KR20210063202A - Composition for diagnosing polycystic kidney disease comprising agent for detecting Metrnl and use thereof - Google Patents

Abstract

The present invention provides a polycystic kidney disease (PKD) diagnostic composition comprising an agent capable of detecting Metrnl expression, a polycystic kidney disease diagnostic kit comprising the composition, and a method for screening a therapeutic agent for polycystic kidney diseases, comprising measuring the expression level of Metrnl. By using the polycystic kidney disease marker Metrnl provided in the present invention, it is possible to diagnose polycystic kidney diseases from a sample obtained by a non-invasive method such as urine from a patient and predict the prognosis.

Description

Composition for diagnosing polycystic kidney disease comprising agent for detecting Metrnl and use thereof

The present invention provides a composition for diagnosing and/or predicting polycystic kidney (PKD), comprising an agent capable of detecting the expression of METRNL protein and/or a gene encoding the same, and diagnosis and/or polycystic kidney comprising the composition It relates to a method for screening a composition for preventing or treating polycystic kidney using a kit for predicting prognosis and an agent for detecting the expression of METRNL protein and/or a gene encoding the same.

Polycystic kidney disease or polycystic kidney disease is a genetic disease in which the kidney is deformed into a honeycomb shape due to multiple fluid-filled cysts, and is classified into autosomal dominant polycystic kidney (ADPKD) and autosomal recessive polycystic kidney (ARPKD).

Autosomal dominant polycystic kidney (ADPKD, hereinafter referred to as "polycystic kidney") is the most common hereditary kidney disease in the kidney, with an incidence of 1 in 1,000 people. In patients with polycystic kidney, multiple cysts develop in both kidneys, and the size and number of cysts increase, eventually leading to death due to renal function cessation in the 50s and 60s. The cyst progresses as the cyst epithelial cells proliferate and the cyst fluid fills the cyst, causing the cyst to increase in size.

Polycystic kidney accounts for about 2% of domestic dialysis patients, and is the second most common cause after diabetes, hypertension, and glomerulonephritis. Polycystic kidneys not only cause structural and functional defects in both kidneys, but also can accompany various renal complications, so management is required from the relatively early stage of the disease.

The causative genes of polycystic kidney are PKD1 and PKD2 genes, which encode proteins called polycystin-1 and polycystin-2, respectively. It is known that 85% of patients diagnosed with polycystic kidney are due to a defect in the PKD1 gene and the remaining 15% to a defect in the PKD2 gene.

Currently, there is no known cure method for polycystic kidney, and recent research is being conducted in the direction of reducing disease morbidity and death due to complications. To this end, development of a technology that can diagnose polycystic kidney in an early stage in a non-invasive way this is required

It is an object of the present invention to provide a composition for diagnosing and/or predicting prognosis of polycystic kidney comprising an agent for detecting a meteorin-like (METRNL).

Another object of the present invention is to provide a kit for diagnosis and/or prognosis prediction of polycystic kidney, or a method for providing information necessary for diagnosis and/or prognosis prediction, comprising the diagnostic composition.

Another object of the present invention is to provide a screening method for the prevention or treatment of polycystic kidney, comprising the step of measuring the amount of METRNL.

In order to achieve the object of the present invention, the present inventors confirmed that the transcription amount of the gene encoding METRNL and/or the expression level of the METRNL protein increases in cystic epithelial cells and culture medium of polycystic kidney patients. The present invention was completed by confirming the function as a marker.

The present invention provides a composition for diagnosing and/or predicting polycystic kidney, comprising an agent for detecting a meteorin-like (METRNL), a kit for diagnosis and/or prognosis of polycystic kidney comprising the composition, and METRNL It provides a method for providing information necessary for diagnosing polycystic kidney and/or prognosis, comprising measuring the amount of transcription of a gene and/or the expression level of METRNL protein.

The present invention also provides a method for screening a composition for alleviation or treatment of polycystic kidney, comprising the step of treating the cell with a candidate substance and examining the transcription amount of the METRNL gene and/or the expression level of the METRNL protein.

Hereinafter, the present invention will be described in more detail.

In the present invention, the term "diagnosing" means identifying the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to determine whether the polycystic kidney mutant gene is present or has the onset.

In the present invention, the "polycystic kidney" refers to polycystic kidney disease or polycystic kidney disease, for example, it may be autosomal dominant polycystic kidney disease or autosomal recessive polycystic kidney disease, and in one example, autosomal dominant polycystic kidney disease. may be a disease. The autosomal dominant polycystic kidney disease may be used interchangeably with "autosomal dominant polycystic kidney", and may include a defect in PKD1 and/or PKD2 genes.

In the present invention, "METRNL gene" refers to a gene encoding METRNL protein, and "METRNL expression" includes both transcription and/or expression of a gene encoding METRNL protein, and expression of METRNL protein.

The composition for diagnosing polycystic kidney provided by the present invention includes an agent for detecting mRNA and/or METRNL protein of a gene encoding METRNL protein.

The agent for detecting the mRNA can be freely selected and used by a person skilled in the art within the range for measuring the expression level of mRNA, for example, it may be an oligonucleotide, primer, or probe that specifically binds to the METRNL gene. The primer may be a pair of primers consisting of the nucleic acid sequences of SEQ ID NOs: 1 and 2.

The agent for detecting the METRNL protein can be selected and used without limitation as long as it is an agent capable of measuring the expression or activity level of the protein, for example, an antibody, peptide, aptamer or nucleotide that specifically binds to the METRNL protein. can be The agent for measuring the expression of the protein refers to all kinds of antibodies within the target range for specifically binding to the protein, for example, polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof. All include, but not limited to.

The detection agent can be used without limitation in the range of purposes for detecting the mRNA and/or the METRNL protein of a gene encoding the METRNL protein from a biological sample, and the biological sample is a patient's tissue, blood, cell, plasma, serum, It may be one or more selected from the group consisting of urine, cyst fluid, and saliva, but is not limited thereto. In one example, the biological sample may be a sample isolated from a patient by a non-invasive method.

In one embodiment of the present invention, after extracting total RNA from renal epithelial cells isolated from polycystic kidney patients, cDNA is prepared through RT-PCR, and PCR is performed again using the cDNA as a template to perform METRNL in the healthy and patient groups mRNA expression levels of genes were compared. As a result of comparing the band intensity by electrophoresis of each sample after PCR, the mRNA expression level of METRNL in the epithelial cells of the renal cyst of the autosomal dominant polycystic kidney patients was statistically significantly higher than that of the control group (normal cells). Therefore, the METRNL gene or the METRNL protein encoded by the gene can be utilized as a biomarker for diagnosing polycystic kidney, for example, autosomal dominant polycystic kidney.

In one embodiment of the present invention, the expression pattern of METRNL protein in renal epithelial cells isolated from polycystic kidney patients was confirmed by Western blot. As a result, the METRNL protein band appeared remarkably clear compared to the control (health group) cells in which the band appeared very faint, confirming that the expression level of the METRNL protein was increased in the patient group like mRNA ( FIG. 1b ). Therefore, METRNL protein can be utilized as a biomarker for diagnosing polycystic kidney, for example, autosomal dominant polycystic kidney.

In one embodiment of the present invention, the amount of METRNL protein in the renal epidermal cell culture isolated from a polycystic kidney patient was measured by ELISA. As a result, the amount of METRNL protein in the culture medium was significantly increased in all of the patient samples compared to the culture medium of the control (non-patient or healthy group) cells. Therefore, it was confirmed that the amount of extracellularly secreted METRNL was also significantly higher in patients with polycystic kidney, and through this, it can be seen that polycystic kidney, for example, autosomal dominant polycystic kidney, can be diagnosed by detecting METRNL using a non-invasive method.

In one embodiment of the present invention, the METRNL content in the urine of the non-progressor group known to have a good prognosis among polycystic kidney patients and the progressor group known to have a poor prognosis among polycystic kidney patients was measured. As a result, the METRNL content in the group known to have a good prognosis (Non-progressor) was lower than the METRNL content in the group known to have a poor prognosis (Progressor). It was confirmed that the prognosis of the dominant polycystic kidney can be reliably predicted (FIG. 2b). Therefore, the composition for diagnosis and/or prognosis of polycystic kidney provided by the present invention can detect METRNL protein from a urine sample, and thus can be utilized for non-invasive diagnosis and/or prediction of polycystic kidney.

Another embodiment of the present invention relates to a kit for diagnosing polycystic kidney, comprising an agent for detecting mRNA and/or METRNL protein transcribed from a gene encoding METRNL protein.

The diagnostic kit is an agent for detecting the gene encoding the METRNL protein and/or the METRNL protein, and includes, for example, one or more agents selected from the group consisting of primers, probes, antisense oligonucleotides, aptamers, and antibodies. In addition, one or more other component compositions, solutions, and/or devices suitable for analytical methods may be included.

As a specific example, the kit for measuring the mRNA expression level of the gene encoding the METRNL protein in the present invention may be a kit including essential components necessary for performing real-time polymerase chain reaction (RT-PCR). The RT-PCR kit contains, in addition to each primer pair specific for the mRNA of the gene encoding the METRNL protein, a test tube or other suitable container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs) ), Taq-polymerase, and enzymes such as reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like. It may also include a pair of primers specific for a gene used as a quantitative control. Also, in one example, the kit of the present invention may be a diagnostic kit including essential components necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, reagents, agents, enzymes, and the like for preparing a fluorescently-labeled probe. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

As another specific example, the kit for measuring the expression level of the METRNL protein in the present invention includes a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, a chromogenic substrate, etc. for immunological detection of the antibody. may include In the above substrate, a nitrocellulose membrane, a 96-well plate synthesized from a polyvinyl resin, a 96-well plate synthesized from a polystyrene resin, and/or a glass slice glass may be used, and the chromogenic enzyme is peroxidase , Alkaline Phosphatase may be used, FITC, RITC, etc. may be used as a fluorescent material, and ABTS (2,2'-azino-bis(4-ethylbenzothiazoline-6-sulfonyl) as a chromogenic substrate. phonic acid)) or OPD (o-phenylenediamine), TMB (tetramethyl benzidine) may be used.

Each material exemplified in the composition of the kit is for illustration only, and a person skilled in the art may appropriately change the composition as needed.

Another embodiment of the present invention is a method for providing information necessary for diagnosing polycystic kidney and/or predicting the prognosis of polycystic kidney, comprising measuring the expression level of a gene encoding METRNL protein and/or METRNL protein from a sample it's about

The sample may be one or more selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient and/or control group.

The method includes measuring the expression level of the mRNA and/or METRNL protein of the METRNL gene from a sample isolated from the patient, and measuring the expression level of the mRNA and/or METRNL protein of the METRNL gene in the control sample. / or comparing the expression level of the METRNL protein.

The control group refers to a population that is not a healthy group and/or a polycystic kidney patient.

The method for measuring the mRNA expression level of the METRNL gene is, for example, reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction, real time reverse transcriptase polymerase chain reaction (Real time RT-PCR) , an RNase protection assay, Northern blotting, and one or more methods selected from the group consisting of a DNA chip may be used.

In the reverse transcriptase polymerase chain reaction, it is possible to check the mRNA expression and expression level of the METRNL gene by checking the band pattern and the thickness of the band by electrophoresis after the reaction, and by comparing it with the control group, the onset or progression of polycystic kidney is diagnosed can do. Specifically, when the mRNA expression level of the METRNL gene appears lower than that of the control group, polycystic kidney disease can be diagnosed.

Methods for measuring the expression level of the METRNL protein include Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Oukteroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, One or more methods selected from the group consisting of FACS, and protein chips may be performed, but are not limited thereto.

In one embodiment, the protein expression level is measured using an ELISA method. ELISA is a direct ELISA using a labeled antibody recognizing an antigen attached to a solid support, an indirect ELISA using a labeled antibody recognizing a capture antibody in a complex of an antibody recognizing an antigen attached to a solid support, and an indirect ELISA using a labeled antibody recognizing an antigen attached to a solid support. Direct sandwich ELISA using another labeled antibody that recognizes the antigen in a complex of the antibody and the antigen, reacts with another antibody that recognizes the antigen in the complex of the antibody attached to a solid support and the antigen, followed by a labeled antibody that recognizes the antibody It includes various ELISA methods, such as an indirect sandwich ELISA using a secondary antibody. More preferably, after attaching an antibody to a solid support and reacting the sample, a labeled antibody recognizing the antigen of the antigen-antibody complex is attached to enzymatically develop color or for an antibody recognizing the antigen of the antigen-antibody complex Detection is performed by a sandwich ELISA method in which a labeled secondary antibody is attached and enzymatically developed. By confirming the degree of complex formation between the polycystic kidney marker METRNL protein and the antibody, it is possible to determine whether polycystic kidney disease occurs and/or the prognosis of progression.

In one example, the protein expression level is measured using a protein chip in which one or more antibodies against METRNL protein are arranged at a predetermined position on a substrate and immobilized at a high density. In the method of analyzing a sample using a protein chip, a protein is separated from a sample, the separated protein is hybridized with a protein chip to form an antigen-antibody complex, and the presence or expression level of the protein is checked by reading it, It is possible to determine whether polycystic kidney is onset and/or the prognosis of progression.

In the method for providing information on diagnosis of polycystic kidney provided by the present invention, the expression level of METRNL gene mRNA and/or METRNL protein expression level in the patient sample is measured by the expression level of METRNL gene mRNA and/or METRNL protein expression level of a healthy control group. After the step of comparing with, when the expression level of the METRNL gene mRNA and/or the METRNL protein in the patient sample is higher than that of the normal group, the method may further include determining a polycystic kidney patient.

In one example, the amount of mRNA of the gene encoding the METRNL protein is 2 to 100 times, 3 to 100 times, 5 to 100 times, 7 to 100 times, 10 to 100 times, 2 to 50 times, 2 to 50 times compared to the normal group. Autosomal dominant polycystic kidney when fold, 5 to 50 fold, 7 to 50 fold, 10 to 50 fold, 2 to 25 fold, 3 to 25 fold, 5 to 25 fold, 7 to 25 fold, or 10 to 25 fold can be decided with

In one example, the content of the METRNL protein in the sample is 2 to 100 times, 2 to 50 times, 2 to 30 times, 5 to 100 times, 5 to 50 times, 5 to 30 times, 10 to 100 times, compared to the normal group, 10 to 50 times, 10 to 30 times, 10 to 25 times, 15 to 100 times, 15 to 50 times, 15 to 30 times, or 15 to 25 times, it can be determined as an autosomal dominant polycystic kidney patient.

Through the detection method, it is possible to diagnose the onset of polycystic kidney, cyst formation and prognosis in polycystic kidney patients. That is, by comparing the expression level of the gene encoding the METRNL protein and/or the METRNL protein in the patient with the expression level of the gene encoding the METRNL protein and/or the METRNL protein in the healthy control group, the expression level of the METRNL gene and/or the METRNL protein in the patient is higher than in the healthy control group, polycystic kidney disease can be diagnosed as onset or progression.

In one embodiment of the present invention, as a result of measuring the mRNA amount of the METRNL gene in the cystic epithelial cells of a polycystic kidney patient using RT-PCR, a faint band appeared in the healthy control cells, whereas a clear band appeared in the patient group cells. .

The method of providing information necessary for predicting the prognosis of polycystic kidney provided by the present invention includes measuring the expression level of a gene encoding METRNL protein and/or METRNL protein in a sample isolated from a patient.

In the method of providing information necessary for predicting the prognosis of polycystic kidney provided by the present invention, the method for providing information necessary for the diagnosis of polycystic kidney is performed, or a patient determined to be polycystic kidney using a polycystic kidney diagnosis method other than the above method. may be performed for

In one example, the concentration of the METRNL protein in the sample is 0.25 to 10pg/mg creatinine, 0.25 to 5pg/mg creatinine, 0.25 to 2pg/mg creatinine, 0.5 to 10pg/mg creatinine, 0.5 to 5pg/mg creatinine, or 0.5 to In the case of 2pg/mg creatinine, it can be predicted that the prognosis of polycystic kidney is poor.

In the present specification, the prognosis of polycystic kidney is that the prognosis is poor when an increase in the number and/or size of cysts and/or a decrease in renal function is predicted over time in consideration of the number, size, and/or renal function of the cyst. can be judged.

Another example of the present invention relates to a screening method for a polycystic kidney treatment, comprising the steps of treating a candidate substance for a polycystic kidney treatment and detecting a change in the expression level of the METRNL gene and/or the METRNL protein.

In the present invention, the treatment for polycystic kidney includes a substance that alleviates or stops the progression of polycystic kidney. The progression of multiple stature means that the stage progresses in the direction of worsening the prognosis of polycystic kidney.

Specifically, it is a method of comparing the increase or decrease in the expression of METRNL gene and/or METRNL protein in the presence and absence of a polycystic kidney treatment candidate, which can be usefully used for screening polycystic kidney treatment agents. Substances that directly or indirectly decrease the mRNA or METRNL protein concentration of the METRNL gene may be selected as a therapeutic agent for polycystic kidney. That is, after measuring the expression level of the marker METRNL gene and/or METRNL protein of the present invention in the presence of a polycystic kidney drug candidate, and comparing both, the METRNL gene and/or METRNL protein in the presence of a polycystic kidney drug candidate substance A substance whose expression level reduces the expression level of the METRNL gene and/or METRNL protein in the absence of a polycystic kidney candidate may be determined as a therapeutic agent for polycystic kidney.

The diagnostic composition comprising an agent for measuring the transcription level of the METRNL gene and/or the expression level of the METRNL protein provided by the present invention can be usefully used for the early diagnosis of polycystic kidney and management of the associated disease at low cost. In particular, it can be applied as a target for the development of therapeutic agents that can inhibit the growth of renal cyst size in patients in the future.

The prognosis of proliferation of cysts in patients with polycystic kidney can be predicted by using a composition comprising an agent for measuring the transcription amount of the METRNL gene and/or the expression level of the METRNL protein provided by the present invention, and by following this, the cyst of the patient in the future It can be used as a biomarker that can predict the degree of disease progression according to proliferation, and through this, it is possible to provide personalized treatment for each patient.

1a is a result of confirming the expression level of METRNL gene in cyst epithelial cells (Cyst#1 and Cyst#2) and control cells (RPTEC) of polycystic kidney patients using real-time polymerase chain reaction.
Figure 1b is a photograph of the result of confirming the expression level of METRNL protein in cystic epithelial cells and control cells of polycystic kidney patients using Western blot.
2A is a graph illustrating quantitative analysis of the expression level of METRNL protein in cyst epithelial cells and control cells of a polycystic kidney patient using ELISA.
Figure 2b is a graph showing the results of measuring the amount of METRNL in urine of a group with a mutation known to have a bad prognosis (Progressor) and a group with a mutation known to have a good prognosis (Non-progressor) among polycystic kidney patients using ELISA.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only for illustrating the present invention, and do not limit the scope of the present invention.

Example 1. Preparation of samples

Kidney tissue samples from patients with polycystic kidney were supplied by Seoul National University Hospital. Cell culture was performed by extracting a part of the cyst from the kidney extracted from a patient with autosomal dominant polycystic kidney. Cell culture was performed in DMEM/10% (v/v) FBS medium at 37°C and 5% CO2 conditions. As a control sample, normal renal epidermal cells called RPTEC/TERT1 (CRL-4031) purchased from ATCC were used.

Example 2. Confirmation of Metrnl expression level in cyst epithelial cells of polycystic kidney patients

2-1. RNA sample preparation

Total intracellular RNA was extracted from the cells cultured in Example 1 using Qiagen's RNeasy Plus Mini Kit. Specifically, 1X10^7 cells were first obtained and cell lysis was performed using RLT lysis buffer. Lysate was transferred to the gDNA Eliminator spin column, centrifuged at 10,000 rpm for 30 seconds, the same amount of 70% EtOH was added to the flow-through, mixed, and then transferred to an RNeasy spin column and centrifuged at 10,000 rpm for 15 seconds. After putting 700ul of RW1 buffer into the column, centrifugation at 10,000rpm for 15 seconds, adding 500ul of RPE buffer to the column, centrifugation at 10,000rpm for 15 seconds, air dry 50ul RNase-free water into the column, and then 10,000 Total RNA was extracted by centrifugation at rpm for 15 seconds.

2-2. RT-PCR

Using the extracted total RNA as a template, cDNA was prepared through reverse transcription polymerase chain reaction (RT-PCR) using TAKARA's PrimeScript RT-PCR Kit. Reaction Mixture, Reagent Mixture, and Thermal condition information are as follows.

(1) reaction mixture;

Template (RNA) 2ug

Oligo dT primer (2.5uM) 1ul

dNTP (10mM each) 1ul

RNase Free dHO up to 10ul

Denaturation at 65℃ for 5 min

(2) Reagent mixture;

reaction mixture 10ul

5X PrimeScript Buffer 4ul

RNase Inhibitor (40U/ul) 0.5ul

PriemScript RTase 0.5ul

RNase Free dH ₂ O 5ul

(3) Thermal condition;

30℃ 10 min

42℃ 30 min

95℃ 5min

4℃ storage

2-3. Comparison of Metrnl expression levels between healthy and patient groups

Using the cDNA sample prepared in Example 2-2 as a template, the expression level of the gene encoding Metrnl was measured by reverse transcription polymerase chain reaction (RT-PCR) using the primer sets of SEQ ID NOs: 1 and 2 shown in Table 2 below. was amplified to compare Metrnl expression levels in the healthy and patient groups. As a control, the GAPDH gene was used. The primer sets used for the amplification of the GAPDH gene and the amplification of Metrnl cDNA are shown in Table 1 below.

Sequence number primer sequence (5'>3') One Metrnl_forward CAAGTTACCCACGAGCCTGAG 2 Metrnl_reverse CGGCCCACGGAGTCAGTC 3 GAPDH_forward TTGCCATCAATGACCCCTTCA 4 GAPDH_reverse CGCCCCACTTGATTTTGGA

After PCR, each sample was electrophoresed on an agarose gel to compare mRNA expression levels through the band intensity of each PCR product. Figure 1a shows a photograph of the result of examining the mRNA expression level of Metrnl gene in renal cyst epithelial cells of autosomal dominant polycystic kidney patients. The band intensity of the control GAPDH did not show a significant change between the control cells (control, RPTEC) and the autosomal dominant polycystic kidney patient cells, but in the case of Metrnl, a band weaker than the intensity of the band in the control cells appeared. On the other hand, in the autosomal dominant polycystic kidney patient group, the band appeared with a strength similar to that in the control cell, confirming that the mRNA expression level of Metrnl was increased in common in the patient group.

Fig. 1a shows a band photograph and a graph of real-time polymerase chain reaction (RT-PCR) results of electrophoresis results of autosomal dominant polycystic kidney patients. When the fold change in the control group, RPTEC, was set to 1, the fold change of 2 patients was measured to be 15.25 and 20.07, respectively, and it was quantitatively confirmed that the expression level of Metrnl was significantly higher in the polycystic kidney patients than in the healthy group.

In addition, the expression level of Metrnl was confirmed in the control cells and the epithelial cells of the renal cyst of the polycystic kidney patient using Western blot. As a control to check the protein expression level, b-actin protein was selected. For METRNL, Abcam's anti-METRNL (ab235775) antibody, and for b-actin, Sigma's monoclonal anti-b-actin (A5316) antibody was 1 each. : It was used at a dilution concentration of 1000.

Western blot results are shown in FIG. 1B. As in RT-PCR, Western blot confirmed that Metrnl protein in cyst epithelial cells (indicated as Cyst #1 and Cyst #2) was increased compared to control cells.

Example 3. Confirmation of Metrnl Amount in Cyst Epidermal Cell Culture of Polycystic Kidney Patients

In order to examine whether the accumulation of Metrnl in the cystic epithelial cells of a polycystic kidney patient in the cell culture medium was increased compared to that of the non-patient group, the renal cyst epithelial cells and control cells (RPTEC) cultured in substantially the same manner as in Example 1. An enzyme-linked immunosorbent assay (ELISA) was performed.

Specifically, cyst epithelial cells (Cyst #1 and #2) and control cells (RPTEC) isolated from the patient in substantially the same manner as in Example 1 were cultured, respectively, and Human Meteorin-like/METRNL (DY7867 of R&D System) -05) The amount of Metrnl was measured using an ELISA kit.

Figure 2a shows a graph of the results of measuring the amount of Metrnl in the culture medium (cyst#1 and Cyst#2) of autosomal dominant polycystic kidney patients by ELISA. As a result of ELISA, it was confirmed that the amount of Metrnl protein in the cell culture medium was increased in a statistically significant manner in both samples of the two patients. Specifically, the control group showed Metrnl protein concentrations of 1.99 pg/mL, and the patients had Metrnl protein concentrations of 84.94 pg/mL and 95.00 pg/mL, respectively.

Therefore, it was confirmed that the expression level of Metrnl was increased in renal cyst epithelial cells of autosomal dominant polycystic kidney patients. In particular, it was confirmed that Metrnl secretion was high only in renal cyst epithelial cells isolated from the patient (Cyst#1 and Cyst#2). did.

Example 4. Determination of Amount of Metrnl in Urine Sample

In order to confirm the diagnostic and prognostic predictability of autosomal dominant polycystic kidney using Metrnl using a non-invasive method, urine from non-progressor and Progressor patients classified according to the type of autosomal mutation in the patient group was used and ELISA was used. My OPN protein amount was measured.

Specifically, the non-progressor group was classified into a group corresponding to Class 1A-1B according to the Mayo Clinic classification in the United States, that is, a group with a small kidney volume according to age and a PKD2 gene mutation and a PKD1 missense mutation. 11 patients was targeted. The Progressor group included 11 patients who were identified as having a nonsense mutation in the PKD1 gene with a large kidney volume according to age, that is, a group corresponding to Class 1C-1E according to the Mayo Clinic classification in the United States.

ELISA was performed in substantially the same manner as in Example 3, and the result is shown in the graph in FIG. 2B. As a result of ELISA, the Metrnl concentration in the non-progressor group with a relatively good prognosis was higher in the Progressor group even between the Non-progressor group, a patient group with a mutation known to have a relatively good prognosis, and the Progressor group, a patient group with a mutation known to have a relatively poor prognosis. Appears at a low concentration compared to that, it was confirmed that Metrnl protein, a gene encoding it, and mRNA transcribed from the gene can all be utilized as biomarkers that can predict the prognosis of autosomal dominant polycystic kidney.

<110> Seoul National University R&DB Foundation <120> Composition for diagnosing polycystic kidney disease comprising agent for detecting Metrnl and use thereof <130> DPP20201841KR <150> KR 10-2019-0151709 <151> 2019-11-22 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Metrnl_forward <400> 1 caagttaccc acgagcctga g 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Metrnl_reverse <400> 2 cggccccacgg agtcagtc 18 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_forward <400> 3 ttgccatcaa tgaccccttc a 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 4 cgccccactt gattttgga 19

Claims (10)

A composition for diagnosis of polycystic kidney, comprising at least one agent selected from the group consisting of an agent for detecting a meteorin-like (Metrnl) protein, and an agent for detecting the mRNA of a gene encoding a meteorin-like protein. A kit for diagnosis of polycystic kidney, comprising the composition according to claim 1. A composition for predicting the prognosis of polycystic kidney, comprising at least one agent selected from the group consisting of an agent for detecting a meteorin-like (Metrnl) protein, and an agent for detecting mRNA of a gene encoding a meteorin-like protein. A kit for predicting the prognosis of polycystic kidney, comprising the composition according to claim 3 . A method for providing information necessary for diagnosing polycystic kidney, comprising measuring the expression level of one or more selected from the group consisting of a gene encoding Metrnl protein and METRNL protein from a sample isolated from a patient The method of claim 5, wherein the sample is at least one selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient. The method of claim 5, further comprising: measuring the expression level of one or more selected from the group consisting of a gene encoding Metrnl protein and Metrnl protein from a sample isolated from a control group other than a polycystic kidney patient;
comparing the expression levels of the patient and the control group; and
When the expression level in the patient sample is higher than that of the control, determining the patient as a polycystic kidney patient. A method for providing information necessary for predicting the prognosis of polycystic kidney, comprising measuring the expression level of one or more selected from the group consisting of a gene encoding Metrnl protein and Metrnl protein from a sample isolated from a patient. The method of claim 8, wherein the sample is at least one selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient. The method according to claim 8, comprising determining that the prognosis of polycystic kidney is poor when the concentration of Metrnl protein is 0.25 to 10 pg/mg creatinine.

Images