KR102288447B1 - Composition for diagnosing polycystic kidney disease comprising agent for detecting CTGF and use thereof - Google Patents

Abstract

CTGF is expressed in the tissues of polycystic kidney patients compared to the healthy group, and as the glomerular filtration rate decreases, the detection concentration in the patient's urine increases, so it can be used as a diagnostic marker for polycystic kidney. The present invention also provides a kit for diagnosing polycystic kidney comprising an agent for detecting CTGF, a method for providing information on diagnosing polycystic kidney comprising the step of detecting CTGF in urine, and measuring a change in CTGF concentration in the sample A screening method for a therapeutic agent for polycystic kidney is provided.

Description

Composition for diagnosing polycystic kidney disease comprising agent for detecting CTGF and use thereof

The present invention provides a composition for diagnosis of polycystic kidney (PKD) comprising an agent capable of detecting CTGF protein, a kit for diagnosis of polycystic kidney comprising the composition, and a composition for preventing or treating polycystic kidney using an agent for detecting CTGF. it's about how

Polycystic kidney disease or polycystic kidney disease is a genetic disease in which the kidney is deformed into a honeycomb shape due to multiple fluid-filled cysts.

Autosomal dominant polycystic kidney (ADPKD, hereinafter referred to as "polycystic kidney") is the most common hereditary kidney disease in the kidney, with an incidence of 1 in 1,000 people. In patients with polycystic kidney, multiple cysts develop in both kidneys, and the size and number of cysts increase, eventually leading to death due to renal function cessation in the 50s and 60s. The cyst progresses as the cyst epithelial cells proliferate and the cyst fluid fills the cyst, causing the cyst to increase in size.

Polycystic kidney accounts for about 2% of domestic dialysis patients, and is the second most common cause after diabetes, hypertension, and glomerulonephritis. Polycystic kidneys not only cause structural and functional defects in both kidneys, but also can accompany various renal complications, so management is required from the relatively early stage of the disease.

The causative genes of polycystic kidney are PKD1 and PKD2 genes, which encode proteins called polycystin-1 and polycystin-2, respectively. It is known that 85% of patients diagnosed with polycystic kidney are due to a defect in the PKD1 gene and the remaining 15% to a defect in the PKD2 gene.

Currently, there is no known cure method for polycystic kidney, and recent research is being conducted in the direction of reducing disease morbidity and death due to complications. this is required

It is an object of the present invention to provide a composition for diagnosis of polycystic kidney comprising an agent for detecting connective tissue growth factor (CTGF) protein and/or mRNA transcribed from a gene encoding the same.

Another object of the present invention is to provide a diagnostic kit for polycystic kidneys comprising the composition for diagnosis or a method for providing information necessary for diagnosis.

Another object of the present invention is to provide a screening method for the prevention or treatment of polycystic kidney, comprising the step of measuring the amount of CTGF.

In order to achieve the above object of the present invention, the present inventors completed the present invention by identifying the involvement of CTGF in renal fibrosis of polycystic kidney patients. By measuring the expression level of the CTGF biomarker provided by the present invention, it is possible to provide information on the progress of renal fibrosis, renal dysfunction, and polycystic kidney disease.

The present invention relates to a polycystic kidney diagnostic composition comprising an agent for measuring the expression level of CTGF, a polycystic kidney diagnostic kit comprising the composition, and a method for diagnosing polycystic kidney or renal dysfunction comprising the step of measuring the expression level of CTGF It provides a way to provide the necessary information.

The present invention also provides a method for screening a composition for reducing or treating polycystic kidney or a composition for restoring function of the kidney, comprising the step of examining the expression level of CTGF by treating the cells with a candidate substance.

Hereinafter, the present invention will be described in more detail.

The polycystic kidney prognosis and/or diagnosis composition provided by the present invention includes a CTGF protein and/or an agent for detecting the expression of a gene encoding the CTGF protein.

In the present invention, the term "diagnosing" means identifying the presence or characteristics of a pathological condition. For the purposes of the present invention, diagnosis is to determine the presence, the onset of, and/or the prognosis of, the polycystic kidney gene.

In the present specification, when the prognosis of polycystic kidney is expressed as poor or poor, it indicates that the polycystic kidney patient has a lot of renal fibrosis or that the glomerular filtration rate (eGFR) is lower than the standard value classified as exhibiting normal renal function in the art. This includes all cases in which the rate of disease progression is maintained or increased or the tissue function is not expected to be normalized over time based on the measurement time point.

In the present invention, the "polycystic kidney" means polycystic kidney disease or polycystic kidney disease, for example, may be autosomal dominant polycystic kidney disease or autosomal recessive polycystic kidney disease, preferably autosomal dominant polycystic kidney disease. can be

In the present invention, "expression amount" refers to both the mRNA transcription amount of a gene and/or the translation amount and/or the secretion amount of the protein encoded by the gene, and may be interpreted as one of the above contents if necessary.

The CTGF gene of the present invention is known to be located in the human chromosome 6 gene, and the CTGF protein is also referred to as connective tissue growth factor or CCN2, cell adhesion, migration, proliferation, angiogenesis, skeletal development, It is known to be involved in wound tissue regeneration and cancer pathogenesis.

The agent for detecting the mRNA can be freely selected and used by those skilled in the art as long as the mRNA expression level can be measured, for example, it may be an oligonucleotide, primer or probe that specifically binds to the CTGF gene.

The agent for detecting the CTGF protein can be selected and used without limitation as long as it is an agent capable of measuring the expression or activity level of the protein, for example, an antibody, peptide, aptamer or nucleotide that specifically binds to the CTGF protein. can be The agent for measuring the expression of the protein refers to an antibody that specifically binds to the protein, and includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof.

In one embodiment of the present invention, as a result of staining tissues isolated from polycystic kidney patients by immunohistochemical staining, it was confirmed that the expression of CTGF, phosphorylated Smad2 and Smad3 was increased compared to the healthy group. In addition, renal cyst epithelial cells from the polycystic kidney patient group and the healthy group were extracted and cell lined, and then Western blot was performed. As a result, the expression levels of unphosphorylated smad2 and smad3 were not different between the healthy group and the patient group, but phosphorylated smad2 , increased expression of smad3 and CTGF. Therefore, CTGF protein can be utilized as a biomarker for diagnosing polycystic kidney, preferably autosomal dominant polycystic kidney.

In one example, the composition provided by the present invention can be used to provide information necessary for prognosis or diagnosis of polycystic kidney by measuring the expression level of CTGF protein and/or gene in a sample isolated from a patient, for example, urine I can measure my CTGF concentration.

In one example, when CTGF is detected in a sample isolated from a patient, it may be classified as a polycystic kidney patient. In another example, when the CTGF concentration in the urine of a patient confirmed as polycystic kidney is 0.1 ng/ml or less, CTGF undetectable, when the CTGF concentration is 0.1 to 1.0 ng/ml, low CTGF protein expression Group (low), when it exceeds 1.0 ng/ml, it can be classified as a high CTGF protein expression group, and the higher the CTGF expression level and/or the lower the kidney function, the worse the prognosis of polycystic kidney. can be classified as

In another embodiment of the present invention, the amount of CTGF protein present in a sample isolated from polycystic kidney patients with different progression rates, for example, urine was measured by ELISA. As the amount of CTGF is detected in the urine of polycystic kidney patients, the glomerular permeability (eGFR) tends to decrease, suggesting that CTGF protein can be used as a biomarker for detecting deterioration of renal function. In one embodiment, the higher the CTGF protein concentration in the urine of the patient, the lower the renal function may be determined. Therefore, it can be used to predict the prognosis of polycystic kidney by detecting the CTGF protein in the sample and examining its content.

The composition for prognosis prediction and/or diagnosis of polycystic kidney provided by the present invention is an agent for detecting one or more selected from the group consisting of TGF-b2 protein or a gene encoding the protein, phosphorylated Smad2 protein, and phosphorylated Smad3 protein may further include.

In one example, the secretion of TGF-b2 is increased in patients with autosomal dominant polycystic kidney, which causes phosphorylation of the C-terminal region of Smad2/3. Meanwhile, phosphorylated ERK phosphorylates the linker region of Smad2/3 to stabilize phosphorylated Smad2/3. The stabilized P-smad2/3 migrates to the nucleus and promotes CTGF expression, resulting in renal fibrosis ( FIG. 7 ).

Therefore, if the expression of one or more proteins selected from the group consisting of phosphorylated Smad2, phosphorylated Smad3 and TGF-b2 proteins in a sample isolated from a patient increases, the patient may be classified as a polycystic kidney patient.

Another embodiment of the present invention relates to a kit for diagnosing polycystic kidneys comprising an agent for detecting a CTGF gene and/or protein.

The diagnostic kit includes a detection agent such as a primer, a probe, an antisense oligonucleotide, an aptamer, and an antibody for detecting the CTGF gene and/or protein, as well as at least one other component composition suitable for an analysis method, a solution , or devices may be included.

As a specific example, the kit for measuring the mRNA expression level of the CTGF gene in the present invention may be a kit including essential elements necessary for performing RT-PCR. The RT-PCR kit contains, in addition to each primer pair specific for the mRNA of the ELK3 gene, a test tube or other appropriate container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs), Taq-polymer enzymes such as lyase (Taq-polymerase) and reverse transcriptase, DNase, RNase inhibitors, DEPC-water, sterile water, and the like. It may also include a pair of primers specific for a gene used as a quantitative control. Also preferably, the kit of the present invention may be a diagnostic kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, reagents, agents, enzymes, and the like for preparing a fluorescently-labeled probe. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

As another specific example, the kit for measuring the expression level of CTGF protein in the present invention includes a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, a chromogenic substrate, etc. for immunological detection of the antibody. can do. As the substrate, a nitrocellulose membrane, a 96-well plate synthesized from a polyvinyl resin, a 96-well plate synthesized from a polystyrene resin, and a glass slide glass may be used, and the chromogenic enzyme is peroxidase, alkaline phosphorus Alkaline Phosphatase may be used, FITC, RITC, etc. may be used as a fluorescent material, and ABTS (2,2'-azino-bis(4-ethylbenzothiazoline-6-sulfonic acid) as a color developing substrate solution. ) or OPD (o-phenylenediamine), TMB (tetramethyl benzidine) can be used.

In a specific example, the kit for measuring the expression level of the CTGF protein and/or the expression level of the CTGF gene of the present invention may be configured as a kit for urinalysis. In one embodiment, as the expression level of CTGF in urine increased, the glomerular filtration rate decreased, confirming the onset of polycystic kidney and/or deterioration of renal function.

Another embodiment of the present invention relates to a method of providing information necessary for predicting polycystic kidney prognosis and/or diagnosis, comprising measuring the expression level of a CTGF gene and/or protein in a sample isolated from a patient.

The sample may be, for example, one or more, two or more, three or more, four or more, or five or more selected from the group consisting of tissue, blood, cells, plasma, serum, urine, cyst fluid, and saliva of a patient. It is not limited, and it may preferably be the urine of a patient. There is an advantage of being able to diagnose polycystic kidney and predict the prognosis in a non-invasive way by using a patient's urine as a sample.

The method comprises the steps of measuring the expression level of the mRNA and/or CTGF protein of the CTGF gene from a sample isolated from the patient, and the expression level of the mRNA and/or protein in the health control sample. may include a step of comparing with

In one example, the method of providing information necessary for predicting the prognosis of polycystic kidney measures the expression level of one or more selected from the group consisting of a CTFG protein and a gene encoding the CTGF protein from a sample isolated from a patient diagnosed with polycystic kidney. including the steps of

Methods for measuring the mRNA expression level of the CTGF gene, for example, reverse transcriptase polymerase chain reaction (RT-PCR), competitive reverse transcriptase polymerase chain reaction, real time reverse transcriptase polymerase chain reaction (Real time RT-PCR) , an RNase protection assay, Northern blotting, and one or more methods selected from the group consisting of a DNA chip may be used.

In the reverse transcriptase polymerase chain reaction, it is possible to check whether or not the mRNA expression and the expression level of the CTGF gene is expressed by checking the band pattern and the thickness of the band by electrophoresis after the reaction, and the onset or progression of polycystic kidney is diagnosed by comparing it with the control can do.

Methods for measuring the expression level of the CTGF protein include Western blotting, ELISA, radioimmunoassay, radioimmunodiffusion, Octeroni immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, One or more methods selected from the group consisting of FACS, and protein chips may be performed, but are not limited thereto.

In one embodiment, the protein expression level is measured using an ELISA method. ELISA is a direct ELISA using a labeled antibody recognizing an antigen attached to a solid support, an indirect ELISA using a labeled antibody recognizing a capture antibody in a complex of antibodies recognizing an antigen attached to a solid support, Direct sandwich ELISA using another labeled antibody that recognizes an antigen in a complex of an antibody and antigen, reacts with another antibody that recognizes an antigen in a complex of an antibody attached to a solid support and an antigen It includes various ELISA methods, such as an indirect sandwich ELISA using a secondary antibody. More preferably, after attaching an antibody to a solid support and reacting the sample, a labeled antibody recognizing the antigen of the antigen-antibody complex is attached to enzymatically develop color or for an antibody recognizing the antigen of the antigen-antibody complex Detection is performed by a sandwich ELISA method in which a labeled secondary antibody is attached and enzymatically developed. By confirming the degree of complex formation between the CTGF protein, which is a polycystic kidney marker, and the antibody, it is possible to determine whether polycystic kidney disease develops and/or progresses.

Also, it is preferable to use a protein chip in which one or more antibodies against CTGF protein are arranged at a predetermined position on a substrate and immobilized at a high density. In the method of analyzing a sample using a protein chip, the protein is separated from the sample, the separated protein is hybridized with the protein chip to form an antigen-antibody complex, and the presence or expression level of the protein is checked by reading it, Kidney fibrosis or polycystic kidney disease can be confirmed.

The method for providing information on polycystic kidney diagnosis provided by the present invention compares the expression level of the mRNA and/or protein of the CTGF gene in the patient sample with the expression level of the mRNA and/or protein of the CTGF gene of a healthy control group. When the expression level of the mRNA and/or protein of the CTGF gene in the patient sample is higher than that of the normal group after the step of determining and/or classifying the patient as a polycystic kidney patient, the method may further include.

Through the detection method, it is possible to diagnose and/or predict the onset of polycystic kidney, cyst formation and progression in polycystic kidney patients, and prognosis in polycystic kidney patients. That is, by comparing the expression level of the mRNA and/or protein of the CTGF gene in the patient with the mRNA and/or protein expression level of the CTGF gene in the healthy control group, the mRNA and/or protein expression level of the CTGF gene in the patient is higher than in the healthy control group. If it appears higher, polycystic kidney disease can be diagnosed as onset or advanced.

In one example, in order to predict the prognosis of polycystic kidney patients, the patients may be grouped into a plurality of groups according to the expression level of the CTGF protein and/or the gene encoding the protein detected from the patient's sample, for example, CTGF It may be grouped into an undetected group, a low CTGF expression group, and a CTGF high expression group, but is not limited thereto.

In one embodiment of the present invention, polycystic kidney patients were treated based on the detected amount of CTGF in urine (undetectable, less than 0.1 ng/ml), low CTGF (low, 0.1 to 1.0 ng/ml), and high CTGF ( As a result of analyzing the eGFR for each group after classification into three groups (high, over 1.0ng/ml) (Fig. 3b), similar glomerular permeability (eGFR) was shown for each group, and the median value of eGFR for each group was not detected. , low CTGF, and high CTGF showed 60.5, 48.7, and 35.7 (ml/min/1.73m ² ), respectively, confirming that the glomerular permeability according to the amount of CTGF was correlated with each other. Therefore, it is possible to know the degree of renal function of the patient by the amount of CTGF in the patient's urine, which means that the CTGF protein and/or the gene encoding the protein can be applied as a biomarker that can determine the degree of fibrosis and the degree of renal function in patients with polycystic kidney. imply

Another embodiment of the present invention provides a screening method for a polycystic kidney treatment, comprising treating a candidate substance for a polycystic kidney treatment and detecting (measuring) a change in the expression level of CTGF gene mRNA and/or protein. it's about

In the present invention, the polycystic kidney treatment includes a substance that relieves symptoms of polycystic kidney or stops the progression of the disease.

Specifically, it is a method of comparing the expression increase or decrease of CTGF gene mRNA and/or protein in the presence and absence of a polycystic kidney treatment candidate, which can be usefully used for screening polycystic kidney treatment agents. Substances that directly or indirectly decrease the mRNA or protein concentration of the CTGF gene may be selected and/or classified as a therapeutic agent for polycystic kidney. That is, after measuring the expression level of the mRNA and/or protein of the marker CTGF gene of the present invention in the presence of a candidate polycystic kidney treatment, the mRNA and/or of the CTGF gene in the presence of a polycystic kidney treatment candidate material A substance in which the expression level of the protein decreases than the expression level of the mRNA and/or protein of the CTGF gene in the absence of the candidate polycystic kidney may be predicted as a therapeutic agent for polycystic kidney.

The present inventors provide a target for the development of a therapeutic agent capable of inhibiting renal function decline in patients in the future by identifying an accurate signal transduction system for renal fibrosis of polycystic kidney. Specifically, an increase in the amount of CTGF in a patient's urine means a decrease in the patient's renal function, so follow-up observation can be applied as a biomarker that can predict the patient's renal function in the future. can do.

1A is a micrograph showing the result of confirming fibrosis of kidney tissue of a patient with autosomal dominant polycystic kidney (ADPKD) with masson stain.
Figure 1b shows the kidney tissue of healthy people and polycystic kidney patients by immunohistochemical staining (IHC) using CTGF antibody to stain CTGF, and phosphorylated smad2 and smad3, which are transcription factors of CTGF, using the same method. This is a comparison picture.
Figure 1c is a photograph comparing the protein expression level by Western blot method using each antibody after extracting the protein by decomposing the kidney tissue of a healthy person and a patient with polycystic kidney.
Figure 2a is a photograph comparing the protein expression level by Western blot method using each antibody in renal cyst epithelial cells of autosomal dominant polycystic kidney patients.
Figure 2b is a photograph comparing protein expression levels by Western blot method using each antibody when A83-01, a phosphorylation inhibitor of smad2 and 3, was treated in renal cyst epithelial cells of autosomal dominant polycystic kidney patients.
Figure 3a is a graph showing the correlation between the amount of CTGF and glomerular permeability (eGFR) in the urine of polycystic kidney patients.
Figure 3b is a graph analyzing the glomerular permeability (eGFR) in each group by dividing the amount of CTGF in the urine of polycystic kidney patients into three groups.
Figure 4a is a graph showing the result of ELISA confirming the difference in the expression level of TGF_b by type in renal cyst epithelial cells and normal cells isolated from polycystic kidney patients.
FIG. 4b is an electrophoretic image of RT-PCR results confirming the difference in the expression level of TGF-b by type in renal cyst epithelial cells and normal cells isolated from polycystic kidney patients.
Figure 4c shows the results of confirming the expression levels of p-smad2, smad2, p-smad3, smad3 and CTGF when TGF-b2 was treated in cystic epithelial cells isolated from a polycystic kidney patient using Western blot.
Figure 5a shows Western blot results for P-Smad2, P-Smad3, Lamin A/C and b-actin in the cytoplasm and nucleus according to PD98059 (ERK inhibitor) treatment.
6a is a result confirming that phosphorylation of AKT occurs in IMCD cells into which the recombinant PC1 gene is introduced.
FIG. 6b is an ELISA result showing that the secretion of TGF-b2 is reduced in IMCD cells in which phosphorylation of AKT has occurred, and that this is due to AKT treatment by concentration of an AKT inhibitor.
6c is an electrophoresis picture of the RT-PCR result confirming the mRNA expression level of TGF-b2 when the AKT inhibitor was treated in IMCD cells into which the recombinant PC1 gene was introduced.
7 is a schematic diagram of the mechanism of action of the Smad2/3 signaling pathway related to CTGF in an autosomal dominant polycystic kidney patient.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only for illustrating the present invention, and do not limit the scope of the present invention.

Example 1. Preparation of samples

Kidney tissue samples from patients with polycystic kidney were supplied by Seoul National University Hospital. Kidney tissue samples for tissue staining were fixed by immersion in 4% paraformaldehyde and embedded with paraffin. For the production of a cyst cell line, a part of the cyst was extracted from a kidney extracted from a patient with autosomal dominant polycystic kidney, and cell culture was performed. Cell culture was performed in DMEM/10% FBS medium at 37° C., 5% CO ₂ conditions. As a control sample, normal renal epidermal cells called RPTEC/TERT1 (CRL-4031) purchased from ATCC were used.

Example 2. Masson trichrome tissue staining

부란기에 1시간 동안 매염 시킴, (3) 흐르는 물에 10분간 수세(picric acid 색소 제거), (4) Weigert hema로 10분간 핵염색 후 흐르는 물에 10분간 중화, (5) Biebrich scarlet-acid fuchsin용액으로 10 - 15분간 염색, (6) 수세로 과량의 염색액 제거후 P.T.A.-P.M.A.용액으로 5분간 처리, (7) 수세 후 0.5% acetic acid로 10분간 감작, (8) 수세없이 aniline blue용액으로 5분간 염색, (9) 수세로 염료를 깨끗이 씻고 탈수, 투명, 봉입의 단계를 거쳐 수행되었다. To confirm fibrosis in polycystic kidney patients, masson trichrome tissue staining was performed. Specifically, put the slide in (1) deparaffinized, water-washed 5 minutes, (2) Bouin sol. on the renal paraffin tissue slides of patients and healthy people prepared in Example 1 56

Mording for 1 hour during incubation period, (3) washing with running water for 10 minutes (picric acid dye removal), (4) nuclear staining with Weigert hema for 10 minutes and neutralization in running water for 10 minutes, (5) Biebrich scarlet-acid fuchsin Dyeing with solution for 10 - 15 minutes, (6) removing excess staining solution with water and then treating with PTA-PMA solution for 5 minutes, (7) washing with water and sensitizing with 0.5% acetic acid for 10 minutes, (8) without washing with aniline blue solution Dyeing for 5 minutes, (9) washing the dye thoroughly with water, dehydration, transparency, and encapsulation were performed.

When staining is performed by the Masson Trichrome staining method, blue is stained for fibrous tissue, weak red for cytoplasm, and dark red for nuclei. 1 shows a photograph of the result of masson trichrome staining of cells of polycystic kidney patients and healthy people. As can be seen in the drawings, it was confirmed that the dye was blue when fibrosis occurs around the patient's cyst. That is, it was confirmed that a lot of fibrosis occurred in the renal tissue of the patient.

Example 3. Expression analysis of CTGF, Smad2, Smad3 in polycystic kidney patient tissue

3-1. Immunohistochemistry staining (IHC staining)

Immunohistochemical staining (IHC staining) was performed to compare the expression level of CTGF and the expression levels of phosphorylated Smad2 and Smad3, which are transcription factors of polycystic kidney patients, with those of healthy individuals as a control group. Specifically, for dialysis or kidney transplantation at Seoul National University Hospital, tissues of patients and healthy individuals obtained by surgical excision of the existing polycystic kidney were fixed in 4% paraformaldehyde and embedded with paraffin.

Slides with paraffin sections attached were washed in D.W after deparaffination. The tissue section slides from which the paraffin was removed were placed in a container containing 1X antigen retrieval solution (DARCO cat #:S1699). Put the barrel with the slide in the pressure cooker and put it in the microwave to boil for 5 minutes. After antigen retrieval, the slides were cooled at room temperature and washed twice with PBS. Slides were put in a blocking solution (5% BSA + 0.2% Triton X-100 in PBS) and incubated at room temperature for 1 hour. CTGF (abcam, ab6992), p-smad2 (cell signaling, #3101s), and p-smad3 (abcam, ab52903) of primary antibodies were prepared at a ratio of 1:200, and 200ul was dispensed onto the slide, followed by incubation at 4°C overnight on a shaker. . The next day, after washing twice with PBS, the secondary antibody (vector, PI-1000) was prepared at a ratio of 1:500, and 200ul was dispensed on the slides and incubated at room temperature for 1 hour. After 1 hour, after washing twice with PBS, the color was developed with DAB substrate (vector, sk-4100). Since the color development time differs for each primary antibody, the reaction was stopped after observation under a microscope. After the color development was completed, the slides were mounted through dehydration, observed under a microscope, and then photographed.

In Figure 1b, kidney tissues of healthy people and polycystic kidney patients were stained with CTGF antibody by immunohistochemical staining (IHC), and phosphorylated smad2 and smad3, which are transcription factors of CTGF, were stained in the same way using the antibody. Comparison pictures are shown. CTGF, phosphorylated Smad2 (P-smad2) and phosphorylated smad3 (P-smad3) were all elevated in the tissues of patients with autosomal dominant polycystic kidney.

3-2. Comparison of protein expression levels using Western blot

To study the signaling system involved in polycystic kidney fibrosis, proteins were extracted from kidney tissue and renal cyst epithelial cells of patients and healthy groups, and Western blot was performed to compare the protein expression levels of CTGF and smad2 and smad3. Specifically, a protein sample was obtained by chemical lysis using a RIPA solution from renal cyst epithelial cells of a healthy group and a patient who had kidney tissue and cell lined according to the method of Example 1, and SDS-PAGE on 12% polyacrylamide gel. After performing, primary antibodies of CTGF (abcam, ab6992), p-smad2 (cell signaling, #3101s), and p-smad3 (abcam, ab52903) were made at a ratio of 1:200 and the antibodies were bound to proteins.

Figures 1c and 2a show photos comparing the protein expression levels by Western blot method using each antibody after protein extraction by decomposing kidney tissue and cells of healthy people and polycystic kidney patients. As a control, b-actin was used, and unphosphorylated smad2 and smad3 were common in both the normal and patient groups, but phosphorylated smad2, phosphorylated smad3 and CTGF were expressed only in the patient group.

Figure 2b shows a photograph comparing protein expression levels by Western blot method using each antibody when A83-01, a phosphorylation inhibitor of smad2 and 3, was treated in renal cyst epithelial cells of autosomal dominant polycystic kidney patients. When the patient cyst cell line was treated with A83-01, an inhibitor that interferes with smad2 and smad3 phosphorylation, phosphorylation of smad2 and smad3 and protein expression levels of CTGF decreased, indicating that CTGF expression is regulated by phosphorylated smad2 and smad3. there is. These results show that in the case of polycystic kidney patients, when smad2 and smad3 are phosphorylated and activated, they move into the nucleus as a transcription material to induce the transcription of CTGF, thereby increasing the expression of CTGF, which leads to fibrosis.

Example 4. Investigation of the amount of CTGF in urine using ELISA

Urine samples from several polycystic kidney patients were collected and the amount of CTGF and estimated glomerular filtration rate were compared using ELISA.

Specifically, a total of 76 samples were collected from patients with polycystic kidneys at Seoul National University Hospital. ELISA was measured using Antigenix America's Human CTGF "Super X" ELISA kit. The glomerular permeability was measured using the 4-variable MDRD formula (age, race, sex, creatinine).

3a shows a graph showing the correlation between the amount of CTGF and glomerular permeability (eGFR) in the urine of polycystic kidney patients. As the amount of CTGF in the urine increases, the glomerular permeability (eGFR) decreases, which means that the renal function decreases. Therefore, it means that patients with a large amount of CTGF in urine have lower glomerular permeability, that is, patients with reduced renal function, and that the amount of CTGF in urine can be used as a biomarker to predict renal function in patients with polycystic kidney.

Afterwards, the distribution of glomerular permeability was examined by dividing the patients into three groups according to the amount of CTGF in the urine. Each group was divided into three groups according to the amount of CTGF in urine: undetectable (undetectable, less than 0.1 ng/ml), low CTGF (low, 0.1 to 1.0 ng/ml), and high CTGF (high, more than 1.0 ng/ml). classified. 3b shows a graph analyzing the glomerular permeability (eGFR) in each group by dividing the amount of CTGF in the urine of polycystic kidney patients into three groups. Each group showed similar glomerular permeability, and the median eGFR for each group was 60.5, 48.7, and 35.7 (ml/min/1.73m ² ) in undetected, low CTGF, and high CTGF, respectively. It was confirmed that the transmittance was divided in correlation with each other.

Taken together, the amount of CTGF in the patient's urine can determine the patient's renal function, suggesting that CTGF can be applied as a biomarker to determine the degree of fibrosis and renal function in polycystic kidney patients.

Example 5. Confirmation of TGF-b secretion in cell culture medium of polycystic kidney patients

5-1. Identification of the type of TGF-b involved in the Smad2/3 signaling pathway

ELISA and RT-PCR were performed to identify the type of TGF-β (TGF-b) that induces the Smad2/3 signaling pathway in patients with autosomal dominant polycystic kidney.

Specifically, renal cyst epithelial cells and normal cells isolated from polycystic kidney patients were cultured in DMEM/10% FBS, and ELISA was performed on the culture solution in substantially the same manner as in Example 4.

Figure 4a shows the ELISA results. TGF-b3 was hardly expressed in both the normal group and the patient group, and TGF-b1 did not show a significant difference in expression level. However, the expression level of TGF-b2 was significantly increased in the patient group than in the normal group (about 1500 to 2500 pg/ml in the normal group, about 5500 to 7000 pg/ml in the patient group), indicating that TGF-b2 induces the Smad2/3 signaling pathway described above. Confirmed.

For RT-PCR, intracellular total RNA was extracted using Qiagen's RNeasy Plus Mini Kit after culturing the cyst cells or normal cells, respectively. As the extracted RNA template, cDNA was prepared through reverse transcription polymerase chain reaction (RT-PCR) using TAKARA's PrimeScript RT-PCR Kit. Specifically, the reaction was carried out at 30°C for 10 minutes, at 42°C for 30 minutes, and at 95°C for 5 minutes, and then stored at 4°C.

Using the cDNA as a template, RT-PCR was performed on TGF-b1, TGF-b2, TGF-b3 and GAPDH (control) using the primers of SEQ ID NOs: 1 to 8 shown in Table 1 below, and RT-PCR After the electrophoresis results are shown in Figure 4b.

SEQ ID NO: Explanation Nucleic acid sequence (5'>3') One TGF-b1_forward GACTACTACGCCAAGGAG 2 TGF-b1_reverse GCTCTGATGTGTTGAAGAA 3 TGF-b2_forward GTGCCTGAACAACGGATT 4 TGF-b2_reverse ATTCGCCTTCTGCTCTTG 5 TGF-b3_forward AATCAGCATTCACTGTCCAT 6 TGF-b3_reverse TCATTGTCCACGCCTTTG 7 GAPDH_forward TTGCCATCAATGACCCCTTCA 8 GAPDH_reverse CGCCCCACTTGATTTTGGA

The control group, GAPDH band, and TGF-b1, TGF-b3 band intensity did not show significant changes between the control group (normal) and autosomal dominant polycystic kidney patients, but in the case of TGF-b2, autosomal dominant polycystic kidney The band appeared stronger than that of the control group, confirming that the transcription amount of the TGF-b2 gene was increased in patients with polycystic kidney.

5-2. Activation of Smad2/3 pathway with or without TGF-b2 addition

To determine whether TGF-b2 is involved in the activation of the Smad2/3 pathway and expression of CTGF in patients with autosomal dominant polycystic kidney, cystic epithelial cells isolated from patients with autosomal dominant polycystic kidney were cultured and treated with TGF-b2. Expression levels of p-smad2, smad2, p-smad3, smad3 and CTGF were confirmed using Western blot.

4c shows the Western blot results. When TGF-b2 was not added, CTGF was hardly expressed and neither smad2 nor smad3 was phosphorylated, but it was qualitatively confirmed that phosphorylated smad2 and smad3 increased when TGF-b2 was added, and the expression level of CTGF protein was increased. .

Example 6. Confirmation of the relationship between ERK and Smad2/3 pathways

ERK is known to phosphorylate the linker region of Smad3, and it is known that ERK activity is increased in patients with autosomal dominant polycystic kidney. In order to confirm the role of ERK in the Smad2/3 signaling pathway, the present inventors treated cystic epithelial cells isolated from polycystic kidney patients with PD98059, an ERK inhibitor, to determine whether ERK and Smad3 phosphorylation were performed according to treatment. .

5 shows Western blot results for P-Smad2, P-Smad3, Lamin A/C and b-actin in the cytoplasm and nucleus according to PD98059 (ERK inhibitor) treatment.

The expression level of phosphorylated Smad2/3 in the nucleus decreased when ERK inhibitor (PD98059) was treated, and P-Smad2 and P-Smad3 were not observed in the cytoplasm regardless of ERK inhibitor treatment.

Example 7. Confirmation of the relationship between AKT and TGF-b2

It is known that activation of AKT inhibits TGF-b2, and overexpression of PC1 (polycystin1) activates AKT. Accordingly, the present inventors confirmed whether PC1 inhibits TGF-b2 through AKT.

Specifically, after transformation by introducing the recombinant PC1 gene into IMCD cells, Western blot was used to confirm whether phosphorylation of AKT (phosphorylation at S473 site) occurred in the cells in which PC1 overexpression occurred, and the results are shown in FIG. 6a.

pcDNA5 means an empty plasmid without the PC1 gene, and the P-AKT band was higher in PC1 overexpressed cells than pcDNA5 or the control group (5uM of AKT inhibitor added group), confirming that overexpression of PC1 induced phosphorylation of AKT. .

In FIG. 6b, AKT1/2 kinase inhibitor (A6730, Sogma-Aldrich), an AKT inhibitor, was treated in IMCD cells overexpressing the PC1 gene at different concentrations of 5uM and 10uM, and the amount of TGF-b in the culture medium was confirmed by ELISA method.

As can be seen in FIG. 6b , when IMCD cells overexpressing the PC1 gene were treated with an AKT inhibitor, the concentration of TGF-b2 secreted in the culture medium increased again compared to IMCD cells overexpressing the PC1 gene, so that AKT was reduced to TGF It was confirmed that the secretion of -b2 was inhibited.

In addition, as a result of performing RT-PCR using primer pairs of SEQ ID NOs: 3 and 4 and SEQ ID NOs: 7 and 8 for TGF-b2 and GAPDH (FIG. 6c), IMCD cells overexpressing the PC1 gene upon treatment with an AKT inhibitor It was confirmed that AKT suppressed the intracellular expression and secretion of TGF-b2 by increasing the expression level of the TGF-b2 gene than in .

Example 8. Summary of CTGF-related mechanism of action in patients with autosomal dominant polycystic kidney

To summarize the contents of the above examples, the secretion of TGF-b2 is increased in patients with autosomal dominant polycystic kidney, which causes phosphorylation of the C-terminal region of Smad2/3.

Meanwhile, phosphorylated ERK phosphorylates the linker region of Smad2/3 to stabilize phosphorylated Smad2/3. The stabilized P-smad2/3 migrates to the nucleus to promote CTGF expression, and as a result, kidney fibrosis proceeds.

The mechanism of action is shown schematically in FIG. 7 .

<110> Seoul National University R&DB Foundation <120> Composition for diagnosing polycystic kidney disease comprising agent for detecting CTGF and use thereof <130> DPP20195200KR <150> KR 10-2018-0172218 <151> 2018-12-28 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TGF-b1_forward <400> 1 gactactacg ccaaggag 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TGF-b1_reverse <400> 2 gctctgatgt gttgaagaa 19 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TGF-b2_forward <400> 3 gtgcctgaac aacggatt 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TGF-b2_reverse <400> 4 attcgccttc tgctcttg 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TGF-b3_forward <400> 5 aatcagcatt cactgtccat 20 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TGF-b3_reverse <400> 6 tcattgtcca cgcctttg 18 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_forward <400> 7 ttgccatcaa tgaccccttc a 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_reverse <400> 8 cgccccactt gattttgga 19

Claims (10)

An agent for detecting at least one selected from the group consisting of a connective tissue growth factor (CTGF) protein and a gene encoding the CTGF protein from a sample isolated from a patient, wherein the sample is urine A composition for diagnosis of chromosomal dominant polycystic kidney. delete delete The composition of claim 1, further comprising an agent for detecting at least one selected from the group consisting of TGF-b2 protein or a gene encoding the protein, phosphorylated Smad2 protein, and phosphorylated Smad3 protein. Measuring the expression level of one or more selected from the group consisting of a CTGF protein and a gene encoding the CTGF protein from a sample isolated from a patient; and
Comprising; comparing the expression level with the expression level in a healthy control sample, wherein the sample is urine, a method of providing information necessary for diagnosis of autosomal dominant polycystic kidney. The polycystic kidney patient according to claim 5, wherein when the expression level of one or more selected from the group consisting of the expression level of CTGF protein and the expression level of a gene encoding CTGF protein in the patient sample is higher than the expression level in the healthy control group, the patient is polycystic kidney patient. The method further comprising the step of classifying into treating a sample isolated from a patient with a candidate substance for the treatment of polycystic kidney; and
A screening method for a therapeutic agent for polycystic kidney, comprising the step of detecting a change in the expression level of one or more selected from the group consisting of a CTGF gene and a CTGF protein in the sample. The method according to claim 7, wherein when the expression level of one or more selected from the group consisting of CTGF gene and CTGF protein in the sample treated with the candidate substance is reduced compared to the sample that is not treated with the candidate substance, the candidate substance is used as a polycystic kidney treatment. A screening method for a therapeutic agent for polycystic kidney which is to classify. An agent for detecting at least one selected from the group consisting of a connective tissue growth factor (CTGF) protein and a gene encoding the CTGF protein from a sample isolated from a patient diagnosed with polycystic kidney, the sample is urine, a composition for predicting the prognosis of autosomal dominant polycystic kidney. Measuring the expression level of one or more selected from the group consisting of a CTGF protein and a gene encoding the CTGF protein from a sample isolated from a patient diagnosed with polycystic kidney, wherein the sample is urine, autosomal dominant polycystic kidney How to provide the information needed to predict the prognosis.

Images