expression level is lower than that of the control group, polycystic kidney disease can be diagnosed. Methods for measuring the expression level of the TNFSF13 protein include western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Oukteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, One or more methods selected from the group consisting of FACS, and a protein chip may be performed, but the present invention is not limited thereto.

In one embodiment, the protein expression level is measured using an ELISA method. ELISA is a direct ELISA using a labeled antibody recognizing an antigen attached to a solid support, an indirect ELISA using a labeled antibody recognizing a capture antibody in a complex of antibodies recognizing an antigen attached to a solid support, Direct sandwich ELISA using another labeled antibody that recognizes an antigen in a complex of an antibody and antigen It includes various ELISA methods such as indirect sandwich ELISA using a secondary antibody. More preferably, after attaching an antibody to a solid support and reacting the sample, a labeled antibody recognizing the antigen of the antigen-antibody complex is attached to enzymatically develop color or for an antibody recognizing the antigen of the antigen-antibody complex Detection is performed by a sandwich ELISA method in which a labeled secondary antibody is attached and enzymatically developed. By confirming the degree of complex formation between the polycystic kidney marker TNFSF13 protein and the antibody, the onset and/or progression of polycystic kidney can be confirmed.

In one example, the protein expression level is measured using a protein chip in which one or more antibodies against TNFSF13 protein are arranged at a predetermined position on a substrate and immobilized at a high density. In the method of analyzing a sample using a protein chip, the protein is separated from the sample, the separated protein is hybridized with the protein chip to form an antigen-antibody complex, and the presence or expression level of the protein is checked by reading it, It is possible to determine whether liver fibrosis or liver cirrhosis has occurred.

The method of providing information necessary for diagnosing polycystic kidney provided by the present invention is after the step of comparing the expression level of the TNFSF13 gene and/or TNFSF13 protein in the patient sample with the expression level of the TNFSF13 gene and/or TNFSF13 protein of the control group When the expression level of the TNFSF13 gene and/or TNFSF13 protein in the patient sample is lower than that of the control, the method may further include determining a polycystic kidney patient. In one example, when the amount of the gene encoding the TNFSF13 protein in the sample is 0.5 times or less, 0.4 times or less, 0.3 times or less, 0.2 times or less, 0.1 times or less, 0.02 times or less, 0.015 times or less, or 0.01 times or less compared to the normal group , the patient from which the sample was obtained may be determined as an autosomal dominant polycystic kidney patient.

In one example, when the content of TNFSF13 protein in the sample is 0.7 times or less, 0.5 times or less, 0.4 times better, 0.3 times or less, 0.27 times or less, 0.25 times or less, or 0.2 times or less compared to the control group (normal group), the sample is The obtained patient can be determined as an autosomal dominant polycystic kidney patient.

Through the detection method, it is possible to diagnose the onset of polycystic kidney, cyst formation and prognosis of progression in a patient with polycystic kidney. That is, by comparing the expression level of the gene encoding the TNFSF13 protein and / or the TNFSF13 protein in the patient with the gene encoding the TNFSF13 protein and / or the expression level of the TNFSF13 protein in the control, the patient's TNFSF13 gene and / or TNFSF13 protein expression level is If it appears lower than in the control group, polycystic kidney disease can be diagnosed as onset or advanced.

In one embodiment of the present invention, as a result of measuring the mRNA amount of TNFSF13 gene in cyst epithelial cells of polycystic kidney patients using RT-PCR, a clear band appeared in the control group, whereas a faint band appeared in the patient group (Example see 2). The method of providing information necessary for predicting the prognosis of polycystic kidney provided by the present invention includes measuring the expression level of a gene encoding TNFSF13 protein and/or TNFSF13 protein in a sample isolated from a patient.

In the method of providing information necessary for predicting the prognosis of polycystic kidney provided by the present invention, the method of providing information necessary for the diagnosis of polycystic kidney is performed, or by using a polycystic kidney diagnosis method other than the above method, the patient is determined to be a polycystic kidney patient. It may be performed for

In the method of providing information necessary for predicting the polycystic kidney prognosis, the control group may refer to a patient group with a good prognosis among polycystic kidney patients. The prognosis is good It means that the increase in size or number of cysts is slow in the future, and the decline in renal function occurs slowly. For example, the patient with a good prognosis may refer to a group (Non-progressor) having a related mutation (eg, a PKD2 gene mutation and/or a PKD1 missense mutation, etc.).

In one example, when the concentration of the TNFSF13 gene and/or protein in the sample is lower than that of the control, it can be predicted that the polycystic kidney has a poor prognosis (see Example 5).

In one embodiment, when the content of TNFSF13 protein and/or gene in the sample is 0.8 times or less, 0.7 times or less, 0.6 times or less, 0.5 times or less, 0.4 times or less, or 0.3 times or less compared to the control, the patient from whom the sample was obtained can be determined as an autosomal dominant polycystic kidney of

In another embodiment, when the concentration of TNFSF13 protein in the sample is less than 700fg/mg creatinine, less than 600fg/mg creatinine, less than 500fg/mg creatinine, less than 400fg/mg creatinine, or less than 300fg/mg creatinine, the prognosis of polycystic kidney is poor. can be predicted that

Therefore, the method of providing information necessary for predicting the prognosis of polycystic kidney provided by the present invention compares the expression level of the TNFSF13 gene and/or TNFSF13 protein in the patient sample with the expression level of the TNFSF13 gene and/or TNFSF13 protein in the control group. After the step, when the expression level of the TNFSF13 gene and/or TNFSF13 protein in the patient sample is lower than that of the control, the step of determining that the prognosis of polycystic kidney is poor may be further included. In the present specification, the prognosis of polycystic kidney is that the prognosis is poor when an increase in the number and/or size of cysts and/or a decrease in renal function is predicted over time in consideration of the number, size, and/or renal function of the cyst. can be judged.

Another embodiment of the present invention relates to a screening method for a polycystic kidney treatment, comprising treating a candidate substance for the polycystic kidney treatment and detecting a change in the expression level of the TNFSF13 gene and/or TNFSF13 protein. In the present invention, the polycystic kidney treatment includes a substance that alleviates or stops the progression of polycystic kidney.

Specifically, it is a method of comparing the increase or decrease in the expression of TNFSF13 gene and/or TNFSF13 protein in the presence and absence of a polycystic kidney treatment candidate, and it can be usefully used for screening polycystic kidney therapeutics. Substances that directly or indirectly increase the TNFSF13 gene mRNA or TNFSF13 protein concentration may be selected as a therapeutic agent for polycystic kidney. That is, after measuring the expression level of the marker TNFSF13 gene and/or TNFSF13 protein of the present invention in the presence of a polycystic kidney treatment candidate substance and comparing both, the TNFSF13 gene and/or TNFSF13 protein in the presence of a polycystic kidney treatment candidate substance A substance whose expression level increases than the expression level of the TNFSF13 gene and/or TNFSF13 protein in the absence of a polycystic kidney candidate may be determined as a therapeutic agent for polycystic kidney.

The diagnostic composition comprising an agent for measuring the amount of transcription of the TNFSF13 gene and/or the expression level of the TNFSF13 protein provided by the present invention can be usefully used for the early diagnosis of polycystic kidney and management of the resulting disease at low cost. In particular, it can be applied as a target for the development of therapeutic agents that can inhibit the growth of renal cyst size in patients in the future.

The prognosis of cyst proliferation in patients with polycystic kidney can be predicted by using a composition comprising an agent for measuring the amount of transcription and/or expression of TNFSF13 protein of the TNFSF13 gene provided by the present invention. It can be used as a biomarker that can predict the degree of disease progression according to proliferation, and through this, it is possible to provide personalized treatment for each patient.

1a is the result of confirming the expression level of TNFSF13 gene in cyst epithelial cells (Cyst#1 and Cyst#2) and control cells (RPTEC) of polycystic kidney patients using real-time polymerase chain reaction.
Figure 1b is a photograph of the result of confirming the expression level of TNFSF13 protein in cyst epithelial cells and control cells of polycystic kidney patients using Western blot.
2a is a graph of quantitative analysis of the expression level of TNFSF13 protein in cyst epithelial cells and control cells of a polycystic kidney patient using ELISA.
Figure 2b is a graph of the results of measuring the amount of TNFSF13 in the urine of polycystic kidney patients (Progressor) with a mutation known to have a bad prognosis and a group with a mutation known to have a good prognosis (Non-progressor) using ELISA.

Hereinafter, the present invention will be specifically described by way of Examples. However, the following examples are only for illustrating the present invention, and do not limit the scope of the present invention.

Example 1. Preparation of samples

Kidney tissue samples from patients with polycystic kidney were supplied by Seoul National University Hospital. Cell culture was performed by extracting a part of the cyst from the kidney extracted from a patient with autosomal dominant polycystic kidney. Cell culture was performed in DMEM/10% (v/v) FBS medium at 37°C and 5% CO2 conditions. As a control sample, normal (non-patient) renal epidermal cells called RPTEC/TERT1 (CRL-4031) (hereinafter referred to as “RPTEC”) purchased from ATCC were used.

Example 2. Confirmation of mRNA level of TNFSF13 in cystic epithelial cells of polycystic kidney patients

2-1. RNA sample preparation

Total intracellular RNA was extracted from the cells cultured in Example 1 using Qiagen's RNeasy Plus Mini Kit. Specifically, 1X10^7 cells were first obtained and cell lysis was performed using RLT lysis buffer. Lysate was transferred to the gDNA Eliminator spin column, centrifuged at 10,000 rpm for 30 seconds, the same amount of 70% EtOH was added to the flow-through, mixed, and then transferred to an RNeasy spin column and centrifuged at 10,000 rpm for 15 seconds. After putting 700ul of RW1 buffer into the column, centrifugation at 10,000rpm for 15 seconds, adding 500ul of RPE buffer to the column, centrifugation at 10,000rpm for 15 seconds, air dry 50ul RNase-free water into the column, and then 10,000 Total RNA was extracted by centrifugation at rpm for 15 seconds

2-2. RT-PCR

Using the extracted total RNA as a template, cDNA was prepared through reverse transcription polymerase chain reaction (RT-PCR) using TAKARA's PrimeScript RT-PCR Kit. Reaction Mixture, Reagent Mixture, and Thermal condition information are as follows.

(1) reaction mixture;

Template (RNA) 2ug

Oligo dT primer (2.5uM) 1ul

dNTP (10mM each) 1ul

RNase Free dHO up to 10ul

Denaturation at 65℃ for 5 min

(2) Reagent mixture;

reaction mixture 10ul

5X PrimeScript Buffer 4ul

RNase Inhibitor (40U/ul) 0.5ul

PriemScript RTase 0.5ul

RNase Free dH2O 5ul

(3) Thermal condition;

30℃ 10 min

42℃ 30 min

95℃ 5min

4℃ storage

2-3. Comparison of TNFSF13 expression level between control group and patient group

Using the cDNA sample prepared in Example 2-2 as a template, the expression level of the TNFSF13-encoding gene was measured by reverse transcription polymerase chain reaction (RT-PCR) using the primer sets of SEQ ID NOs: 1 and 2 shown in Table 2 below. was amplified using the TNFSF13 expression level of the control group (RPTEC; see Example 1) and the patient group (refer to Example 1) was compared. As a control, the GAPDH gene was used. The primer sets used for the amplification of the GAPDH gene and the amplification of the TNFSF13 cDNA are shown in Table 1 below.

SEQ ID NO: primer sequence (5'->3') One TNFSF13_forward AGAAGAAGCAGCACTCTGTC 2 TNFSF13_reverse CCATGTGGAGAGAGGTTAAG 3 GAPDH_forward TTGCCATCAATGACCCCTTCA 4 GAPDH_reverse CGCCCCACTTGATTTTGGA

After PCR, each sample was electrophoresed on an agarose gel to compare mRNA expression levels through the band intensity of each PCR product. Figure 1a shows a photograph of the result of examining the mRNA expression level of the TNFSF13 gene in renal cyst epithelial cells of autosomal dominant polycystic kidney patients. The band intensity of the control GAPDH did not show a significant change between the control cells (control, RPTEC) and the autosomal dominant polycystic kidney patient cells, but in the case of TNFSF13, the band in the control cells had a similar intensity to GAPDH. On the other hand, there was almost no band in the autosomal dominant polycystic kidney patient group, confirming that the mRNA expression level of TNFSF13 in the patient group was commonly reduced. A graph of the results of real-time polymerase chain reaction (Real time-PCR, RT-PCR) is shown. When the fold change in the control group, RPTEC, was set to 1, the fold change of 2 patients was measured to be 0.015 and 0.010, respectively, and it was quantitatively confirmed that the expression level of TNFSF13 was lower in the polycystic kidney patients compared to the healthy group.

Example 3. Confirmation of protein level of TNFSF13 in cystic epithelial cells of polycystic kidney patients (Western blot)

In addition, the expression level of TNFSF13 in the control cells and the epithelial cells of the renal cyst of a polycystic kidney patient (see Example 1) was confirmed using Western blot. As a control to check the protein expression level, b-actin protein was selected. For TNFSF13, Abcam's anti-TNFSF13 (ab189263) antibody, and for b-actin, Sigma's monoclonal anti-b-actin (A5316) antibody was 1 each. : It was used at a dilution concentration of 1000.

Figure 1b shows the Western blot results. Western blot also confirmed that, as in RT-PCR, TNFSF13 protein in cyst epithelial cells (indicated by Cyst #1 and Cyst #2) was decreased compared to control cells.

Example 4. Identification of protein levels of TNFSF13 in cyst epithelial cells of polycystic kidney patients (ELISA)

In order to examine whether the accumulation of TNFSF13 in the cystic epithelial cells of a polycystic kidney patient in the cell culture medium was reduced compared to that of the non-patient group, the renal cyst epithelial cells cultured in substantially the same manner as in Example 1 and a culture medium of control cells (RPTEC) An enzyme-linked immunosorbent assay (ELISA) was performed.

Specifically, cyst epithelial cells (Cyst #1 and #2) and control cells (RPTEC) isolated from the patient in substantially the same manner as in Example 1 were cultured, respectively, and Human Osteopontin (OPN: SOST00) ELISA of R&D System Co., Ltd. The amount of TNFSF13 was measured using the kit.

Figure 2a shows a graph showing the result of measuring the amount of TNFSF13 in the culture medium (cyst#1 and Cyst#2) of autosomal dominant polycystic kidney patients by ELISA. As a result of ELISA, it was confirmed that the amount of TNFSF13 protein in the cell culture was significantly decreased in both samples of the two patients. Specifically, the control group showed a TNFSF13 protein concentration of 13.7 pg/mL, and the patient had 3.2 pg/mL and 3.6 pg/mL, respectively.

Therefore, it was confirmed that the expression level of TNFSF13 was decreased in the epithelial cells of the renal cyst of the autosomal dominant polycystic kidney patient, and in particular, it was confirmed that the secretion of TNFSF13 was high only in the healthy control cells (RPTEC).

Example 5. Prediction of polycystic kidney prognosis by a non-invasive method using TNFSF13

In order to confirm the diagnostic and/or prognosis predictability of autosomal dominant polycystic kidney using TNFSF13 using a non-invasive method, the non-progressor group and prognosis, classified according to the type of autosomal mutation in the patient group, are known to have a good prognosis. The amount of TNFSF13 protein in the urine was measured using ELISA using the urine of a patient of the Progressor group, which is known to have poor blood pressure.

Specifically, the non-progressor group was classified into a group corresponding to Class 1A-1B according to the Mayo Clinic classification in the United States, that is, a group with a small kidney volume according to age and a PKD2 gene mutation and a PKD1 missense mutation 11 patients was targeted. The Progressor group included 11 patients who were identified as having a nonsense mutation in the PKD1 gene with a large kidney volume according to age, that is, a group corresponding to Class 1C-1E according to the Mayo Clinic classification in the US.

ELISA was performed in substantially the same manner as in Example 4, and a graph of the results is shown in FIG. 2B. As a result of ELISA, the TNFSF13 concentration in the non-progressor group with a relatively good prognosis was higher in the Progressor group, even between the Non-progressor group, a patient group with a mutation known to have a relatively good prognosis, and the Progressor group, a patient group with a mutation known to have a relatively poor prognosis. appeared at a higher concentration than Through the above results, it was confirmed that both the TNFSF13 protein and the gene encoding it and the mRNA transcribed from the gene can be utilized as biomarkers capable of predicting the prognosis of autosomal dominant polycystic kidney.

<110> Seoul National University R&DB Foundation <120> Composition for diagnosing polycystic kidney disease comprising agent for detecting TNFSF13 and use thereof <130> DPP20201839KR <160> 4 <170> enPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFSF13_forward <400> 1 agaagaagca gcactctgtc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFSF13_reverse <400> 2 ccatgtggag agaggttaag 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_forward <400> 3 ttgccatcaa tgaccccttc a 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 4 cgccccactt gattttgga 19

Claims (10)

Tumor necrosis factor ligand superfamily member 13 (Tumor necrosis factor ligand superfamily member 13, TNFSF13) comprising at least one agent selected from the group consisting of an agent for detecting a protein, and an agent for detecting the mRNA of a gene encoding the TNFSF13 protein, A composition for diagnosis of polycystic kidney. A kit for diagnosis of polycystic kidney, comprising the composition according to claim 1. Tumor necrosis factor ligand superfamily member 13 (Tumor necrosis factor ligand superfamily member 13, TNFSF13) comprising at least one agent selected from the group consisting of an agent for detecting a protein, and an agent for detecting the mRNA of a gene encoding the TNFSF13 protein, A composition for predicting the prognosis of polycystic kidney. A kit for predicting the prognosis of polycystic kidney, comprising the composition according to claim 3 . A method of providing information necessary for diagnosing polycystic kidney, comprising measuring the expression level of one or more selected from the group consisting of a gene encoding TNFSF13 protein and TNFSF13 protein from a sample isolated from a patient. The method of claim 5, wherein the sample is at least one selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient. The method of claim 5, further comprising: measuring the expression level of one or more selected from the group consisting of a gene encoding TNFSF13 protein and TNFSF13 protein from a sample isolated from a control group other than a polycystic kidney patient;
Comparing the expression level of the patient and the control; and
When the expression level in the patient sample is lower than that of the control, determining the patient as a polycystic kidney patient. A method of providing information necessary for predicting the prognosis of polycystic kidney, comprising measuring the expression level of one or more selected from the group consisting of a gene encoding TNFSF13 protein and TNFSF13 protein from a sample isolated from a patient. The method of claim 8, wherein the sample is at least one selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient. The method of claim 8, further comprising: measuring the expression level of one or more selected from the group consisting of a gene encoding TNFSF13 protein and TNFSF13 protein from a sample isolated from a control group having a good prognosis of polycystic kidney;
Comparing the expression level of the patient and the control; and
When the expression level in the patient sample is lower than that of the control group, determining the patient as a patient with poor polycystic kidney prognosis.

Images