KR20210094770A - Composition for Preventing, Improving or Treating of muscular disease containing Petasites japonicus extract - Google Patents

Abstract

The present invention relates to a composition for preventing, alleviating or treating muscular diseases, containing a Petasites japonicus leaf extract as an active component. More specifically, the present invention relates to a muscle strengthening composition or a food composition for improving exercise ability which contains a Petasites japonicus leaf extract as an active component. A method of the present invention, since the Petasites japonicus leaf extract has effects of increasing the size of muscle cells and improving exercise performance, can be usefully used for preventing, alleviating or treating muscular diseases without side effects.

Description

Composition for Preventing, Improving or Treating of muscular disease containing Petasites japonicus extract containing coltsfoot leaf extract as an active ingredient

The present invention relates to a composition for preventing, ameliorating or treating muscle diseases comprising a coltsfoot leaf extract as an active ingredient, and more particularly, to a composition for muscle strengthening or a food composition for improving athletic performance comprising a coltsfoot leaf extract as an active ingredient. it's about

Muscle is the tissue with the most composition in the human body, and in order to maintain the functional capacity of the human body and prevent metabolic diseases, it is essential to secure an appropriate muscle mass. Muscle size is regulated by intracellular signaling pathways that induce anabolism or catabolism within the muscle. When a signal transduction reaction that induces synthesis rather than degradation of muscle protein occurs, muscle protein synthesis is increased, and as a result, muscle hypertrophy (hypertrophy) or increase in the number of muscle fibers (hyperplasia) occurs (The Korea) Journal of Sports Science, 20(3): 1551-1561, 2011).

Muscles also promote calcium influx and increase bone density. However, as the body ages, the redistribution of body fat and body proteins occurs due to changes in the composition of the body. At the age of 50, the rate of protein synthesis in muscle cells becomes slower than the rate of decomposition, leading to rapid muscle degeneration and exposure to muscle loss disease. can be

Sarcopenia, one of muscle loss diseases, refers to a state in which about 13 to 24% of one's body mass is decreased, and indicates a decrease in protein content, fiber diameter, muscle strength production, and fatigue resistance. Sarcopenia is caused by a variety of causes, including sepsis, cancer, renal failure, excess glucocorticoids, denervation, muscle non-use, and the aging process. Mainly, the gradual decrease in the quantity and quality of skeletal muscle that occurs with aging and weight loss including fat and body fat components due to inadequate dietary energy intake can be cited as the causes. .

Sarcopenia results from an imbalance between protein synthesis and degradation. If there is sarcopenia, the amount of action is significantly reduced, which not only harms mental health, but also reduces life satisfaction.

In addition, excessive exercise causes muscle fatigue and damage, and reduces exercise capacity. Muscle injuries include bruises, lacerations, ischemia, strains, and severe damage to skeletal muscles. In addition to causing great pain, the injured person can become incapacitated by preventing him from continuing to exercise and work or even performing normal daily activities. When there is severe damage to the skeletal muscle, sprains are most common, which are characterized by destruction of the muscle-tendon unit. Destruction of these muscle-tendon units can occur anywhere in the muscle. Constraints account for more than 30% of all injuries treated professionally or by sports medicine professionals.

Treatments that reduce muscle damage or speed up recovery of muscle tissue have the potential to speed up recovery of muscle development after exercise. It may also help muscle recovery after illness.

However, as interest in appearance and diet has increased recently, sarcopenia may be induced by rapid weight loss regardless of age, and muscle may be damaged by vigorous exercise.

Accordingly, research and efforts to treat muscle loss caused by general muscle loss disease or to increase muscle have been focused, and research on treatment and muscle strengthening of muscle loss disease is still required.

Accordingly, the present inventors have searched for a natural substance that has muscle function strengthening and muscle reduction inhibitory activity and can be safely applied. As a result, it was confirmed that coltsfoot leaf extract has the effect of preventing and treating sarcopenia, increasing muscle mass, inhibiting muscle loss, or increasing muscle endurance. Thus, the present invention was completed.

Accordingly, it is an object of the present invention to provide a composition for preventing, improving or treating muscle diseases, comprising an extract of butterbur leaf ( Petasites japonicus ) as an active ingredient.

Another object of the present invention is to provide a composition for strengthening muscles comprising coltsfoot leaf extract as an active ingredient.

Another object of the present invention is to provide a food composition for enhancing athletic performance comprising a coltsfoot leaf extract as an active ingredient.

In order to achieve the above object, the present invention provides a composition for preventing, improving or treating muscle diseases, comprising an extract of butterbur leaf ( Petasites japonicus ) as an active ingredient.

In order to achieve another object of the present invention, the present invention provides a composition for strengthening muscles comprising a coltsfoot leaf extract as an active ingredient.

In order to achieve another object of the present invention, the present invention provides a food composition for enhancing athletic performance comprising a coltsfoot leaf extract as an active ingredient.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for preventing, improving, or treating muscle diseases, comprising an extract of Butterbur leaf ( Petasites japonicus ) as an active ingredient.

In the present invention, the coltsfoot leaf ( Petasites japonicus) is a perennial plant belonging to the Asteraceae family, and grows wild anywhere in the country, mainly in wetlands such as mountainous areas. The genus name, Petasites, is a Greek word meaning 'broad-brimmed hat', derived from the large leaves of coltsfoot. After the flowers have faded, a thick underground stem stretches out to the side, and a wide kidney-shaped round leaf sprouts from the tip. A coltsfoot leaf has a long petiole, 15-30cm wide, has hairs on both sides and then disappears, and has irregular sawtooths on the edge of the leaf. It is known that the country of origin is Europe, Asia such as Korea and Japan, and North America, and 15 to 20 species are said to be native.

The extract of the present invention may be extracted by a known natural extracting method. It has a meaning commonly used as a crude extract in the art, but broadly includes a fraction obtained by additionally fractionating the extract. . That is, the coltsfoot leaf extract includes not only those obtained by using an extraction solvent, but also those obtained by additionally applying a purification process thereto. For example, a fraction obtained by passing the extract through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (prepared for separation according to size, charge, hydrophobicity or affinity), etc. The fraction obtained through the purification method may also be included in the extract of the present invention. Preferably, it is characterized in that the extract is obtained by at least one solvent selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof.

In the present invention, the muscle disease is a progressive disease characterized by a loss of walking ability due to a gradual decrease in muscle strength, weakness in respiratory muscle, weakness in heart function, etc. It is a chronic disease that causes In addition, muscle diseases can be divided into congenital diseases and acquired diseases, but are not limited thereto, but atony, muscular atrophy, muscular dystrophy, muscle degeneration, muscle stiffness, muscular dystrophy, muscular atrophy It may be axonal sclerosis, myasthenia gravis, cachexia or sarcopenia.

The present invention provides a composition for strengthening muscles comprising a coltsfoot leaf extract as an active ingredient.

In the present invention, muscle strengthening refers to an effect of increasing muscle strength and/or size of a muscle, and the type of muscle is not limited. Preferably, it exhibits an effect of increasing muscle mass, and is characterized in that it exhibits an effect of inhibiting muscle loss.

The increase in muscle mass is to improve muscle performance, and it is possible to increase muscle mass through physical exercise and improvement of endurance, and to increase muscle mass by administering a substance having a muscle increasing effect into the body. In addition, the muscle reduction is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles, genetic factors, and acquired factors. Aging may be the cause.

The composition of the present invention is characterized in that it is a pharmaceutical composition or a food composition comprising a coltsfoot leaf extract as an active ingredient.

The pharmaceutical composition according to the present invention may contain coltsfoot leaf extract alone or may be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may further contain excipients or diluents. As used herein, the term 'pharmaceutically acceptable' refers to a non-toxic composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans.

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, various drug delivery materials used for oral administration of the peptide formulation may be included. In addition, the carrier for parenteral administration may include water, a suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components. For other pharmaceutically acceptable carriers and agents, reference may be made to those described in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration. can be

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above.

In the case of a formulation for oral administration, the composition of the present invention may be formulated as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. using methods known in the art. can For example, oral preparations can be obtained by mixing the active ingredient with a solid excipient, grinding it, adding suitable adjuvants, and processing into a granule mixture to obtain tablets or dragees. Examples of suitable excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches, including corn starch, wheat starch, rice starch and potato starch, cellulose, Cellulose, including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, and the like, fillers such as gelatin, polyvinylpyrrolidone, and the like may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant if necessary. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, and a preservative.

Formulations for parenteral administration can be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols and nasal inhalants by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995, which is a commonly known recipe for all pharmaceutical chemistry.

The total effective amount of the composition of the present invention may be administered to a patient as a single dose, or may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. Preferably, the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 μg to 10,000 mg, most preferably 0.1 μg to 500 mg per kg of patient body weight per day. However, the dosage of the pharmaceutical composition is determined by considering various factors such as the formulation method, administration route and number of treatments, as well as the patient's age, weight, health status, sex, severity of disease, diet and excretion rate, etc., the effective dosage for the patient is determined. Therefore, in consideration of this point, those of ordinary skill in the art will be able to determine an appropriate effective dosage of the composition of the present invention. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

The present invention provides a food composition for improving athletic performance comprising a coltsfoot leaf extract as an active ingredient.

In the present invention, the exercise ability can be performed quickly, strongly, accurately, for a long time, and skillfully when physical motions seen in daily life or sports are externally divided into running, jumping, throwing, swimming, etc. It indicates the degree of presence, and exercise performance is defined by factors such as muscle strength, agility, and endurance.

The term 'improving athletic performance' refers to improving or improving athletic performance. Preferably, the food composition exhibits an effect of increasing muscle strength and is characterized in that it exhibits an effect of increasing muscle endurance. In addition, although not limited thereto, it may be to prevent or improve symptoms such as degenerative diseases, mitochondrial abnormalities, hypostamina, hypoactivity, lethargy, muscle wasting or depression.

The composition for food using the butterbur leaf extract according to the present invention includes all types of functional food, nutritional supplement, health food and food additives. The above types can be prepared in various forms according to conventional methods known in the art.

For example, as a health food, the composition for food of the present invention may be prepared in the form of tea, juice, and drink for drinking, or may be ingested by granulation, encapsulation and powdering. In addition, the composition for food of the present invention can be prepared in the form of a composition by mixing with known substances or active ingredients known to have effects of promoting hair growth and anti-inflammatory.

In addition, functional foods include beverages (including alcoholic beverages), fruits and their processed foods (eg, canned fruit, canned fruit, jam, marmalade, etc.), fish, meat and their processed foods (eg, ham and sausage cornbread). if), breads and noodles (eg udon noodles, soba noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, margarine , vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.) can be prepared by adding the composition for food of the present invention.

The preferred content of the composition for food according to the present invention is not limited thereto, but is preferably 0.01 to 50% by weight based on the total weight of the finally prepared food. In order to use the composition for food of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.

In one embodiment of the present invention, when the oral coltsfoot leaf extract was treated with PPAR delta and ERR3 over cells to measure luciferase activity, the two transcription activities were increased to increase the utilization rate in muscle cells. It was confirmed that it was effective for formation and differentiation. (See Fig. 1).

In one embodiment of the present invention, as a result of analyzing the life span by treating the coltsfoot leaf extract with C. elegans as a diet, it was confirmed that the life span was increased compared to the control group, N2. (See Fig. 2).

In one embodiment of the present invention, after treatment of coltsfoot leaf extract on muscle cells, RNA is extracted, atrogin-1, MurF-1, which induces atrophy by destroying muscle protein, Myostatin that inhibits muscle differentiation, and muscle As a result of measuring the expression levels of MyoG and MyoD mRNA that regulate differentiation, the case where the coltsfoot extract was treated significantly regulated the above gene expression compared to the group treated with dexamethasone, resulting in muscle cell formation and It was confirmed that it was effective for differentiation. (See Fig. 3).

In one embodiment of the present invention, the protein expression of T-MHC, MHCI, MHCIIa, and MHCIIb was measured after treatment with the coltsfoot leaf extract on muscle cells. As a result, muscle cells decreased when treated with dexamethasone. It was confirmed that the expression of cell constituent protein was significantly increased when the coltsfoot extract was treated, and thus it was effective in the formation of muscle cells. (See Fig. 4).

In one embodiment of the present invention, the cellular respiration rate, that is, the oxygen consumption rate (OCR) was measured after the coltsfoot leaf extract was treated with the muscle cells. Significant recovery was confirmed. (See Fig. 5).

Accordingly, the present invention provides a composition for preventing, ameliorating or treating muscle disease, comprising the coltsfoot leaf extract as an active ingredient. The method of the present invention confirmed the effect of coltsfoot leaf extract on muscle cells, and since the coltsfoot leaf extract showed an effect of improving muscle mass, muscular endurance or athletic performance when ingested, a composition for preventing, improving or treating muscle disease, exercise ability It can be usefully used as a food composition for enhancement, a composition for strengthening muscles.

Figure 1 shows the results of measuring Luciferase activity after treatment with coltsfoot leaf extract on PPAR delta and ERR3 over cells using U-2 OS (HTB-96 ^{TM) human-derived bone cells.}
2 is a result of analyzing the life span of a coltsfoot leaf extract treated with a diet in C. elegans.
3 shows the results of confirming the expression of mRNA related to muscle cell differentiation and muscle contraction according to the treatment with coltsfoot leaf extract after treating the differentiated myoblasts with dexamethasone.
4 is a result confirming the expression change of muscle type protein according to the treatment with coltsfoot leaf extract after treating the differentiated myoblasts with dexamethasone.
5 is a result of confirming the change in cellular respiration rate according to the treatment of coltsfoot leaf extract after treatment of myoblasts with dexamethasone.

Hereinafter, the present invention will be described in detail.

However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

<Experiment method>

One-way ANOVA was performed for all study results using GraphPad Prism 7 (GraphPad Software Inc., SanDiego, CA, USA), and statistical significance was verified by Boneferroni multiple comparison post test, *p<0.05, **p It was expressed as <0.01, ***p<0.001.

1. Preparation of coltsfoot leaf extract sample

The coltsfoot leaves were purchased, dried in hot air, and then pulverized into powder. Hot water extraction was performed for 2 hours using a 50% ethanol solvent in a volume 10 times the weight of the powder. After the extract was concentrated under reduced pressure, the final product obtained by freeze-drying after freezing at -80°C was finely pulverized and used in the experiment.

2. Measurement of luciferase activity regulation of PPAR delta and ERR3 transcription of coltsfoot leaf extract

U-2 OS (HTB-96 ^TM ) human-derived bone cells used in the experiment were purchased from American type Cell Collection (ATCC, USA) and cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS.

The plasmid DNA of pBABE-puro (addgene, Plasmide #1764), pBABE puro PPAR delta (addgene, Plasmide #8891), and pSG5-HA-ERR3 (addgene, Plasmide #37850) was converted to X-tremeGENE 9 DNA Transfection Reagent (06 365 787). 001, Roche, Switzerland) was used to construct a target over cell.

After processing coltsfoot leaf extract on the prepared PPAR delta and ERR3 over cells, PPRE X3-TK-lus (addgene, Plasmide #1015), pRL-SV40P (addgene, Plasmide #27163) plasmid DNA and Dual-Luciferase® Reporter Assay System ( Promega, E1910) was used to measure luciferase activity. The results are shown in FIG. 1 .

3. Lifespan analysis of C. elegans from coltsfoot leaf extract

The life span of coltsfoot leaf extract was analyzed using C. elegans. After making a culture plate by adding 100 mg/mL of coltsfoot leaf extract to NGM (Nematode Growth Medium), 200 μl of OP50 culture was dispensed to create basic culture conditions. Here, two N2 L4 stage worms were separated from one plate and incubated in an incubator at 15°C for a week. After a week, young adults from synchronized L4 were collected in 200μl M9 buffer and incubated at 20°C overnight. After overnight incubation, dispense in the NGM prepared for the L1 stage and incubate for two days. After two days of incubation, when the L1 stage grows to L4, transfer one worm per plate to a new NGM (n=30). After raising the worms in an incubator at 20 °C, the date of death was recorded for each worm, and when all the worms died, the life span was measured by analyzing the death records. The results are shown in FIG. 2 .

4. Confirmation of changes in mRNA expression of muscle contraction and differentiation regulators when coltsfoot leaf extract differentiates muscle cells

Mouse-derived myoblasts, C2C12 (CRL1772 ATCC, USA) cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS, and treated with DMEM differentiation medium containing 2% HS for 4 days. After differentiation induction, coltsfoot extract 1, 2.5 μg/mL and dexamethasone 5 μM were treated.

After 24 hours, the cells were washed with PBS, the cells were obtained, and total RNA was extracted using the NucleoSpin RNA kit (Nacherey-Nagel, Duren, Germany) according to the manufacturer's instructions. Then, cDNA was synthesized using Synthesize cDNA for real-time PCR kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO), and PCR was performed with SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan). to measure the mRNA expression levels of atrogin-1, MurF-1, Myostatin, and MyoD. The results are shown in FIG. 3 .

primer sequence base sequence SEQ ID NO: Atrogin Sense GACTGGACTTCTCGACTGCC One Anti-sense TCAGGGATGTGAGCTGTGAC 2 MurF-1 Sense GCTGGTGGAAAACATCATTGACAT 3 Anti-sense CATCGGGTGGCTGCCTTT 4 Myostatin Sense ACGCTACCACGGAAACAATC 5 Anti-sense GGAGTCTTGACGGGTCTGAG 6 MyoD Sense CGGGACATAGACTTGACAGGC 7 Anti-sense TCGAAACACGGGTCATCATAGA 8 18s RNA Sense GTAACCCGTTGAACCCCATT 9 Anti-sense CCATCCAATCGGTAGTAGCG 10

5. Effect of coltsfoot leaf extract on muscle type protein expression

Mouse-derived myoblasts, C2C12 (CRL1772 ATCC, USA) cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS, and treated with DMEM differentiation medium containing 2% HS for 4 days. After differentiation induction, coltsfoot leaf extract 1, 2.5 μg/mL and Dexamethasone 5 μM were treated.

After 24 hours, the cells were washed using PBS, the cells were obtained, and the protein was extracted by dissolving in RIPA buffer (Thermo Scientific, Waltham, MA, USA), and then electrophoresed using an SDS-PAGE gel. was carried out. After that, the membrane to which the protein was transferred was blocked with 5 (v/v)% skim milk for 1 hour, the primary antibody was heated at 4° C. overnight, and the secondary antibody was incubated at room temperature. After attaching for 2 hours in a , protein expression was measured using an enhanced chemiluminescence (ECL) solution.

The primary antibody used for western blotting performed in the present invention is β-actin (β-actin, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MHC (myosin heavy chain), MHC1 (oxidative, slow type), MHC2A (oxidative, fast type) and MHC2B (glycolytic, fast type) (Developmental Studies Hybridoma Bank, Iowa City, Iowa, USA). The results are shown in FIG. 4 .

6. Confirmation of effect of coltsfoot leaf extract on respiration rate

Respiratory rate, that is, oxygen consumption rate (OCR) of coltsfoot leaf extract was measured using XF analyzer (Seahorse Bioscience, USA).

C2C12 (CRL1772 ATCC, USA) cells, which are mouse-derived myoblasts, were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS. Cells were prepared by seeding according to the instructions of XF-24 FluxPak (Seahorse, Agilent, USA). After 24 hours of treatment with dexamethasone and coltsfoot leaf extract 1, 2.5 μg/mL, the medium was replaced with a bicarbonate-free medium and cultured in a cell incubator without CO2 for 1 hour. 1.5 μM oligomycin, 2 μM carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (carbonyl cyanide-4-(trifluoromethoxy)) using Seahorse XF Cell Mito Stress Test Kit (Agilent, USA) phenylhydrazone (FCCP)) and 1 μM rotenone, a respiratory chain inhibitor, were sequentially treated to measure the change in OCR. The results are shown in FIG. 5 .

<Example 1> Measurement of luciferase activity regulation of PPAR delta and ERR3 transcription of coltsfoot leaf extract

As can be seen in Figure 1, it was confirmed that the coltsfoot leaf extract significantly increased the activity of ERR3 and PPAR delta. It was found that coltsfoot extract effectively regulates ERR3 and PPAR delta activities, which play an important transcriptional role in muscle cells.

<Example 2> Lifespan analysis of C. elegans of coltsfoot leaf extract

As can be seen in Figure 2, compared to the N2 worm control group, it was observed that the lifespan significantly increased by about 4 days in the group treated with the coltsfoot leaf extract at 100 μg/mL. From Day 10, individual lifespan increased as a whole, and in particular, coltsfoot leaf extract was observed to have the function of increasing both N2 worm lifespan and healthspan.

<Example 3> Confirmation of changes in mRNA expression of muscle contraction and differentiation regulators when coltsfoot leaf extract differentiates muscle cells

As can be seen in Figure 3, the results of confirming the gene expression of Atrogin-1, MurF-1 (Muscle RING-finger protein-1), which causes atrophy by destroying muscle protein, dexamethasone It was confirmed that the treated group significantly increased compared to the control group, DMSO group.

On the other hand, it was confirmed that the increase in gene expression caused by dexamethasone was significantly reduced in the group treated with coltsfoot leaf extract at 1, 2.5 μg/mL. The efficacy of regulating muscle atrophy-regulating genes of coltsfoot leaf extract was confirmed.

As a result of analyzing the gene expression of MyoD, which is known to regulate muscle differentiation, and myostatin, a muscle differentiation inhibitory factor, the expression of MyoD was significantly reduced in the dexamethasone-treated group compared to the control group DMSO. could be seen to increase.

It was confirmed that the gene expression of MyoD and myostatin, which are genes regulating muscle differentiation during treatment with dexamethasone, was significantly regulated when treated with coltsfoot extract 1, 2.5 μg/mL. As a result, it was confirmed that the coltsfoot leaf extract had the effect of regulating muscle differentiation.

<Example 4> Effect of coltsfoot leaf extract on muscle type protein expression

As can be seen in Figure 4, protein expression of muscle fibers T-MHC, MHCI, MHCIIa, and MHCIIb was inhibited by treatment with dexamethasone, but protein expression was increased according to treatment with coltsfoot extract 1 and 2.5 μg/mL. was significantly recovered in a dependent manner.

As a result, it was confirmed that the muscle fiber atrophy induced by dexamethasone was protected by the coltsfoot leaf extract.

<Example 5> Confirmation of effect of coltsfoot leaf extract on respiration rate

As can be seen in FIG. 5, it was confirmed that the cellular respiration rate decreased by dexamethasone treatment was significantly restored when the coltsfoot leaf extract was treated.

As described above, the method of the present invention is useful for preventing, improving or treating muscle diseases without side effects using the coltsfoot leaf extract because it has the effect of increasing the size of muscle cells and improving exercise performance. can be used

<110> KOREA FOOD RESEARCH INSTITUTE <120> Composition for Preventing, Improving or Treating of muscular disease containing Petasites japonicus extract <130> NP19-0135 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin_sense <400> 1 gactggactt ctcgactgcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin_anti sense <400> 2 tcagggatgt gagctgtgac 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MurF-1_sense <400> 3 gctggtggaa aacatcattg acat 24 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MurF-1_anti sense <400> 4 catcgggtgg ctgccttt 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myostatin_sense <400> 5 acgctaccac ggaaacaatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myostatin_anti sense <400> 6 ggagtcttga cgggtctgag 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MyoG_sense <400> 7 gcaggctcaa gaaagtgaat ga 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MyoG_anti sense <400> 8 taggcgctca atgtactgga t 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s RNA_sense <400> 9 gtaacccgtt gaaccccatt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s RNA_anti sense <400> 10 ccacccaatc ggtagtagcg 20

Claims (11)

Butterbur leaf ( Petasites japonicus ) A composition for preventing, improving or treating muscle diseases, comprising an extract as an active ingredient.
The composition of claim 1, wherein the extract is an extract using one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof.
According to claim 1, wherein the muscle disease is dystonia (atony), muscular atrophy (muscular atrophy), muscular dystrophy (muscular dystrophy), muscle degeneration, muscle stiffness, muscular dystrophy, amyotrophic axonal sclerosis, myasthenia gravis, cachexia (cachexia) and A composition, characterized in that at least one selected from the group consisting of sarcopenia.
A composition for strengthening muscles comprising butterbur leaf extract as an active ingredient.
The composition according to claim 4, wherein the composition exhibits an effect of increasing muscle mass.
The composition according to claim 4, wherein the composition exhibits an effect of inhibiting muscle loss.
7. The composition according to any one of claims 1 to 6, wherein the composition is a pharmaceutical composition or a food composition.
A food composition for enhancing athletic performance comprising a coltsfoot leaf extract as an active ingredient.
The food composition according to claim 8, wherein the food composition exhibits an effect of increasing muscle strength.
The food composition according to claim 8, wherein the food composition exhibits an effect of increasing muscular endurance.
According to claim 8, wherein the exercise capacity enhancement is to prevent or improve one or more symptoms selected from the group consisting of degenerative diseases, mitochondrial abnormalities, hypostamina, hypotonia, lethargy, muscle wasting and depression, etc. Food characterized in that composition.

Images