KR20210132292A - A method for inhibiting heavy metal absorption in plants using biopolymers - Google Patents

Abstract

The present invention relates to a method for inhibiting heavy metal absorption in plants using biopolymers, comprising: a heavy metal measurement step of measuring heavy metal contamination in the soil where plants will be planted; a biopolymer treatment step of treating the biopolymer in the soil contaminated with the heavy metals; and a planting step of planting plants after treating the biopolymer.

Description

A method for inhibiting heavy metal absorption in plants using biopolymers {A method for inhibiting heavy metal absorption in plants using biopolymers}

The present invention relates to a method for inhibiting the absorption of heavy metals in plants, and more particularly, to a method for inhibiting absorption of heavy metals in plants using a biopolymer.

Heavy metals are major environmental pollutants and cause generation of reactive oxygen species, DNA damage, and inactivation of various proteins and enzymes in cells. In addition, soil contaminated with heavy metals impedes the normal growth of plants and causes contamination of grains, thereby threatening human health. Recently, living organisms have a mechanism of alleviating the toxicity of harmful substances by using biomaterials or transport proteins that bind harmful substances entering the body. Using genes that contribute to the resistance of these organisms to harmful substances, it is possible to purify the environment polluted with harmful substances in a much more economical and environmentally friendly way compared to the currently widely used physical, chemical, and engineering environmental purification methods (Mejare et al. ., Trends in Biotechnology 19(2): 67-73, 2001). In particular, plants express new traits well by expressing foreign genes, and there are several advantages such as economical management and good aesthetics. Therefore, research is being actively conducted to improve the environment by inserting pollutant tolerance genes into plants. This method is called phytoremediation and is a very efficient, low-cost, and environmentally friendly method for removing heavy metals. Plant environment purification technology is divided into phytoextraction, rhizofiltration, and phytostabilization. Plant extraction removes heavy metals from contaminated soil or water using plants that can accumulate heavy metals in the body. Root filtration is a method of filtering and removing pollutants using plant roots, and plant stabilization is a method of inactivating heavy metals in soil using plants. Biopolymers are attracting attention as a method of inactivating heavy metals in the soil. Biopolymers are a variety of materials produced by biological systems or synthesized from biological source materials. Biopolymers are an alternative to preventing natural disasters and preventing vegetation destruction. Embankment reinforcement technology using For example, it is known that a mixture of biopolymers such as beta-glucan and xanthan gum is effective in enhancing soil strength and water retention. However, the effect of biopolymers on vegetation and plant physiology of mixed soil is not yet clear.

Meanwhile, biofuel as an alternative energy is being discussed recently. Unlike Brazil, which makes biofuel from sugarcane, or the United States, which is obtained by first distilling from corn, Camelina sativa , a native plant of Central Asia, is attracting attention. As an alternative energy source, camelina has a high oil content and a high content of unsaturated fatty acids compared to saturated fat. It is also drought tolerant, has low fertilizer and herbicide requirements, and can rotate with wheat. Planting Camelina has the advantage of producing 100 gallons (about 378 liters) of oil per acre. Camelina oil also contains a large amount of unsaturated fatty acids, making it suitable for future petroleum replacement (Zubr, Industrial Crops and Products , 6, 113-119. 1997).

However, the technology for inhibiting the absorption of heavy metals in plants using biopolymers such as beta-glucan is still unexplored.

The present invention is to solve various problems including the above problems, and it is an object of the present invention to provide a method for inhibiting absorption of heavy metals in plants using a biopolymer in order to prevent overaccumulation of zinc from heavy metal-contaminated soil. However, these problems are exemplary, and the scope of the present invention is not limited thereto.

According to one aspect of the present invention, a heavy metal measuring step of measuring whether heavy metal contamination in the soil to plant a plant; A biopolymer treatment step of treating the soil contaminated with heavy metals with biopolymers; and a planting step of planting a plant after treatment with the biopolymer is provided.

According to an embodiment of the present invention made as described above, the soil in which the soil contaminated with heavy metals is treated and mixed with a biopolymer not only increases water retention but also contains heavy metal ions such as zinc (Zn) in the plant body. By inhibiting absorption, it has a positive effect on plant growth and development even under drought stress and heavy metal toxicity conditions. Of course, the scope of the present invention is not limited by these effects.

1 is a photograph showing the appearance of the dicotyledonous plant Camelina sativa (Camelina) used in the present invention.
2 is a photograph of observation of the zinc stress level of the experimental plant according to the biopolymer concentration treated in the soil.
3 is a graph analyzing the height, leaf length, and live weight of plants in biopolymer mixed soil under zinc toxicity conditions.
4 is a graph of measuring the MDA content in order to confirm the zinc stress damage of plants in biopolymer mixed soil under zinc toxicity conditions.
5 is a photograph observing the results of DTZ staining after purifying an aqueous zinc solution reacted with 0.1% concentration of β-glucan and xanthan gum with a syringe filter of 0.20 μm and 0.45 μm in size.
6 is a photograph of observing stems and leaves after DTZ biostaining of plants in zinc toxicity conditions.
7 is a graph measuring the zinc content of plants under zinc toxicity conditions.
8 is an RT-PCR gel photograph observing the expression pattern of heavy metal ATPase (HMA), which is a heavy metal transport-related gene, under zinc toxicity conditions.

Definition of Terms:

As used herein, the term " Camelina (Camelina sativa L.)" is a dicotyledonous model plant of the Brassaceaceae family, also known as wild flax, flaxseed, German sesame, Siberian oilseed, and is native to Europe and Central Asia. It is mainly grown as a seed crop in Europe and North America.

As used herein, the term "beta glucan (β-glucan)" is a type of polysaccharide and has an immune enhancing action and is present in the cell wall of yeast, mushrooms, grains, and the like. By activating the immune function of normal human cells, it suppresses the proliferation and recurrence of cancer cells, reduces blood sugar and blood cholesterol, and improves lipid metabolism to suppress the formation and accumulation of body fat.

As used herein, the term "xanthan gum" is a food additive for increasing the adhesion and viscosity of food, enhancing emulsion stability, and improving the physical properties and feel of food. It is prepared by purifying, drying, and pulverizing the high molecular weight polysaccharide test material obtained by pure culture fermentation of carbohydrates using Xanthomonas Campestris bacteria in isopropyl alcohol.

DETAILED DESCRIPTION OF THE INVENTION:

According to one aspect of the present invention, a heavy metal measuring step of measuring whether heavy metal contamination in the soil to plant a plant; A biopolymer treatment step of treating the soil contaminated with heavy metals with biopolymers; and a planting step of planting a plant after treatment with the biopolymer is provided.

In the inhibition method, the biopolymer may be treated in soil with 1 to 10 g/kg soil, and the biopolymer may be beta-glucan or xanthan gum, and the heavy metal is cadmium (Cd). ), zinc (Zn) or lead (Pb).

Further, in the suppression method, the crop may be an edible crop or a non-edible crop, and the oilseed crop may be rapeseed, castor, camelina, jatropha, oil palm, or flax.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but can be implemented in various different forms. It is provided to fully inform

material to be disclosed

Camelina Sativa L. used in the present invention was provided by John E. Carlson, Penn State University, USA. β-glucan was provided by Glucan Co., Ltd., and Xanthan gum (CAS No. 11138-66-2) was purchased from Santa Cruz biotechnology.

Example 1: Analysis of Plant Growth and Damage in Zinc Excess Conditions

In order to prevent over-accumulation of zinc from heavy metal-contaminated soil, the present inventors investigated whether or not to reduce zinc toxicity stress damage to plants cultured in soil mixed with biopolymer beta-glucan and xanthan gum (0, 0.25, 0.5, and 1%). The effect on zinc (Zn) absorption in plants was investigated. As plant material, Camelina sativa (Camelina), a dicotyledonous plant, was sown in biopolymer-treated soil and cultured for 1 week, and then treated with 10 mM zinc daily for 2 weeks (FIG. 1). According to the zinc toxicity treatment, changes in leaf length, height, and live weight, which are the phenotypes of the plant leaf, were measured, and the content of malondialdehyde (MDA), which increased when zinc was absorbed by the plant, was measured. In addition, the number of samples used in all experiments was 3 to 15, and repeated experiments were performed three or more times. In addition, statistical analysis was performed using the Tukey method using the SPSS program (SPSS version 25, IBM, USA).

As a result, under the zinc (Zn) toxicity condition, plant growth reduction and damage symptoms did not appear in the soil mixed with 0.25% or more of the biopolymer, and in the soil mixed with 0.5% biopolymer (5 g/1 kg soil), the control Compared to that, it was found that leaf length, height, and live weight were increased ( FIGS. 2 and 3 ). In addition, it was confirmed that the content of malondialdehyde (MDA) was significantly reduced as zinc absorption into the plant decreased ( FIG. 4 ).

Example 2: DTZ staining

The present inventors performed DTZ (dithizone) staining on the biopolymer and the zinc aqueous solution reaction product and the stems and leaves of camelina plants to observe the zinc absorption level by the reaction of the biopolymer according to the zinc toxicity treatment. First, the above-ground parts of Camelina treated with zinc (Zn) were collected and dyed in a solution of DTZ dissolved in methanol at a concentration of 500 μg/L for 4 hours at room temperature. Then, it was washed in distilled water for 5 minutes, and the secondary leaves and stems were observed under a stereoscopic microscope.

As a result, it was possible to confirm zinc absorption by the reaction of the biopolymer (FIG. 5), and similarly to the biopolymer and zinc aqueous solution reaction experiment, excessive absorption of zinc into the plant body during soil treatment of the biopolymer was significantly higher than that of the control group. It was confirmed that the inhibition was (FIG. 6).

Example 3: Analysis of Zinc Content

The present inventors measured the zinc content of the above-ground Camelina based on the DTZ results previously performed in order to confirm the effect of the biopolymer according to the zinc toxicity treatment. Specifically, camelina was sown in soil mixed with biopolymer, cultured for 1 week, and then treated with 10 mM zinc for 2 weeks. The treated camelina was collected and dried in an oven at 65° C. for 3 days. After the dried plants were pulverized and dissolved using nitric acid, the zinc content was measured using ICP-OES.

As a result, it was confirmed that the zinc content of the above-ground part was rapidly increased in the control group under the zinc toxicity treatment condition, but there was no significant difference between the biopolymer mixture treatment groups (FIG. 7).

Example 4: PT-PCR

The present inventors investigated the expression pattern of heavy metal ATPase (HMA), a heavy metal transport-related gene, by RT-PCR under zinc toxicity conditions.

Specifically, _{camelina grown for 1 week was treated with ZnSO 4} aqueous solution (10mM, 150ml) for 2 weeks, then primary main leaves were collected, and total RNA was extracted from the primary main leaves, followed by cDNA synthesis. RT-PCR was performed using the synthesized cDNA, and reaction conditions were as follows: CsHMA1, CsHMA2 , CsHMA4 : denaturation time 95° C. 30 seconds, annealing time 57.3° C., 30 seconds, extension Extension time 72°C, 30 seconds, 30 cycles, CsHMA3 : denaturation time 95°C, 30 seconds, annealing time 54.3°C 30 seconds, extension time 72°C, 30 seconds, 30 cycles. CsActin : denaturation time 95°C, 30 seconds, annealing time 58°C, 30 seconds, extension time 72°C, 30 seconds, 27 cycles.

As a result, the expression of CsHMA2 and CsHMA3 was increased in the control group, whereas it was decreased in the biopolymer mixture treatment group (FIG. 8). The above results suggest that the growth and development of plants are inhibited as well as the problem of accumulation of heavy metals in plants during plant cultivation in heavy metal-contaminated soil, which may eventually lead to a decrease in crop yield. The nucleic acid sequence information of the primers used in the RT-PCR is summarized in Table 1 below.

primer nucleic acid sequence primer Nucleic acid sequence (5'-->3') SEQ ID NO: CsHMA1 F AAGACTTTGTTCATGCCGC One CsHMA1 R CCTCTGGCTTTAGGTTGCAG 2 CsHMA2 F CTCAAGTCCTGCTGATCCCG 3 CsHMA2 R GTGTGGTGTGTGATGGTGACT 4 CsHMA3 F TCGTGAAGGCATTGAATCAA 5 CsHMA3 R CAAGGATGGGGAAAACTCCG 6 CsHMA4 F AGCCTGTTACCTTGGTGGTT 7 CsHMA4 R TGCATAACTCCTGCAACAGT 8 CsActin F GAAGAACTACGAGCTACCTGATG 9 CsActin R GATCCTCCGATCCAGACACTGTA 10

In conclusion, using the method for inhibiting the absorption of heavy metals by plants using the biopolymer according to an embodiment of the present invention, it is possible to prevent the accumulation of heavy metals in the body of the crops even if the crops are grown in soil heavily contaminated with heavy metals, as well as water retention ability. Because it can prevent the inhibition of crop growth and development by increasing

Although the present invention has been described with reference to the above-described embodiments, these are merely exemplary, and those skilled in the art will understand that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

<110> AHN, Sung-Ju <120> A method for inhibiting heavy metal absorption in plants using biopolymers <130> PD19-5825 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CsHMA1 F <400> 1 aagactttgt tcatgccgc 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA1 R <400> 2 cctctggctt taggttgcag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA2 F <400> 3 ctcaagtcct gctgatcccg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA2 R <400> 4 gtgtggtggt gatggtgact 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA3 F <400> 5 tcgtgaaggc attgaatcaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA3 R <400> 6 caaggatggg gaaaactccg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA4 F <400> 7 agcctgttac cttggtggtt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CsHMA4 R <400> 8 tgcataactc ctgcaacagt 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CsActin F <400> 9 gaagaactac gagctacctg atg 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CsActin R <400> 10 gatcctccga tccagacact gta 23

Claims (7)

a heavy metal measurement step of measuring whether heavy metal contamination is present in the soil to be planted;
A biopolymer treatment step of treating the soil contaminated with heavy metals with biopolymers; and
A method of inhibiting absorption of heavy metals during cultivation of the plant, comprising the step of planting a plant after treating the biopolymer. According to claim 1,
A method of treating the soil with the biopolymer at 1 to 10 g/kg soil. According to claim 1,
The biopolymer is beta-glucan (β-glucan) or xanthan gum (xanthan gum), the method. According to claim 1,
The heavy metal is zinc (Zn) method. According to claim 1,
The method of claim 1, wherein the plant is an edible crop or a non-edible crop. 6. The method of claim 5,
The method of claim 1, wherein the non-edible crop is an oilseed crop. 7. The method of claim 6,
The method of claim 1, wherein the oilseed crop is camelina.

Images