KR20210088614A - 5-halouracil-modified microRNA and use thereof in cancer treatment - Google Patents

Abstract

The present invention provides nucleic acid compositions comprising one or more halouracil molecules. More specifically, the present invention shows that replacement of uracil with 5-halouracil in a microRNA nucleotide sequence increases the ability of the microRNA to inhibit cancer progression and tumorigenesis. As such, the present invention provides various nucleic acid (eg, microRNA) compositions in which 5-halouracil molecules are incorporated in the nucleic acid sequence and methods of using the same. The present invention also provides a pharmaceutical composition comprising the modified nucleic acid composition and a method of treating cancer using the same.

Description

5-halouracil-modified microRNA and use thereof in cancer treatment

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is filed in U.S. Provisional Application No. 62/464,491, filed on February 28, 2017, U.S. Provisional Application No. 62/422,298, filed on November 15, 2016, and November 1, 2016, each of which is incorporated herein by reference in its entirety. It is a continuation-in-part application of PCT/US2017/059011, filed October 30, 2017, claiming priority from U.S. Provisional Application Serial No. 62/415,740.

government support

[0002] This invention was made with government support under Grant Nos. HL127522 and CA197098 awarded by the National Institutes of Health. The government reserves the right in this invention.

Sequence Listing Reference Included

[0003] The sequence listing in an ASCII text file named 050 8992 US SequenceListing.txt, filed with the US Patent and Trademark Office via EFS-Web is incorporated herein by reference.

Field of the Invention

[0004] The present invention relates generally to nucleic acid compositions comprising 5-halouracil. More specifically, the present invention provides modified microRNA compositions containing at least one 5-halouracil and methods of using the same. In addition, the present application provides a pharmaceutical composition comprising the nucleic acid composition of the present invention and a cancer treatment method using the same.

[0005] MicroRNAs (miRNAs, miRs) are highly regulated translation in cells or organisms that negatively regulate the expression of their target genes, resulting in translational abortion, messenger RNA (mRNA) cleavage, or a combination thereof. It is a class of conserved non-coding small ribonucleic acid (RNA) molecules. [Bartel DP. Cell. (2009) 136(2):215-33]. By targeting multiple transcripts, miRNAs regulate a wide range of biological processes including apoptosis, differentiation and cell proliferation, and thus aberrant microRNA function can lead to cancer (Ambros V. Nature. (2004) 431). pp. 350-255)), and thus, recently miRNAs have been identified as biomarkers, oncogenes or tumor suppressors. See, eg, Croce, CM, Nat Rev Genet. (2009) 10 pp. 704-714].

[0006] Cancer is the leading cause of death worldwide, accounting for 8.8 million deaths in 2015, according to the World Health Organization (WHO). The most common causes of cancer deaths are lung cancer (1,69 million deaths), liver cancer (788,000 deaths), colorectal cancer (774,000 deaths), stomach cancer (i.e. gastric cancer), which accounts for 774,000 deaths, breast cancer (754,000 deaths). [Surveillance, Epidemiology, and End Results Program. SEER Cancer Stat Facts. National Cancer Institute. Bethesda, MD (2018)].

Lung cancer is the leading cause of cancer death in both men and women in the United States, and only 18.6% of patients diagnosed with lung cancer survive more than 5 years. [Surveillance, Epidemiology, and End Results Program. SEER Cancer Stat Facts. National Cancer Institute. Bethesda, MD (2018)]. There are two main categories of lung cancer: non-small cell lung cancer and small cell lung cancer. Non-small cell lung cancer is further described by the type of cancer cells present in the tissue. As such, non-small cell lung cancer is classified into the following subclasses of lung cancer: squamous cell carcinoma (also called epidermal carcinoma), giant cell carcinoma, adenocarcinoma (i.e., cancer arising from the cells that line the alveoli), polymorphism, carcinoids Tumors and salivary gland carcinomas. On the other hand, there are two main types of small cell lung cancer: small cell carcinoma and complex small cell carcinoma. [Surveillance, Epidemiology, and End Results Program. SEER Cancer Stat Facts. National Cancer Institute. Bethesda, MD (2018)]. The most common treatments for non-small cell lung cancer are gemcitabine (2',2'-difluoro 2'deoxycytidine), taxol (eg, paclitaxel), cisplatin (a DNA crosslinking agent), and combinations thereof. However, many types of antibody-based therapeutics are also used to treat non-small cell lung cancer (eg, gefitinib, pembrolizumab, alectinib). Small cell lung cancer is usually treated with methotrexate, doxorubicin hydrochloride, and topotecan-based chemotherapy agents.

[0008] Breast cancer is the second most common cancer in women, and the most common type of breast cancer is ductal cancer. Carcinoma of the ducts begins in the cells of the ducts. Conversely, lobular carcinoma, commonly found in both breasts, develops in lobes or lobules. Many chemotherapeutic agents are used to treat breast cancer, including, but not limited to, cytotoxic drugs such as taxol (paclitaxel, docetaxel) doxorubicin hydrochloride, 5-FU, gemcitabine hydrochloride, methotrexate and tamoxifen citrate. In addition, many antibody-based therapeutic agents are administered to treat various types of breast cancer, such as trastuzumab, olaparib and pertuzumab.

[0009] Colorectal cancer (CRC) is the third most common malignancy and the second most common cancer-related cause of death in the United States. [Hegde SR, et al., Expert review of gastroenterology & hepatology. (2008) 2(1) pp. 135-49]. Although there are a number of chemotherapeutic agents used to treat cancer, pyrimidine antagonists, such as fluoropyrimidine-based chemotherapeutic agents (eg, 5-fluorouracil, S-1), are the representative standard for treating colorectal cancer. (gold standard). Pyrimidine antagonists block the synthesis of nucleotides containing pyrimidine (cytosine and thymine in DNA, cytosine and uracil in RNA). Because pyrimidine antagonists have a similar structure compared to endogenous nucleotides, they compete with native pyrimidines to inhibit important enzymatic activities involved in the replication process, resulting in inhibition of DNA and/or RNA synthesis and inhibition of cell division.

[0010] Gastric cancer (ie, gastric cancer or adenocarcinoma) is the fourth most common cause of cancer-related death worldwide, and treatment remains difficult in western countries, primarily because most patients have advanced disease. Gastric malignancy is currently the 14th most common cancer in the United States. [American Cancer Society: Cancer Facts and Figures 2018. American Cancer Society. Atlanta, Georgia (2018)]. Gastric cancer is usually presented in the form of well-differentiated intestinal adenocarcinoma, or diffuse adenocarcinoma that is poorly differentiated and does not form glandular structures. Because there are no effective non-invasive treatment options, surgery remains the main treatment for gastric cancer. However, the combination of 5-fluorouracil (5-FU) and leucovorin can also be administered to patients with gastric cancer.

[0011] Pancreatic cancer is a fatal cancer that is very difficult to treat. [Siegel, RL et al. Cancer J. Clin. (2015) 65 pp. 5-29]. Unique aspects of pancreatic cancer include a very low 5-year survival rate of less than 7% (ld.), late onset of symptoms, early metastasis, and poor response to chemotherapy and radiotherapy. [Maitra A and Hruban RH, Annu Rev. Pathol. (2008) 3 pp. 157-188]. To date, gemcitabine-based chemotherapy (2',2'-difluoro 2'-deoxycytidine) has been the standard treatment for pancreatic cancer, but the therapeutic intervention effect is limited due to drug resistance. [Oettle, H et al. JAMA (2013) 310 pp. 1473-1481].

[0012] Blood born cancer, ie leukemia, is a common form of cancer, as evidenced by the number of different types of leukemia, and is also very diverse. In 2015, it was estimated that there were 405,815 leukemia patients living in the United States. The main types of leukemia are: acute lymphoblastic leukemia (ACL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL) and chronic myelogenous leukemia (CML). [Noone AM, et al. (eds). SEER Cancer Statistics Review, 1975-2015, National Cancer Institute. Bethesda, M.D. (2018)]. Drugs approved for the treatment of leukemia include, for example, doxorubicin hydrochloride, 5-FU, gemcitabine hydrochloride, cytarabine, methotrexate and tamoxifen citrate, rituximab, ibrutinib, imatinib and dasatinib.

[0013] 5-fluorouracil (ie, 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is used in many adjuvant chemotherapeutic agents, such as Carac® cream. , Efudex®, Fluoroplex® and Adrucil® are well-known pyrimidine antagonists. 5-FU targets thymidylic acid synthase (TYMS or TS), an important enzyme that catalyses the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP), an essential step in DNA biosynthesis. It is well known that [Danenberg P. V., Biochim. Biophys. Acta. (1977) 473(2):73-92]. However, despite the steady improvement of 5-FU-based therapy, the patient response rate to 5-FU-based chemotherapy is still lukewarm due to the development of drug resistance. [Longley D. B, et al., Apoptosis, Cell Signaling, and Human Diseases, (2007) p. 263-78].

Nevertheless, existing cancer treatments are still in their infancy, and there are still many obstacles waiting to be improved or overcome. For example, although 5-FU is quite effective in the treatment of various cancers, it is well known that 5-FU has substantial toxicity and can cause many side effects. Like many cytotoxic chemotherapeutic agents, 5-FU is administered systemically by IV or injection, and non-specifically targets all dividing cells (including cancer cells) in a subject. As such, as an alternative to the existing cancer treatment, a new targeted anti-cancer treatment with low toxicity is being sought.

With respect to miRNAs, this compound is known to be prone to enzymatic degradation upon administration, which leads to poor stability. In addition, tumor cells are known to evade the apoptotic pathway by developing resistance to common therapeutic agents such as 5-FU and gemcitabine. See Gottesman M. M. et al., Nature Reviews Cancer, (2002) 2(1):48-58. Therefore, for the treatment of cancer, more effective, stable and less toxic drugs would be of great benefit.

Summary of the invention

[0016] Without wishing to be bound by one particular theory, the present invention provides that the incorporation of 5-halouracil bases in the nucleotide sequence of the microRNA is, when compared to certain known chemotherapeutic agents alone and/or native microRNA molecules, It is premised on the discovery of increasing the efficacy of microRNAs as anticancer agents. The present invention demonstrates that a nucleic acid composition (ie, microRNA) comprising one or more 5-halouracil bases has excellent efficacy as an anticancer agent. Moreover, the present data show that contacting cells with the modified microRNA compositions of the present invention modulates cell cycle progression and reduced tumorigenesis, e.g., by reducing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents. show In addition, the modified microRNAs of the present invention maintain target specificity, can be delivered without the use of deleterious and ineffective delivery vehicles (e.g., nanoparticles), and without abrogating the natural function of the endogenous microRNAs. It has been shown to exhibit enhanced efficacy and safety. Accordingly, the present invention provides novel modified microRNA compositions with improved stability and efficacy, target specificity and low toxicity for the treatment of many types of cancer.

[0017] Therefore, in one aspect of the present invention, a modified microRNA nucleotide sequence having one or more uracil bases (U, U bases) replaced with 5-halouracil, such as 5-fluorouracil (5-FU) A nucleic acid composition comprising In certain embodiments, the modified microRNA has one or more uracils or exactly one uracil replaced with 5-halouracil. In some embodiments, the modified microRNA nucleotide sequence comprises 2, 3, 4, 5, 6, 7, 8 or more uracil bases replaced with 5-halouracil. In certain embodiments, all uracil nucleotide bases of the native microRNA have been replaced with 5-halouracil.

[0018] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-halouracil is 5-fluorouracil.

[0019] In certain embodiments, the modified microRNA nucleotide sequence comprises one or more 5-halouracils, whereby each of the 5-halouracils is identical. In another embodiment, the modified microRNA nucleotide sequence comprises one or more 5-halouracils, whereby each of the 5-halouracils is different. In another embodiment, the modified microRNA nucleotide sequence comprises two or more 5-halouracils, whereby the modified microRNA nucleotide sequence comprises different combinations of 5-halouracils.

[0020] In one exemplary embodiment of the present invention, there is provided a nucleic acid composition containing a miR-129 nucleotide sequence modified by replacing one or more uracil nucleotide bases with 5-halouracil. More specifically, the nucleic acid composition comprises at least the following native miR-129 nucleotide sequence:

CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. One]

wherein at least one, two, three, four, five, six, seven, eight or all of the uracil bases in or covalently linked to the depicted nucleic acid sequence are 5 - Replaced by halouracil.

[0021] In a specific embodiment of the present invention, the modified microRNA comprises:

CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0022] In another embodiment, the seed portion of the native miR-129 nucleotide sequence, GUUUUUUC, remains unmodified (ie, does not contain 5-halouracil), while the modified miR-129 nucleotide sequence One or more (or all) of the remaining uracil nucleotide bases in the remainder of the are replaced with the same number of 5-halouracil. In a specific embodiment, the modified miR-129 microRNA of the present invention comprises:

CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5], whereby U ^F is halouracil, specifically 5-fluorouracil.

[0023] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-halouracil is 5-fluorouracil.

[0024] In another embodiment of the present invention, a nucleic acid containing a miR-15a nucleotide sequence modified by replacing one or more of the uracil nucleotide bases with 5-halouracil, such as 5-fluorouracil (5-FU). A composition is provided. Specifically, the nucleic acid composition comprises at least the following native miR-15a nucleotide sequence:

UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], wherein at least one, two, three, four, five, six or all of the uracil nucleotide bases in, or capable of being covalently linked to, the depicted sequence are 5-hollow It's Lasil.

[0025] In a specific embodiment of the present invention, the modified miR-15a microRNA comprises:

U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 6], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0026] In another embodiment, the seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with 5-halouracil, while the remainder of the miR-15a nucleotide sequence (non-seed portion) ) one or more (or all) of the remaining uracil bases are replaced by 5-halouracil.

[0027] In certain embodiments, the modified miR-15a microRNA comprises:

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0028] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the native miR-140 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil. More specifically, the nucleic acid composition comprises one or more of the following native miR-140 nucleotide sequences:

CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8]

1, 2, 3, 4, 5, 6, 7 or more or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0029] In one set of embodiments, exactly one of the U bases in the native miR-140 nucleic acid sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the native miR-140 nucleotide sequence are replaced with 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-140 nucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the native miR-140 nucleotide sequence are 5-halouracil. In some embodiments, exactly 5 or 5 or more U bases in the miR-140 nucleotide sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-140 nucleotide sequence are 5-halouracil. In some embodiments, exactly 7 or 7 or more U bases in the miR-140 nucleotide sequence are 5-halouracil. In certain embodiments, all of the U bases of the miR-140 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0030] In one exemplary embodiment, the modified microRNA nucleic acid composition of the present invention comprises:

CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0031] In another embodiment, the modified microRNA nucleic acid composition of the present invention comprises:

CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0032] In another exemplary embodiment, the present invention provides a nucleic acid composition comprising a native miR-192 or miR-215 nucleotide sequence modified by replacing one or more of the uracil bases with 5-halouracil is about In some embodiments, the modified miR-192 nucleotide sequence has been modified by replacing one or more of the U bases with 5-fluorouracil. More specifically, the nucleic acid composition comprises one or more of the following native miR-192 nucleotide sequences:

CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10]

1, 2, 3, 4 or more or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0033] In a specific embodiment, exactly one of the U bases in the modified miR-192 nucleotide sequence is 5-halouracil. In another embodiment, exactly two or more than two U bases in the modified miR-192 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the modified miR-192 nucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the modified miR-192 or miR-215 nucleotide sequence are 5-halouracil. In certain embodiments, all of the U bases of the modified miR-192 or miR-215 sequence, whether in native and/or appended portions of the nucleic acid, are 5-halouracil.

[0034] In one exemplary embodiment, the nucleic acid composition of the present invention comprises:

CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11] has a modified miR-192 or modified miR-215 nucleotide sequence, wherein U ^F is halouracil, specifically 5-fluorouracil.

[0035] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified native miR-502 nucleotide sequence, modified by replacing uracil with 5-halouracil. In some embodiments, the modified miR-502 nucleotide sequence has been modified by replacing one or more of the U bases with 5-fluorouracil. More specifically, the nucleic acid composition comprises one or more of the following native miR-502 nucleotide sequences:

AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12]

1, 2, 3, 4, 5, 6, 7 or more or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0036] In another set of embodiments, exactly one of the U bases in the miR-502 nucleotide sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-502 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-502 nucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-502 nucleotide sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-502 nucleotide sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-502 nucleotide sequence are 5-halouracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-502 nucleotide sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-502 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0037] In one exemplary embodiment, the modified miR-502 nucleic acid composition of the present invention comprises:

AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0038] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR-506 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition comprises one or more of the following native miR-506 nucleotide sequences:

UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14]

1, 2, 3, 4, 5, 6, 7 or more or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0039] In another set of embodiments, exactly one of the U bases in the native miR-506 nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In another embodiment, exactly 7 or 7 or more U bases in the modified miR-506 nucleotide sequence are 5-halouracil. In certain embodiments, all of the U bases of the modified miR-506 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0040] In one exemplary embodiment, the miR-506 nucleic acid composition of the present invention comprises:

U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0041] In another embodiment, the present invention provides a nucleic acid composition comprising a modified miR-34 nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR-34 nucleotide sequence has been modified by replacing at least one of the U bases with 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-34 nucleotide sequence:

UGGCAGUGUCUUAGCUGGUUGU [SEQ ID NO. 17],

1, 2, 3, 4, 5, 6, 7, 8 or more or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0042] In another set of embodiments, exactly one of the U bases in the native miR-34 nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-34 nucleotide sequence are 5-halo racil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 6 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 7 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 8 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-34 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0043] In an exemplary embodiment, the miR-34 nucleic acid composition of the present invention comprises

U ^F GGCAGU ^F GU ^F CU ^F U ^F AGCU ^F GGU ^F U ^F GU ^F [SEQ ID NO. 18]

has a modified microRNA nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0044] In another embodiment, the present invention provides a nucleic acid composition comprising a modified miR-200a nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR-200a nucleotide sequence has been modified by replacing at least one of the U bases with 5-halouracil, such as 5-fluoro uracil. For example, the nucleic acid composition may contain at least the following native miR-200a nucleotide sequence:

UAACACUGUCUGGUAACGAUGU [SEQ ID NO. 19], at least one, two, three, four, five, six or all of the uracil bases in the nucleic acid sequence shown above are replaced with 5-halouracil.

[0045] In another set of embodiments, exactly one of the U bases in the native miR-200a nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-200a nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-200a nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-200a nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-200a nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 6 U bases in the modified miR-200a nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-200a nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0046] In an exemplary embodiment, the miR-200a nucleic acid composition of the present invention comprises

U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20]

has a modified microRNA nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0047] In another embodiment, the present invention provides a nucleic acid composition comprising a modified miR-200b nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR-200b nucleotide sequence has been modified by replacing at least one of the U bases with 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-200b nucleotide sequence:

UAAUACUGCCUGGUAAUGAUGA [SEQ ID NO. 21], at least one, two, three, four, five, six or all of the uracil bases in the nucleic acid sequence shown are replaced with 5-halouracil.

[0048] In another set of embodiments, exactly one of the U bases in the native miR-200b nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-200b nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-200b nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-200b nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-200b nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 6 U bases in the modified miR-200b nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-200b nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0049] In an exemplary embodiment, the miR-200b nucleic acid composition of the present invention comprises

U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22]

has a modified microRNA nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0050] In another embodiment, the present invention provides a nucleic acid composition comprising a modified miR-200c nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR-200c nucleotide sequence has been modified by replacing at least one of the U bases with 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-200c nucleotide sequence:

UAAUACUGCCGGGUAAUGAUGGA [SEQ ID NO. 23], at least one, two, three, four, five or all of the uracil bases in the nucleic acid sequence shown are replaced with 5-halouracil.

[0051] In another set of embodiments, exactly one of the U bases in the native miR-200c nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-200c nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-200c nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-200c nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-200c nucleotide sequence are 5-halouracil. In certain embodiments, all of the U bases in the modified miR-200c nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0052] In an exemplary embodiment, the miR-200c nucleic acid composition of the present invention comprises

U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24]

has a modified microRNA nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0053] In some embodiments, the present invention provides a nucleic acid composition comprising a modified miR-145 nucleotide sequence comprising 5-halouracil. In one example, the modified miR-145 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-145 nucleotide sequence:

GUCCAGUUUUCCCAGGAAUCCCU [SEQ ID NO. 25], at least 1, 2, 3, 4, 5, 6 or all of the uracil bases in the nucleic acid sequence shown are replaced with 5-halouracil.

In another set of embodiments, exactly one of the U bases in the native miR-145 nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-145 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-145 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-145 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-145 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 6 U bases in the modified miR-145 nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-145 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0055] In an exemplary embodiment, the miR-145 nucleic acid composition of the invention comprises

GUFCCAGUFUFUFUFCCCAGGAAUFCCCUF [SEQ ID NO. 26]

has a modified microRNA nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0056] In another exemplary embodiment, there is provided a nucleic acid composition comprising a modified native miR-194 nucleotide sequence, modified by replacing at least one of the uracil bases with 5-halouracil. In some embodiments, the modified miR-194 nucleotide sequence has been modified by replacing at least one of the U bases with 5-fluorouracil. More specifically, the nucleic acid composition contains at least the following native miR-194 nucleotide sequence:

UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 27], at least one, two, three, four or all of the uracil bases in the nucleic acid sequence shown are replaced with 5-halouracil.

[0057] In certain embodiments, exactly one of the U bases in the modified miR-194 nucleotide sequence is 5-halouracil. In another embodiment, exactly or at least two U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-194 nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-194 sequence, whether in native and/or appended portions of the nucleic acid, are 5-halouracil.

[0058] In an exemplary embodiment, the nucleic acid composition of the present invention comprises

U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28]

has a modified miR-194 nucleotide sequence of , and U ^F is halouracil, specifically 5-fluorouracil.

[0059] In another embodiment, the present invention provides a nucleic acid composition comprising a modified miR-let-7 nucleotide sequence comprising 5-halouracil. In some embodiments, the modified miR let-7 nucleotide sequence has been modified by replacing at least one of the U bases with a 5-halouracil, such as 5-fluorouracil. For example, the nucleic acid composition may contain at least the following native miR-let-7 nucleotide sequence:

UGAGUAGUAGGUUGUAUAGUU [SEQ ID NO. 29], at least 1, 2, 3, 4, 5, 6, 7, 8 or all uracil bases in the nucleic acid sequence shown are replaced with 5-halouracil.

[0060] In another set of embodiments, exactly one of the U bases in the native miR-let-7 nucleotide sequence is replaced with 5-halouracil. In a second set of embodiments, exactly or at least two U bases in the modified miR-let-7 nucleotide sequence are 5-halo racil. In another set of embodiments, exactly or at least 3 U bases in the modified miR-34 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 4 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 5 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 6 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 7 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracil. In another embodiment, exactly or at least 8 U bases in the modified miR-let-7 nucleotide sequence are 5-halouracil. In certain embodiments, all U bases in the modified miR-let-7 nucleotide sequence, whether in native and/or appended portions, are 5-halouracil.

[0061] In an exemplary embodiment, the miR-let-7 nucleic acid composition of the present invention comprises

U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30], and U ^F is halouracil, specifically 5-fluorouracil.

[0062] In some embodiments, the 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In certain embodiments, the 5-halouracil is 5-fluorouracil, or a combination thereof. In certain instances, all U bases of the modified miR are substituted with 5-fluorouracil.

[0063] The present invention also relates to formulations of the modified microRNA compositions described herein or combinations thereof, ie formulations comprising two or more modified microRNAs. In certain embodiments, the formulation may comprise a pharmaceutical formulation comprising the aforementioned nucleic acid composition and other known pharmacological agents, such as one or more pharmaceutically acceptable carriers.

[0064] The present invention shows that each of the modified microRNAs exhibits strong efficacy as anticancer therapeutics. In particular, each modified microRNA nucleic acid composition tested reduces cancer cell proliferation, tumor growth and development in a dose dependent manner by inducing cell-cycle arrest in all six cancer types tested.

[0065] Therefore, another aspect of the invention relates to a method of treating cancer comprising administering to a subject an effective amount of one or more nucleic acid compositions described herein. In a specific embodiment of the method of the present invention, the nucleic acid composition is modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR- 200a, miR-200b, miR-200c, miR-145, miR-194, miR-let-7 nucleotide sequence, or a combination thereof, wherein 1, 2, 3 of each native (unmodified) nucleotide sequence , 4 or more uracil nucleotide bases were replaced with 5-halouracil.

[0066] In certain embodiments, the methods of the present invention comprise administering a nucleic acid composition of the present invention to a subject suffering from or having a cancer predisposition, whereby the nucleic acid composition is modified miR-129 or modified miR-15a nucleic acid. In a specific embodiment of the present invention, the modified microRNA administered is

CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],

CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],

U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6], and

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7] has a nucleic acid sequence selected from the group consisting of.

[0067] In another embodiment, the method of the present invention comprises administering a nucleic acid composition of the present invention to a subject suffering from or having a cancer predisposition, whereby the nucleic acid composition comprises a modified miR-140 or a modified miR-140. miR-192 nucleic acid. In a specific embodiment of the present invention, the modified microRNA administered is

CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],

CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16], and

CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],] having a nucleic acid sequence selected from the group consisting of.

[0068] In another embodiment, the method of the present invention comprises administering a nucleic acid composition of the present invention to a subject suffering from or having a cancer predisposition, whereby the nucleic acid composition is modified miR-502 or modified miR-506 nucleic acid. In a specific embodiment of the present invention, the modified microRNA administered is

AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], and

U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15] has a nucleic acid sequence selected from the group consisting of.

[0069] In another embodiment, the method of the invention comprises administering a nucleic acid composition of the invention to a subject suffering from or predisposed to cancer, whereby the nucleic acid composition comprises a modified miR-34, a modified modified miR-145, modified miR-200a, modified miR-200b, modified miR-200c, modified miR-194 or modified miR-let-7 nucleic acids. In a specific embodiment of the present invention, the modified microRNA administered is

U ^F GGCAGU ^F GU ^F CU ^F U ^F AGCU ^F GGU ^F U ^F GU ^F [SEQ ID NO.18],

U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20],

U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22],

U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24],

GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26],

U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28],

U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30] and

and a nucleic acid sequence selected from the group consisting of combinations thereof.

[0070] In some examples, the subject treated by the methods of the present invention is a mammal. In certain embodiments, the subject being treated is a human, dog, horse, pig, mouse or rat. In certain embodiments, the subject is a human who has been diagnosed with cancer or has been identified as having a predisposition to developing cancer. In some embodiments, the cancer to be treated may be, for example, colorectal cancer, stomach cancer, esophageal cancer, lung cancer, ovarian cancer, pancreatic cancer or uterine cancer. In certain embodiments, the methods of the present invention treat a subject for one or more of the following types of cancer: colorectal cancer, stomach cancer, pancreatic cancer, lung cancer, blood cancer (eg, leukemia) or breast cancer.

[0071] The data provided herein surprisingly show that the modified microRNAs described in the present invention show increased levels of the modified microRNAs described herein when compared to known anticancer agents, such as 5-FU alone, in several different cancer models including colorectal cancer, pancreatic cancer and lung cancer. show efficacy. For example, the present invention provides that the modified nucleic acid composition described above is 5-FU, miR-15a, miR-129, miR-140, miR-192, miR-215, miR-502, miR-506, miR-34 , miR-145, miR-200a, miR-200b, miR-200c, miR-194 or miR-let-7 alone, or the combination of native microRNAs corresponding to 5-FU, cancer progression and tumorigenesis than provides the unexpected finding that it is substantially more potent in inhibiting

[0072] As such, the compositions and methods of the present invention provide the added advantage of allowing lower dosages, which results in lower toxicity and reduced side effects. Another important advantage exhibited by the above-described nucleic acid composition is that the composition is unmodified with halouracil native miR-15a, miR-129, miR-140, miR-192, miR-215, miR-502, miR -506, miR-34, miR-145, miR-200a, miR-200b, miR-200c, miR-194 or miR-506 compared to let-7 nucleic acid has a greatly improved efficacy. Thus, at least in light of the above-mentioned advantages, the nucleic acid compositions disclosed herein represent substantial advances in the treatment of all cancers.

Brief description of the drawing

[0073] The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings are provided by the Patent and Trademark Office upon request and payment of the necessary fees.

1a to 1p. Chemical representations of exemplary modified microRNA nucleotide sequences of the invention. (a) Chemical representation of the miR-129 nucleotide sequence in which ^{all U bases have been replaced with halouracil (ie U F} ), as set forth in SEQ ID NO: 4. (b) chemical representation of miR-129 with U bases replaced with halouracil only in the non-seed portion of miR-129, as set forth in SEQ ID NO: 5 (c) as set forth in SEQ ID NO: 6, all Chemical representation of the miR-15a nucleotide sequence in which the U base is replaced with halouracil, (d) miR- with U bases replaced with halouracil only in the non-seed portion of miR-15a, as set forth in SEQ ID NO: 7 Chemical representation of 15a. (e) Chemical representation of the miR-140 nucleotide sequence in which certain 3 U bases have been replaced with halouracil, as set forth in SEQ ID NO: 9. (f) Chemical representation of the modified miR-140 nucleotide sequence in which all specific U bases have been replaced with halouracil, as set forth in SEQ ID NO: 16. (g) Chemical representation of the miR-192 nucleotide sequence in which certain 5 U bases have been replaced with halouracil, as set forth in SEQ ID NO: 11. (h) Chemical representation of the miR-502 nucleotide sequence in which certain 7 U bases have been replaced with halouracil, as set forth in SEQ ID NO: 13. (i) Chemical representation of the miR-506 nucleotide sequence in which all (ie 8) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 15. (j) Chemical representation of the modified miR-34 nucleotide sequence in which all (ie, 9) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 18. (k) Chemical representation of the modified miR-200a nucleotide sequence in which all (ie 7) U bases have been replaced with halluracil, as set forth in SEQ ID NO: 20. (l) Chemical representation of the modified miR-200b nucleotide sequence in which all (ie 7) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 22. (m) Chemical representation of the modified miR-200c nucleotide sequence in which all (ie, 6) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 24. (n) Chemical representation of the modified miR-145 nucleotide sequence in which all (ie, 7) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 26. (o) Chemical representation of the modified miR-194 nucleotide sequence in which all (ie 5) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 28. (p) Chemical representation of the modified miR-let-7 nucleotide sequence in which all (ie 9) U bases have been replaced with halouracil, as set forth in SEQ ID NO: 30. The orientation of each of the exemplary modified microRNAs shown is provided with a 5' to 3' or 3' to 5' designation.

[0075] Figures 2a-2c. Exemplary modified microRNA nucleic acids enter cancer cells and effectively reduce target protein expression. (A) Target (E2F3) specificity of exemplary modified miR-129 (all U bases replaced by 5-FU, 5-FU-miR-129) compared to that of control miRNA and unmodified miR-129 nucleic acids and Graph showing performance. (b) Quantitative real-time PCR analysis showing that the modified miR-129 nucleic acid (mimetic) enters cancer cells. (c) The modified miR-129 nucleic acid (mimetic) enters cancer cells and degrades TS-FdUMP significantly better than 5-FU alone.

) 및 외인성 발현된 (exogenously expressed) 본연의 miR-129 (○)와 비교한, 모든 U 염기가 5-플루오로우라실로 대체된 예시적인 변형된 miR-129 핵산 (

). [0076] Figure 3. Graph showing the inhibition of colorectal cancer cell proliferation in four different colorectal cancer cell lines (HCT116, RKO, SW480 and SW620) by an exemplary modified microRNA (mimetic). Non-specific control (negative control,

) and an exemplary modified miR-129 nucleic acid in which all U bases were replaced with 5-fluorouracil compared to exogenously expressed native miR-129 (○) (

).

[0077] Figure 4. Combination therapy with 5-FU and the modified microRNA composition of the present invention effectively inhibits cancer cell proliferation. negative control (NC), exogenously expressed native miR-129 (miR-129), 5-FU, an exemplary modified miR-129 nucleic acid of the invention (5-FU-miR-129), and 5-FU Graphical comparison of colorectal cancer cell proliferation versus cancer cells treated with an exemplary combination of miR-129 nucleic acids of the invention (5-FU-miR-129 + 5-FU).

[0078] Figures 5a-5b. Exemplary modified microRNAs induce apoptosis and cause cell cycle arrest in colorectal cancer cells. (A) Quantification of cell death by FITC-Annexin V apoptosis assay, showing that the modified miR-129 nucleic acid composition of the present invention in several different colorectal cancer cell lines was significantly higher than the negative control, or aberrantly expressed native miR-129 It has been shown to induce apoptosis of cancer cells at high levels. (b) flow cytometry was performed to reveal that the modified miR-129 nucleic acid composition of the present invention (mimetic-1) increased the G1 cell cycle arrest to a significantly higher level than the negative control or aberrantly expressed native miR-129 .

[0079] Figure 6. The modified microRNA nucleic acid composition of the present invention eliminates chemotherapy-resistant cancer stem cells. HCT116-derived colorectal cancer stem cells were treated with increasing concentrations of an exemplary modified miR-129 nucleic acid (○) or 5-FU (●) of the present invention. The results show that the modified miR-129 nucleic acid killed 5-FU resistant cancer stem cells in a dose dependent manner.

[0080] Figure 7. In vivo systemic treatment using an exemplary modified microRNA nucleic acid composition inhibits colorectal cancer metastasis without toxic side effects. A mouse model of colorectal cancer metastasis was established via tail vein injection of metastatic human colorectal cancer cells. Two weeks after establishment of metastases, 40 μg of a modified miR-129 nucleic acid composition as set forth in SEQ ID NO: 4 was delivered by intravenous injection at a treatment frequency of one injection every other day for 2 weeks. The exemplary modified miR-129 nucleic acid (mimetic) was able to inhibit colon cancer metastasis (right panel), whereas the negative control miRNA (left panel) had no effect. Mice treated with the modified miR-129 nucleic acid did not show any toxicity.

[0081] Figures 8a-8b. An exemplary second anticancer activity of the modified microRNA of the present invention. (A) Representative Western blot comparing the ability of exogenously expressed unmodified miR-15a (miR-15a) and a modified miR-15a nucleic acid composition (mimetic-1) to regulate protein expression in colorectal cancer cells. Modified miR-15a (mime-1) as set forth in SEQ ID NO: 6 has the ability to modulate miR-15a targets (YAP1, BMI-1, DCLK1 and BCL2) and degrade TS-FdUMP in colorectal cancer cells hold the (b) Modified miR-15a (mime-1) suppressed colorectal cancer cell proliferation in three different colorectal cancer cell lines (HCT116, RKO, SW620) compared to exogenously expressed unmodified miR-15a (miR-15a) It has been shown that the suppression ability is enhanced.

[0082] Figures 9a-9b. Modified microRNA nucleic acids in leukemia cells and colorectal cancer cells induce cell cycle arrest in G1/S phase. (a) Control (negative), unmodified miR-15a (miR-15a), and an exemplary modified miR-15a nucleic acid composition as set forth in SEQ ID NO: 6 (mime-1) showing cell cycle control graph. Modified miR-15a nucleic acid as shown by the increase in the G1/S ratio exhibited by colorectal cancer cells expressing the modified miR-15a when compared to cells exogenously expressing native miR-15a and negative controls Administration of induced cell cycle arrest compared to unmodified miR-15a. (b) additional exemplary modified microRNA nucleic acids (5-FU-miR-145 and 5-FU-miR-let-7) Also, when the modified microRNA is provided at a concentration of 50 nM, hematological cancer cells ( i.e., in REH leukemia cells) induce cell cycle arrest in G1/Srl when compared to negative controls.

[0083] Figure 10. Modified miR-15a expression reduces the ability of cancer stem cells to induce cancer cell colony formation. In colorectal cancer stem cells, expression of unmodified miR-15a (miR-15a) inhibited cancer cell colonization compared to the ability of cancer stem cells presented using non-specific control microRNA (negative). Treatment with an exemplary modified miR-15a (5-FU-miR-15a) of the present invention completely prevented cancer cell colony formation.

[0084] Figure 11. Another exemplary modified microRNA shows efficacy as an anticancer agent in vivo. A mouse model of colorectal cancer metastasis was established through tail vein injection of metastatic human colorectal cancer cells. Two weeks after establishment of metastases, 40 μg of a modified miR-15a nucleic acid composition as set forth in SEQ ID NO: 6 was delivered by intravenous injection at a treatment frequency of one injection every other day for 2 weeks. An exemplary modified miR-15a nucleic acid (mimetic) was able to inhibit colon cancer metastasis, whereas a negative control miRNA (negative) had no effect. Mice treated with the modified miR-15a nucleic acid did not show any toxicity.

12A-12D. Exemplary modified miR-15a and miR-129 mimetics of the invention are human compared to cells treated with unmodified miR-15a (miR-15a) or unmodified miR-129 (miR-129) or negative control. showed an enhanced ability to inhibit proliferation of breast cancer cells (A549; c, d) and pancreatic cancer cells (Panc-1 (a); AsPC-1 (b)).

[0086] Figures 13a-13b. Exemplary modified microRNAs of the present invention exhibit enhanced ability to inhibit human colorectal cancer cell proliferation. Additional exemplary modified microRNAs were tested for their ability to inhibit colorectal cancer cell proliferation in HCT116 human colorectal cancer cells. (a) administration of an exemplary modified miR-140 mimic set forth in SEQ ID NO: 9 to human colorectal cancer cells, it was found that the ability to inhibit colorectal cancer cell proliferation was increased when compared to a negative control microRNA . (b) administration of an exemplary modified miR-192 mimic set forth in SEQ ID NO: 11 to human colorectal cancer cells, it was found that the ability to inhibit colorectal cancer cell proliferation was increased when compared to a negative control microRNA .

[0087] Figures 14a-14e. All exemplary modified microRNAs of the present invention exhibit enhanced ability to inhibit several types of cancer. Cancer cell proliferation was determined by negative control (negative), miR-15a [SEQ ID NO: 6], miR-129 [SEQ ID NO: 4], miR-506 [SEQ ID NO: 15] for each cancer type tested. , miR-502 [SEQ ID NO: 13], miR-34 [SEQ ID NO: 18], miR-200a [SEQ ID NO: 20], miR-200b [SEQ ID NO: 22], miR-200c [SEQ ID NO: 22] ID NO: 24], miR-145 [SEQ ID NO: 26], miR-194 [SEQ ID NO: 28], miR-let-7 [SEQ ID NO: 30], miR-215 [SEQ ID NO: 11 ] and miR-140 [SEQ ID NO: 16], it was inhibited by exogenous expression of each of the 5-FU-modified microRNA nucleic acids. (A) Human pancreatic cancer cell proliferation is inhibited by expression of each modified microRNA tested in Hs766T pancreatic cancer cells. (b) Gastric cancer cell proliferation is inhibited by expression of each modified microRNA tested in AGS gastric cancer cells. (c) Human breast cancer cell proliferation is inhibited by expression of each modified microRNA tested in SKBR3 breast cancer cells. (d) Lung cancer cell proliferation is inhibited by expression of each modified microRNA tested in A549 lung cancer cells. (e) Leukemia cancer cell proliferation is inhibited by expression of each modified microRNA as tested in an acute lymphocytic leukemia cell line (REH). Taken together, the data show that the modified microRNA composition of the present invention exhibits an increased ability to inhibit proliferation of all types of cancer cells when compared to the negative control.

15A-15C. All exemplary modified microRNAs of the present invention showed the ability to inhibit cancer cell growth in a dose dependent manner. Cancer cell proliferation was determined by negative control (negative), miR-15a [SEQ ID NO: 6], miR-129 [SEQ ID NO: 4], miR-506 [SEQ ID NO: 15] for each cancer type tested. , miR-502 [SEQ ID NO: 13], miR-34 [SEQ ID NO: 18], miR-200a [SEQ ID NO: 20], miR-200b [SEQ ID NO: 22], miR-200c [SEQ ID NO: 22] ID NO: 24], miR-145 [SEQ ID NO: 26], miR-194 [SEQ ID NO: 28], miR-let-7 [SEQ ID NO: 30], miR-215 [SEQ ID NO: 11 ] and miR-140 [SEQ ID NO: 16] were inhibited by exogenous expression of each of the 5-FU-modified microRNA nucleic acids. (a, b) Human pancreatic cancer cell proliferation was inhibited in a dose-dependent manner by each modified microRNA tested in two different human pancreatic cancer cell lines (a, APSC-1; b, PANC-1). (c) Leukemia cancer cell proliferation was inhibited in a dose dependent manner by each modified microRNA tested in an acute lymphocytic leukemia cell line (REH). Taken together, these data show that the modified microRNA compositions of the present invention exhibit the ability to inhibit the growth and proliferation of multiple types of cancer cells in a dose dependent manner.

[0089] Figures 16a-16c. Another exemplary modified microRNA nucleic acid enters cancer cells and inhibits tumorigenesis and progression by effectively reducing target protein expression and inducing cell cycle arrest. (A) Targets (ZEB-1 and fibronectin of an exemplary modified miR-200b (all U bases replaced by 5-FU, 5-FU-miR-200b) compared to control miRNA and unmodified miR-200b nucleic acids ) graphs showing specificity and ability. (b) Modified miR-200b nucleic acid (5-FU-miR-200b) enters breast cancer cells (MDA-MB-231 cell line) for triple negative breast cancer, degrades TS-FdUMP and exhibits anticancer activity. (c) Expression of modified miR-200b (5-FU-miR-200b) compared to expression of exogenous native miR-200b and negative control (miR-NC) in cells, G1/S ratio (top) and sub-G1 Population (bottom) significantly increased, indicating that the modified miR-200b inhibits breast cancer cell cycle progression.

[0090] Figures 17a-17b. Modified microRNA molecules can be delivered to cancer cells without an exogenous delivery vehicle. (a) Transfection of MDA-MB-231 cells with non-specific microRNA control nucleic acid (miR-NC), native miR-200b or modified miR-200b (5-FU-miR-200b) in the presence of oligofectamine or (b) without delivery vehicle (ie, no oligofectamine) with NCs (negative control), native miR-200b or modified miR-200b (5-FU-miR-200b). Modified miR-200b effectively reduced cell proliferation of breast cancer cells with or without delivery vehicle, when compared to negative control and native miR-200b. In contrast, exogenous miR-200b did not inhibit cell growth in the absence of delivery vehicle.

DETAILED DESCRIPTION OF THE INVENTION

[0091] The present invention provides a nucleic acid composition comprising one or more halouracil molecules. Without being bound by any one particular theory, surprisingly, the present invention discloses that replacing uracil nucleotides in a microRNA oligonucleotide sequence with 5-halouracil demonstrates the ability of said microRNAs to inhibit cancer, pathogenesis, progression and tumorigenesis. was found to increase Moreover, the data herein indicate that contacting many types of cancer cells with the modified microRNA compositions of the present invention modulates cell-cycle progression, e.g., by decreasing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents, and It has been shown to reduce tumor formation. In addition, the modified microRNAs of the present invention maintain target specificity, can be delivered without the use of deleterious and ineffective delivery vehicles (e.g., nanoparticles), and enhance without abrogating the natural function of endogenous microRNAs. It has been shown to exhibit improved efficacy and safety. As such, the present invention provides various nucleic acid (eg, microRNA) compositions having 5-halouracil molecules incorporated within their nucleic acid sequences and methods for using them to treat cancer. The present invention also provides pharmaceutical compositions comprising formulations, such as modified nucleic acid compositions, and methods of treating cancer comprising administration of said pharmaceutical compositions to a subject in need thereof.

Nucleic Acid Composition

[0092] The term "microRNA" or "miRNA" or "miR" refers to a messenger RNA molecule (mRNA), a small non-coding ribose nucleic acid (RNA) molecule capable of regulating the expression of a gene through interaction with DNA or protein. are used interchangeably to refer to Typically, microRNAs consist of a nucleic acid sequence of about 19-25 nucleotides (bases) and are found in mammalian cells. Mature microRNA molecules are single-stranded RNA molecules that have been processed in double-stranded precursor transcripts to form local hairpin structures. The hairpin structure is usually cleaved by the Dicer enzyme to form a double-stranded microRNA duplex. See, for example, Bartel, Cell , (2004) 116 pp. 281-297]. As used herein, the term microRNA refers to duplexes (i.e. double-stranded miRs) and single-stranded miRs (i.e. mature miRs) of both complementary strands in the 5' to 3' direction and in the 3' to 5' direction. includes all In a specific embodiment, a modified miR of the invention consists of a single stranded mature MiR.

[0093] Typically, one of the two strands of a microRNA duplex is packaged in a microRNA ribonucleoprotein complex (microRNP). For example, human microRNPs also contain the proteins eIF2C2/Argonaut (Ago2), the helicases Gemin3 and Gemin 4. Other members of the Argonaute protein family, such as Ago1, 3 and 4, also bind microRNAs and form microRNPs.

[0094] The terms "modified microRNA", "modified miRNA", "modified miR" or "mimetic" refer to a microRNA that is different from a native or endogenous microRNA (unmodified microRNA) polynucleotide to be used interchangeably in the present invention. More specifically, in the present invention, the modified microRNA differs from the unaltered or unmodified microRNA nucleic acid sequence by one or more bases. In some embodiments of the invention, the modified microRNA of the invention comprises one or more uracil (U) nucleotide bases replaced with 5-halouracil. In another embodiment, the modified microRNA comprises one or more uracil bases substituted with additional nucleotides (i.e., adenine (A), cytosine (C), uracil (U) and guanine (G)) and 5-halouracil. do.

[0095] In one aspect of the invention, a modified microRNA nucleotide sequence having one or more uracil bases (U, U bases) replaced with 5-halouracil, such as 5-fluoro uracil (5-FU) Nucleic acid compositions comprising As further discussed herein, the nucleic acid compositions of the present invention are useful for the treatment of at least all cancers. In particular, it has been shown in the present invention that exemplary modified microRNAs of the present invention are effective in the treatment of colorectal cancer, pancreatic cancer, lung cancer, gastric cancer, blood cancer (eg, leukemia) and breast cancer.

[0096] In some embodiments, the nucleic acid composition contains a nucleotide sequence modified by derivatizing one or more uracil nucleobases with a group that provides an effect similar to a halogen atom at the 5-position. In some embodiments, the group providing a similar effect has a scale similar to that of a halogen atom in weight or spatial dimensions, such as no more than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g. /mol molecular weight or less. In certain embodiments, groups that provide a similar effect to a halogen atom include, for example, a methyl group, a trihalomethyl group (eg, a trifluoromethyl group), a pseudohalide (eg, trifluoromethanesulfonate, cyano or cyanate). ) or a deuterium (D) atom. A group that provides an effect similar to a halogen atom may be present in the absence or in addition to a 5-halouracil base in the microRNA nucleotide sequence.

[0097] Also, in another embodiment, a group that provides an effect similar to a halogen atom may be located in the native (or seed) portion and/or sub-portion of the microRNA nucleotide sequence, as is common in the art. It will be easily identified by those who have the knowledge of In some embodiments, one or more (or all) of the above types of groups that provide a halogen atom-like effect are excluded from the modified miRNA nucleotide sequence. When all these alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the microRNA nucleotide sequence.

[0098] In certain embodiments, the modified microRNA has one or more or exactly one uracil, replaced with 5-halouracil.

[0099] In some embodiments, the modified microRNA nucleotide sequence comprises 3, 4, 5, 6, 7, 8 or more uracil bases replaced with 5-halouracil.

[0100] In one embodiment, all uracil nucleotide bases of the modified mRNA have been replaced with 5-halouracil.

[0101] In some embodiments, 5-halouracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-halouracil is 5-fluorouracil.

[0102] As used herein, the term "miR-129" means synonymous with "microRNA-129" or "miRNA-129", and refers to an oligonucleotide having the following nucleotide sequence:

CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. One],

It is understood that where C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-129 sequence in the present invention, unless otherwise specified. In another embodiment, miR-129 is also referred to in the art as hsa-miR-129 having accession number MI0000252 for stem loop containing double stranded microRNAs; hsa-miR-129-5p for the mature miR 5' to 3' strand, given accession number MIMAT0000242; and hsa-miR-129-3p for the 3' to 5' complementary strand of duplex miR-129 shown in accession number MIMAT0004548. MiR-129 is well known and studied in detail. For example, [J. Wu et al., Cell Cycle , (2010) 9:9, 1809-1818]. As is well known in the art, the miR-129 sequence can be modified to create a "miR-129 mimic", which has a modified sequence from the native sequence but retains the known function or activity of the native miR-129. hold Unless otherwise stated, all such modified miR-129 compositions are considered to be within the scope of the term "miR-129 mimic" as used herein.

[0103] The specific modified miR-129 nucleic acid sequence (mimetic) of the subject nucleic acid sequence is the miR-129 native sequence, such as CUUUUUGCGGUCUGGGCUUGC-UU [SEQ ID NO. 3] contains two U bases (ie, two U-containing nucleotides) covalently appended to the ends. In this sequence, the two terminal U bases contiguous or extend the native miR-129 sequence from 21 nucleotide bases to 23 nucleotide bases. In general, the miR-129 mimic contains no more than 1, 2, 3, 4 or 5 additional bases (ie, as additional nucleotides) covalently appended to the miR-129 native sequence, wherein the additional A base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-129 is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0104] In one embodiment, the present invention relates to a nucleic acid composition comprising a miR-129 nucleotide sequence modified by replacing one or more of its uracil nucleobases (ie, U bases) with 5-halouracil. , ie wherein at least one of the U bases in the miR-129 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0105] According to the first set of embodiments, exactly one of the U bases in the miR-129 sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-129 nucleotide sequence are 5-halouracil. In a third set of embodiments, exactly 3 or 3 or more U bases in the miR-129 nucleotide sequence are 5-halouracil. In a fourth embodiment, exactly 4 or 4 or more U bases in the miR-129 nucleotide sequence are 5-halouracil. In a fifth embodiment, exactly 5 or 5 or more U bases in the miR-129 nucleotide sequence are 5-halouracil. In a sixth embodiment, all of the U bases of the miR-129 nucleotide sequence, whether in the native portion and/or in the appended portion, are 5-halouracil.

[0106] In a specific embodiment, the nucleic acid composition of the present invention comprises SEQ ID NO. has a modified microRNA nucleotide sequence of ^{CU F} U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC described as 4 ^{, wherein U F} is halouracil, specifically 5-fluorouracil.

[0107] The U bases replaced with 5-halouracil in the miR-129 sequence may be located in the unmodified portion of the miR-129 sequence, shown above, or in the case of miR-129 mimetics, also the As shown, it may be located at one or more U bases that are covalently appended to native miR-129. In another embodiment, GUUUUUGC, the seed portion of the native miR-129 nucleotide sequence, remains unmodified with 5-halouracil, while one of the remaining U bases in the remainder of the miR-129 nucleotide sequence. Any (or all) of these are replaced with an equal number of 5-halouracils.

[0108] For example, in certain embodiments, the nucleic acid composition of the present invention comprises SEQ ID NO. has a modified microRNA nucleotide sequence of ^{CUUUUUGCGGU F} CU ^F GGGCU ^F U ^F GC described as 5 ^{, whereby U F} is halouracil, specifically 5-fluorouracil.

[0109] In another embodiment, the nucleic acid composition contains a miR-129 nucleotide sequence modified by derivatizing one or more of the uracil (U) nucleobases at the 5-position with a group that provides a halogen atom-like effect. do. In some embodiments, the group providing a similar effect has a scale similar to that of a halogen atom in weight or spatial dimensions, such as no more than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g. /mol molecular weight or less. Such groups that provide an effect similar to that of a halogen atom include, for example, a methyl group, a trihalomethyl group (such as a trifluoromethyl group), a pseudohalide (such as trifluoromethanesulfonate, cyano or cyanate) or deuterium (D ) may be an atom. This group, which provides an effect similar to that of a halogen atom, may be present in the absence or in addition to a 5-halouracil base in the miR-129 nucleotide sequence. In addition, the group providing an effect similar to that of a halogen atom may be located in the native (or seed) portion and/or accessory portion of the miR-129 nucleotide sequence. In some embodiments, one or more (or all) of the types of groups that provide a halogen atom-like effect are excluded from the miR-129 nucleotide sequence. When all such alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the miR-129 nucleotide sequence.

[0110] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-15a nucleotide sequence. In some embodiments, the miR-15a nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0111] As used herein, the term "miR-15a" is synonymous with "microRNA-15a" or "miRNA-15a", and refers to an oligonucleotide having the following nucleotide sequence:

UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-15a sequence in the present invention, unless otherwise specified. In another embodiment, miR-15a is also referred to in the art as hsa-miR-15a having accession number MI0000069 for a stem loop containing double stranded microRNA; hsa-miR-15a-5p with accession number MI0000068 for mature miR 5' to 3'; and hsa-miR-15a-3p for the 3' to 5' complementary strand of the duplex miR-15a molecule, given accession number MIMAT0004488. MiR-15a is well known and studied in detail. For example, [Xie T, et al. Clin Transl Oncol . (2015) 17(7):504-10]; and [Acunzo M, and Croce CM, Clin . Chem . (2016) 62(4):655-6]. As described above for miR-129 mimetics, methods for generating miR-15a mimetics are known to those skilled in the art. Unless otherwise stated, all such modified miR-15a forms are considered in the present invention to be within the scope of the term "miR-15a mimic" as used herein.

[0112] In general, a modified miR-15a (ie miR-15a mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-15a native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-15a is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0113] In some embodiments, one or more of the U bases in the miR-15a sequence, either in its native portion and/or in its accessory portion, is 5-halouracil. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0114] According to the first set of embodiments, exactly one of the U bases in the miR-15a sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-15a sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-15a oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-15a sequence are 5-halouracil. In some embodiments, exactly 5 or 5 or more U bases in the miR-15a sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-15a sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-15a sequence, whether in native and/or appended portions, are 5-halouracil.

[0115] In one embodiment, the nucleic acid composition of the present invention comprises U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 6], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0116] The U bases replaced with 5-halouracil in the miR-15a sequence may be located in the unmodified portion of the miR-15a sequence, shown above, or in the case of miR-15a mimetics, also As shown, it may be located at one or more U bases that are covalently appended to native miR-15a.

[0117] In another embodiment, the seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with 5-halouracil, while the remaining U bases in the remainder of the miR-15a nucleotide sequence. one or more (or all) of these are replaced with 5-halouracil.

[0118] In a specific embodiment, the nucleic acid composition of the present invention comprises UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0119] In certain embodiments, the nucleic acid composition contains a miR-15a nucleotide sequence modified by derivatizing one or more of the uracil (U) nucleobases at the 5-position with a group that provides a halogen atom-like effect. do. In some embodiments, the group providing a similar effect has a scale similar to that of a halogen atom in weight or spatial dimensions, such as no more than 20, 30, 40, 50, 60, 70, 80, 90, or 80 g. /mol molecular weight or less. Such groups that provide an effect similar to that of a halogen atom include, for example, a methyl group, a trihalomethyl group (such as a trifluoromethyl group), a pseudohalide (such as trifluoromethanesulfonate, cyano or cyanate) or deuterium (D ) may be an atom. This group, which provides an effect similar to that of a halogen atom, may be present in the absence or in addition to a 5-halouracil base in the miR-15a nucleotide sequence. In addition, the group providing an effect similar to that of a halogen atom may be located in the native (or seed) portion and/or sub-portion of the miR-15a nucleotide sequence.

[0120] In some embodiments, one or more (or all) of the types of groups that provide an effect similar to a halogen atom are excluded from the miR-15a nucleotide sequence. When all these alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the miR-15a nucleotide sequence.

[0121] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the miR-140 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0122] As used herein, the term "miR-140" is synonymous with "microRNA-140" or "miRNA-140", and refers to an oligonucleotide having the following nucleotide sequence:

CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-140 sequence in the present invention, unless otherwise specified. In another embodiment, miR-140 is also hsa-miR-140 having accession number MI0000456 for stem loop containing double stranded microRNA; hsa-miR-140-5p for the mature miR 5' to 3' strand, given accession number MIMAT0000431 or NT 010498; and hsa-miR-129-3p with respect to the 3' to 5' complementary strand of the duplex miR-140 molecule shown in accession number MIMAT0004597. MiR-140 is well known and studied in detail. See, eg, Zhai, H. et al., Oncotarget . (2015) 6: 19735-46]. As described above for exemplary mimics miR-129 and miR-15a, methods for generating miR-140 mimetics are known to those skilled in the art. Unless otherwise stated, all such modified miR-140 forms are considered in the present invention to be within the scope of the term "miR-140 mimic" as used herein.

[0123] In general, a modified miR-140 nucleic acid (i.e., miR-140 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-140 native sequence. wherein the additional base is independently selected from C, U, G, and C, or the additional base can be exclusively U. Typically, the miR-140 mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0124] In some embodiments, one or more of the U bases in the miR-140 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0125] According to the first set of embodiments, exactly one of the U bases in the miR-140 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-140 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-140 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-140 sequence are 5-halouracil. In some embodiments, exactly 5 or 5 or more U bases in the miR-140 mimic sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-140 mimic sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-140 sequence, whether in native and/or appended portions, are 5-halouracil.

[0126] In one exemplary embodiment, the nucleic acid composition of the present invention is CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0127] In another embodiment, the nucleic acid composition of the present invention comprises

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 16], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0128] The U bases replaced with 5-halouracil in the miR-140 mimic sequence may be located in the unmodified portion of the miR-140 sequence, shown above, or, as shown above, the native miR- 140 may be located at one or more U bases covalently appended to the sequence.

[0129] In another embodiment, the seed portion of the native miR-140 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-140 nucleotide sequence. one or more (or all) is replaced with 5-halouracil.

[0130] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-192 nucleotide sequence. In some embodiments, the miR-192 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0131] As used herein, the term "miR-192" means synonymous with "microRNA-192", "miRNA-192", "microRNA-215", "miR215" or "miRNA-215", Refers to an oligonucleotide having the following nucleotide sequence:

CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-192 sequence in the present invention, unless otherwise specified. In some embodiments, miR-192 is, in the art, hsa-miR-192 or hsa-miR-215 having accession number MI0000234 or MI0000291 for stem loop containing double stranded microRNAs; Each accession number MIMAT0000222. and hsa-miR-192-5p or hsa-miR-215-5p for the mature miR 5' to 3' strand shown as MIMAT0000272; and hsa-miR-192-3p or hsa-miR-215-3p for the 3' to 5' complementary strands of the duplex molecule, respectively, shown with accession numbers MIMAT0004543 and MIMAT0026476. MiR-192 is well known and studied in detail. See, e.g., Song, B. et al., Clin. Cancer Res . (2008), 14: 8080-8086], and [Song, B. et al., Mol . Cancer . (2010), 9:96 pp. 1476-4598]. As described above for exemplary mimics miR-129, miR-140 and miR-15a, methods for generating miR-192 mimetics are known to those skilled in the art. Unless otherwise stated, all such modified miR-192 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-192 mimic" as used herein.

[0132] In general, a modified miR-192 (ie miR-192 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-192 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-192 mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0133] In some embodiments, one or more of the U bases in the miR-192 or miR-215 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0134] In another set of embodiments, exactly one of the U bases in the miR-192 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-192 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-192 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-192 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-192 sequence, whether in native and/or appended portions, are 5-halouracil.

[0135] In one exemplary embodiment, the nucleic acid composition of the present invention comprises CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0136] The U bases replaced with 5-halouracil in the miR-192 mimetic sequence may be located in the unmodified portion of the miR-192 sequence, shown above, or, as shown above, the native miR- 192 may be located at one or more U bases covalently appended to the sequence.

[0137] In another embodiment, the seed portion of the native miR-192 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-192 nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0138] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-502 nucleotide sequence. In some embodiments, the miR-502 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0139] As used herein, the term "miR-502" means synonymous with "microRNA-502" or "miRNA-502", and refers to an oligonucleotide having the following nucleotide sequence:

AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-502 sequence in the present invention, unless otherwise specified. In another embodiment, miR-502 is also referred to in the art as hsa-miR-502 having accession number MI0003186 for stem loop containing double stranded microRNA; hsa-miR-502-5p for the mature miR 5' to 3' strand shown as accession number MIMAT0002873; and hsa-miR-502-3p for the 3' to 5' complementary strand of the duplex miR-502 molecule given accession number MIMAT0004775. MiR-502 is well known and studied in detail. See, eg, Zhai, H, et al., Oncogene . (2013), 32:12 pp. 1570-1579]. As described above for exemplary mimics miR-129, miR-140, miR-192 and miR-15a, methods for generating miR-502 mimetics are known to those skilled in the art. Unless otherwise stated, all such modified miR-502 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-502 mimic" as used herein.

[0140] In general, a modified miR-502 (ie miR-502 mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-502 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-502 mimic is used in single-stranded form, although double-stranded versions are also contemplated in the present invention.

[0141] In some embodiments, one or more of the U bases in the miR-502 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0142] In another set of embodiments, exactly one of the U bases in the miR-502 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-502 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-502 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-502 sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-502 sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-502 sequence are 5-halouracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-502 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-502 sequence, whether in native and/or appended portions, are 5-halouracil.

[0143] In one exemplary embodiment, the nucleic acid composition of the present invention comprises AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0144] The U bases replaced by 5-halouracil in the miR-502 mimetic sequence may be located in the unmodified portion of the miR-502 sequence, shown above, or, as shown above, the native miR -502 may be located at one or more U bases covalently appended to the sequence.

[0145] In another embodiment, the seed portion of the native miR-502 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-502 nucleotide sequence. One or more (or all) is replaced by 5-halouracil or a combination thereof.

[0146] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence. In some embodiments, the miR-506 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0147] As used herein, the term "miR-506" means synonymous with "microRNA-506" or "miRNA-506", and refers to an oligonucleotide having the following nucleotide sequence:

UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-506 sequence in the present invention, unless otherwise specified. In another embodiment, miR-506 is also hsa-miR-506 having accession number MI0003193 for stem loop containing double stranded microRNA; hsa-miR-506-5p for the mature miR 5' to 3' strand shown as accession number MIMAT0022701; and hsa-miR-506-3p for the 3' to 5' complementary strand of the duplex miR-506 molecule shown in accession number MIMAT0002878. MiR-506 is well known and studied in detail. See, e.g., Li, J, et al., Oncotarget . (2016), 7:38 pp. 62778-62788], and [Li, J. et al., Oncogene. (2016) 35 pp. 5501-5514]. As described above for exemplary mimics miR-129, miR-140, miR-502, miR-192 and miR-15a, methods for generating miR-506 mimetics are known to those skilled in the art. will be. Unless otherwise stated, all such modified miR-506 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-506 mimic" as used herein.

[0148] In general, a modified miR-506 (i.e., miR-506 mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-506 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-506 mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0149] In some embodiments, one or more of the U bases in the miR-506 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0150] In another set of embodiments, exactly one of the U bases in the miR-506 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-506 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-506 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-506 sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-506 sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-506 sequence are 5-halouracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-506 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-506 sequence, whether in native and/or appended portions, are 5-halouracil.

[0151] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0152] The U bases replaced with 5-halouracil in the miR-506 mimic sequence may be located in the unmodified portion of the miR-506 sequence, as shown above, or, as shown above, the native miR- 506 may be located at one or more U bases covalently appended to the sequence.

[0153] In another embodiment, the seed portion of the native miR-506 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-506 nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0154] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-34 nucleotide sequence. In some embodiments, the miR-34 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0155] As used herein, the term "miR-34" is synonymous with "microRNA-34", "miR-34a" or "miRNA-34", and refers to an oligonucleotide having the following nucleotide sequence:

UGGCAGUGUCUUAGCUGGUUGU [SEQ ID NO. 17].

The nucleotide sequence refers to an unmodified (ie, “native”) miR-34 sequence in the present invention, unless otherwise specified. In another embodiment, miR-34 is also referred to in the art as hsa-miR-34 having accession number MI0000268 for a stem loop containing double stranded microRNA; hsa-miR-34a-5p for the mature miR 5' to 3' strand given accession number MIMAT0000255; and hsa-miR-34a-3p with respect to the 3' to 5' complementary strand of the duplex miR-129 molecule shown with accession number MIMAT0004557. MiR-34 is well known and has been studied in detail. See, eg, Lui, WO, et al., Cancer Res. 67 pp. 6031-6043 (2007)]. As described above for exemplary mimics miR-129, miR-140, miR-502, miR-506 miR-192 and miR-15a, methods for generating modified miR-34 polynucleotides are those of skill in the art. known to those skilled in the art. Unless otherwise stated, all such modified miR-34 nucleic acid forms are considered herein to be within the scope of the terms "miR-34 mimic" or "modified miR-34" as used herein.

[0156] In general, a modified miR-34 (ie miR-34 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-34 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-34 mimic is used in single-stranded form, although double-stranded versions are also contemplated in the present invention.

[0157] In some embodiments, one or more of the U bases in the miR-34 sequence, either in its native portion and/or in its accessory portion, is 5-halouracil. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0158] In another set of embodiments, exactly one of the U bases in the miR-34 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-34 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-34 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-34 sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-34 sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-34 sequence are 5-halouracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-34 sequence are 5-halouracil. In yet another embodiment, exactly 8 or more than 8 U bases in the miR-34 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-34 sequence, whether in native and/or appended portions, are 5-halouracil.

[0159] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F GGCAGU ^F GU ^F CU ^F U ^F AGCU ^F GGU ^F U ^F GU ^F [SEQ ID NO. 18], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0160] The U bases replaced with 5-halouracil in the modified miR-34 sequence may be located in the unmodified portion of the miR-34 sequence, shown above, or, as shown above, the native miR- 34 may be located at one or more U bases covalently appended to the sequence.

[0161] In another embodiment, the seed portion of the native miR-34 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-34 nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0162] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-200a nucleotide sequence. In some embodiments, the miR-200a nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0163] As used herein, the term "miR-200a" is synonymous with "microRNA-200a" or "miRNA-200a", and refers to an oligonucleotide having the following nucleotide sequence:

UAACACUGUCUGGUAACGAUGU [SEQ ID NO. 19]. The nucleotide sequence refers to an unmodified (ie, “native”) miR-200a sequence in the present invention, unless otherwise specified. In another embodiment, miR-200a is also hsa-miR-200a having accession number MI0000737 for stem loop containing double stranded microRNA; hsa-miR-200a-5p for the mature miR 5' to 3' strand, given accession number MIMAT0001620; and hsa-miR-200a-3p with respect to the 3' to 5' complementary strand of the duplex miR-200a molecule represented by accession number MIMAT000682. MiR-200a is well known and studied in detail. See, eg, Lagos-Quintana M, et al., RNA . 9: pp. 175-179 (2003)]. As described above, methods for generating modified miR-200a polynucleotides are known to those skilled in the art. Unless otherwise stated, all such modified miR-200a nucleic acid forms are considered in the present invention to be within the scope of the terms "miR-200a mimic" or "modified miR 200a" as used herein.

[0164] In general, a modified miR-200a (ie miR-200a mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-200a native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-200a mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0165] In some embodiments, one or more of the U bases in the miR-200a sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0166] In another embodiment, exactly one of the U bases in the miR-200a mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-200a sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-200a oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-200a sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-200a sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-200a sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-200a sequence, whether in native and/or appended portions, are 5-halouracil.

[0167] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0168] The U bases replaced with 5-halouracil in the modified miR-200a sequence may be located in the unmodified portion of the miR-200a sequence, shown above, or, as shown above, the native miR- It may be located at one or more U bases covalently appended to the 200a sequence.

[0169] In another embodiment, the seed portion of the native miR-200a nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-200a nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0170] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-200b nucleotide sequence. In some embodiments, the miR-200b nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0171] As used herein, the term "miR-200b" is synonymous with "microRNA-200b" or "miRNA-200b", and refers to an oligonucleotide having the following nucleotide sequence:

UAAUACUGCCUGGUAAUGAUGA [SEQ ID NO. 21]. The nucleotide sequence refers to an unmodified (ie, “native”) miR-200b sequence in the present invention, unless otherwise specified. In another embodiment, miR-200b is also hsa-miR-200b having accession number MI0000342 for stem loop containing double stranded microRNA; hsa-miR-200b-5p for the mature miR 5' to 3' strand, given accession number MIMAT00004571; and hsa-miR-200b-3p with respect to the 3' to 5' complementary strand of the duplex miR-200b molecule shown with accession number MIMAT0000318. MiR-200b is well known and studied in detail. See, e.g., Altuvia Y, et al., Nucleic Acids Res . 33 pp. 2697-2706 (2005)]. As above, methods for generating modified miR-200b polynucleotides are known to those skilled in the art. Unless otherwise stated, all such modified miR-200b nucleic acid forms are considered in the present invention to be within the scope of the terms "miR-200b mimic" or "modified miR-200b" as used herein.

[0172] In general, a modified miR-200b (ie, miR-200b mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-200b native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-200b mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0173] In some embodiments, one or more of the U bases in the miR-200b sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0174] In another embodiment, exactly one of the U bases in the miR-200b mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-200b sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-200b oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-200b sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-200b sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-200b sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-200b sequence, whether in native and/or appended portions, are 5-halouracil.

[0175] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0176] The U bases replaced with 5-halouracil in the modified miR-200b sequence may be located in the unmodified portion of the miR-200b sequence, shown above, or, as shown above, the native miR- It may be located at one or more U bases that are covalently appended to the 200b sequence.

[0177] In another embodiment, the seed portion of the native miR-200b nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-200b nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0178] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-200c nucleotide sequence. In some embodiments, the miR-200c nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0179] As used herein, the term "miR-200c" means synonymous with "microRNA-200c" or "miRNA-200c", and refers to an oligonucleotide having the following nucleotide sequence:

UAAUACUGCCGGGUAAUGAUGGA [SEQ ID NO. 23]. The nucleotide sequence refers to the unmodified (ie, “native”) miR-200c sequence in the present invention, unless otherwise specified. In another embodiment, miR-200c is also hsa-miR-200c with accession number MI0000650 for stem loop containing double stranded microRNA; hsa-miR-200c-5p for the mature miR 5' to 3' strand given accession number MIMAT00004657; and hsa-miR-200c-3p for the 3' to 5' complementary strand of the duplex miR-200c molecule shown with accession number MIMAT0000617. MiR-200c is well known and studied in detail. See, eg, Landgraf P, et al., Cell . 129 pp. 1401-1414 (2007)]. As described above, methods for generating modified miR-200c polynucleotides are known to those skilled in the art. Unless otherwise stated, all such modified miR-200c nucleic acid forms are considered in the present invention to be within the scope of the terms "miR-200c mimic" or "modified miR-200c" as used herein.

[0180] In general, a modified miR-200c (i.e., miR-200c mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-200c native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-200c mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0181] In some embodiments, one or more of the U bases in the miR-200c sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0182] In another embodiment, exactly one of the U bases in the miR-200c mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-200c sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-200c oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-200c sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-200c sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-200c sequence, whether in native and/or appended portions, are 5-halouracil.

[0183] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0184] The U bases replaced with 5-halouracil in the modified miR-200c sequence may be located in the unmodified portion of the miR-200c sequence, shown above, or, as shown above, the native miR- It may be located at one or more U bases covalently appended to the 200c sequence.

[0185] In another embodiment, the seed portion of the native miR-200c nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-200c nucleotide sequence. One or more (or all) is replaced with 5-halouracil or a combination thereof.

[0186] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-145 nucleotide sequence. In some embodiments, the miR-145 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0187] As used herein, the term "miR-145" means synonymous with "microRNA-145" or "miRNA-145", and refers to an oligonucleotide having the following nucleotide sequence:

GUCCAGUUUUCCCAGGAAUCCCU [SEQ ID NO. 25],

It is understood where A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to an unmodified (ie, “native”) miR-145 sequence in the present invention, unless otherwise specified. In some embodiments, miR-145 is hsa-miR-145 having accession number MI0000461 for stem loop containing double stranded microRNAs; hsa-miR-145-5p for the mature miR 5' to 3' strand, given accession number MIMAT0000437; and hsa-miR-145-3p with respect to the 3' to 5' complementary strand of the duplex miR-145 molecule shown with accession number MIMAT0004601. MiR-145 is well known and has been studied in detail. See, eg, Landgraf P, et al., Cell . 129 pp. 1401-1414 (2007)]. As described above for exemplary mimics miR-129, miR-140, miR-192, 200a, 200b, 200c, miR-34 and miR-15a, methods for generating miR-145 mimetics are those of skill in the art. It is known to the skilled person. Unless otherwise stated, all such modified miR-145 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-145 mimic" as used herein.

[0188] In general, a modified miR-145 (ie, miR-145 mimetic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-145 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-145 mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0189] In some embodiments, one or more of the U bases in the miR-145 sequence, either in its native portion and/or in its accessory portion, is 5-halouracil. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0190] In another set of embodiments, exactly one of the U bases in the miR-145 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-145 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-145 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-145 sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-145 sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-145 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-145 sequence, whether in native and/or appended portions, are 5-halouracil.

[0191] In one exemplary embodiment, the nucleic acid composition of the present invention comprises GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0192] The U bases replaced by 5-halouracil in the miR-145 mimic sequence may be located in the unmodified portion of the miR-145 sequence, shown above, or, as shown above, the native miR -145 may be located at one or more U bases covalently appended to the sequence.

[0193] In another embodiment, the seed portion of the native miR-145 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-145 nucleotide sequence. One or more (or all) is replaced by 5-halouracil or a combination thereof.

[0194] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-194 nucleotide sequence. In some embodiments, the miR-194 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0195] As used herein, the term "miR-194" is synonymous with "microRNA-194" or "miRNA-194", and refers to an oligonucleotide having the following nucleotide sequence:

UGUAACAGCAACUCCAUGUGGA [SEQ ID NO. 27]. The nucleotide sequence refers to the unmodified (ie, “native”) miR-194 sequence in the present invention, unless otherwise specified. In some embodiments, miR-194 is identified in the art as hsa-miR-194 having accession number MI0000488 or MI0000732 for stem loop containing double stranded microRNAs; hsa-miR-194-5p for the mature miR 5' to 3' strand given accession number MIMAT0000460; and hsa-miR-194-3p for the 3' to 5' complementary strand of the duplex molecule shown in accession number MIMAT0004671. MiR-194 is well known and studied in detail. See, eg, Lagos-Quintana M, et al., RNA . 9: pp. 175-179 (2003)]. As in the case of the modified microRNAs above, methods for generating miR-194 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-194 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-194 mimic" as used herein.

[0196] In general, a modified miR-194 (ie miR-194 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-194 native sequence. and the additional base may be independently selected from C, U, G, and C, or the additional base may be exclusively U. Typically, the miR-194 mimic is used in single-stranded form, although double-stranded versions are also contemplated in the present invention.

[0197] In some embodiments, one or more of the U bases in the miR-194 sequence, either in its native portion and/or in its accessory portion, is 5-halouracil. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0198] In another set of embodiments, exactly one of the U bases in the miR-194 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-194 sequence are 5-halouracil. In another set of embodiments, exactly 3 or 3 or more U bases in the miR-194 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-194 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-506 sequence, whether in native and/or appended portions, are 5-halouracil.

[0199] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0200] The U bases replaced by 5-halouracil in the miR-194 mimic sequence may be located in the unmodified portion of the miR-194 sequence, shown above, or, as shown above, the native miR -194 may be located at one or more U bases covalently appended to the sequence.

[0201] In another embodiment, the seed portion of the native miR-194 nucleotide sequence remains unmodified with 5-halouracil, while among the remaining U bases in the remainder of the miR-194 nucleotide sequence. One or more (or all) is replaced by 5-halouracil or a combination thereof.

[0202] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-let-7 nucleotide sequence. In some embodiments, the miR-let-7 nucleotide sequence has been modified by replacing one or more of the U bases with 5-halouracil.

[0203] As used herein, the term "miR-let-7" is synonymous with "microRNA-let-7" or "miRNA-let-7", and refers to an oligonucleotide having the following nucleotide sequence:

UGAGUAGUAGGUUGUAUAGUU [SEQ ID NO. 29]. The nucleotide sequence refers to an unmodified (ie, “native”) miR-let-7 sequence in the present invention, unless otherwise specified. In another embodiment, miR-let-7 is also referred to in the art as hsa-miR-let-7a-1 having accession number MI0000060 for stem loop containing double stranded microRNAs; hsa-miR-let-7a-5p for the mature miR 5' to 3' strand given accession number MIMAT00000062; and hsa-miR-let-7a-3p with respect to the 3' to 5' complementary strand of the duplex miR-129 molecule shown in accession number MIMAT0004481. MiR-let-7 is well known and studied in detail. See, eg, Kasashima K, et al., Biochem Biophys Res Commun. 322 pp. 403-410 (2004)]. As described above for the exemplary modified microRNAs described herein, methods for generating miR-let-7 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-let-7 nucleic acid forms are considered in the present invention to be within the scope of the term "miR-let-7 mimic" as used herein.

[0204] In general, the modified miR-let-7 (ie, miR-let-7 mimic) contains 1, 2, 3, 4 or 5 covalently appended to the miR-let-7 native sequence. contains the following additional bases, wherein the additional bases are independently selected from C, U, G, and C, or the additional bases can be exclusively U. Typically, the miR-let-7 mimic is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0205] In some embodiments, one or more of the U bases in the miR-let-7 sequence is 5-halouracil, either in its native portion and/or in its accessory portion. The 5-halouracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0206] In another set of embodiments, exactly one of the U bases in the miR-let-7 mimic sequence is 5-halouracil. In a second set of embodiments, exactly two or more than two U bases in the miR-let-7 sequence are 5-halouracil. In another set of embodiments, exactly three or more than three U bases in the miR-let-7 oligonucleotide sequence are 5-halouracil. In another embodiment, exactly 4 or 4 or more U bases in the miR-let-7 sequence are 5-halouracil. In another embodiment, exactly 5 or 5 or more U bases in the miR-let-7 sequence are 5-halouracil. In another embodiment, exactly 6 or 6 or more U bases in the miR-let-7 sequence are 5-halouracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-let-7 sequence are 5-halouracil. In a specific embodiment, all of the U bases of the miR-let-7 sequence, whether in native and/or appended portions, are 5-halouracil.

[0207] In one exemplary embodiment, the nucleic acid composition of the present invention comprises U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0208] The U bases replaced by 5-halouracil in the miR-let-7 mimic sequence may be located in the unmodified portion of the miR-let-7 sequence, as shown above, or as shown above , one or more U bases covalently appended to the native miR-let-7 sequence.

[0209] In another embodiment, the seed portion of the native miR-let-7 nucleotide sequence remains unmodified with 5-halouracil, while remaining in the remainder of the miR-let-7 nucleotide sequence. One or more (or all) of the U bases are replaced by 5-halouracil or a combination thereof.

[0210] The modified microRNA nucleic acid compositions described herein can be synthesized using any known method for synthesizing nucleic acids. In certain embodiments, the nucleic acid composition is prepared by any well-known process using automated oligonucleotide synthesis, such as phosphoramidite chemistry. modified miR sequences (eg, miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence, miR-34 sequence, miR-200a sequence, miR-200b sequence, miR-200c sequence) To introduce one or more 5-halouracil bases into the sequence, miR-145 sequence, miR-194 sequence, or miR-let-7 sequence), the 5-halouracil nucleoside phosphoramidite is , A, U, G and C), together with phosphoramidite derivatives of nucleosides, may be included as precursor bases to be included in the nucleic acid sequence.

[0211] In some embodiments, the nucleic acid composition of the present invention is biosynthetically used, such as using in vitro RNA transcription from a plasmid, PCR fragment or synthetic DNA template, or recombinant (in vivo) RNA expression It can be prepared by using the method. See, eg, CM Dunham et al., Nature Methods , (2007) 4(7), pp. 547-548]. The modified microRNA sequence of the present invention (eg, miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence, miR-34 sequence, miR-200a sequence, miR-200b sequence) sequence, miR-200c sequence, miR-145 sequence, miR-194 sequence, or miR-let-7 nucleotide sequence) can be prepared by techniques well known in the art, such as polyethylene glycol (PEG) or hydrocarbons or targeting agents. , in particular can be further chemically modified by functionalization with cancer cell targeting agents such as folic acid. To include these groups, a reactive group (eg, an amino, aldehyde, thiol or carboxylate group) that can be used to attach a desired functional group may first be included in the oligonucleotide sequence. Such reactive or functional groups can be incorporated on the as-produced nucleic acid sequence, but reactive or functional groups are non-nucleoside phosphoramidite or reactive groups containing reactive groups. Precursor groups can be incorporated more easily by using automated oligonucleotide synthesis.

Modified Nucleic Acid Formulations

[0212] The present invention shows that each of the modified microRNAs exhibits potent efficacy as an anticancer therapeutic agent. In particular, each modified microRNA nucleic acid composition tested reduces cancer cell proliferation, tumor growth and development in a dose dependent manner by inducing cell-cycle arrest in all six cancer types tested.

[0213] In another aspect, the present invention also relates to formulations of the modified microRNA nucleic acid compositions described herein. For example, a nucleic acid composition of the present invention may be formulated for pharmaceutical use. In certain embodiments, the formulation is a pharmaceutical composition containing the nucleic acid composition described herein and a pharmaceutically acceptable carrier. In another embodiment, the agent of the present invention comprises a modified miR-129 nucleic acid, a modified miR-15a nucleic acid, a modified miR-140 nucleic acid, a modified miR-192 nucleic acid, a modified miR-502, a modified miR-506 nucleic acid, modified miR-34 nucleic acid, modified miR-200a nucleic acid, modified miR-200b, modified miR-200c nucleic acid, modified miR-194 nucleic acid, modified miR-let-7 nucleic acid, or combinations thereof, and pharmaceutically acceptable carriers.

[0214] More specifically, one or more modified microRNA nucleic acids described by the following nucleotide sequences may be formulated for pharmaceutical utilization and use;

CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],

CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],

U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6],

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7],

CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],

CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],

AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13],

U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15],

CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16],

UFGGCAGUFGUFCUFUFAGCUFGGUFUFGUF [SEQ ID NO. 18],

U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20],

U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22],

U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24],

GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26],

U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28],

U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30].

[0215] The term "pharmaceutically acceptable carrier" is used synonymously herein with a pharmaceutically acceptable diluent, vehicle or excipient. Depending on the type of pharmaceutical composition and the intended mode of administration, the nucleic acid composition may be dissolved or suspended in the pharmaceutically acceptable carrier (eg, as an emulsion). A pharmaceutically acceptable carrier may be, within the scope of sound medical judgment, a liquid or solid compound, material, composition and/or dosage form suitable for use in contact with a tissue of a subject. A carrier must be "acceptable" in the sense of not being deleterious to the subject to which it is provided and must be compatible with the other ingredients of the formulation, ie, do not alter its biological or chemical function.

[0216] Some, non-limiting examples of substances that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as ethylene glycol and propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffer solution; and other non-toxic commercial substances used in pharmaceutical formulations. Pharmaceutically acceptable carriers may also include manufacturing aids (eg, lubricants, magnesium talc, calcium or zinc stearate or stearic acid), solvents, or encapsulating materials. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. Other suitable excipients are found in standard pharmaceutical texts, such as in "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19 ^th Ed. Mack Publishing Company, Easton, Pa., (1995)].

[0217] In some embodiments, the pharmaceutically acceptable carrier may include a diluent that increases the volume of the solid pharmaceutical composition and makes the pharmaceutical dosage form easier for patients and caregivers to handle. Diluents for solid compositions include, for example, microcrystalline cellulose (eg Avicel ^® ), microfine cellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, saccharides, dextrates, Dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylate (such as Eudragit ^® ), potassium chloride, powdered cellulose, sodium chloride , sorbitol and talc.

[0218] The nucleic acid compositions of the present invention can be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated composition may be specially formulated for administration in solid or liquid form, including those adapted for administration: (1) oral administration, such as tablets, capsules, powders, granules , pastes, aqueous or non-aqueous solutions or suspensions, drenches or syrups for application to the tongue; (2) parenteral administration, such as by subcutaneous, intramuscular or intravenous injection as a sterile solution or suspension; (3) topical application, such as topical application as a cream, ointment or spray applied to the skin, lungs or mucous membranes; or (4) administered intravaginally or rectally, eg, as a pessary, cream or foam; (5) sublingual or buccal administration; (6) ophthalmic administration; (7) transdermal administration; or (8) nasal administration.

[0219] In some embodiments, the dosage form of the present invention comprises a solid pharmaceutical preparation compressed into a dosage form such as a tablet, the function of which is to help bind the active ingredient and other excipients together after compression. may include. Binders for solid pharmaceutical compositions include acacia, alginic acid, carbomer (such as carbopol), carboxymethylcellulose sodium, dextrin, ethyl cellulose, gelatin, guar gum, hydrogenated vegetable oil, hydroxyethyl cellulose, hydroxypropyl cellulose ( For example, Klucel ^® ), hydroxypropyl methyl cellulose (eg Methocel ^® ), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylate, povidone (Kollidon ^® , Plasdone ^® ), pregelatinized starch, sodium alginate and starch.

[0220] The dissolution rate of a compressed solid pharmaceutical composition in the stomach of a subject can be increased by adding a disintegrant to the composition. Disintegrants include alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (eg Ac-Di-Sol ^® , Primellose ^® ), colloidal silicon dioxide, croscarmellose sodium, crospovidone (eg Kollidon ^® , Polyplasdone ^{® )} ), guar gum, magnesium aluminum silicate, methyl cellulose, microcrystalline cellulose, polacrylline potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (such as Explotab ^® ) and starch.

[0221] Therefore, in certain embodiments, a glidant may be added to the formulation to improve the flowability of the non-compressible solid formulation and to improve the accuracy of administration. Excipients that can function as lubricants include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc and tribasic calcium phosphate.

[0222] When a dosage form such as a tablet is prepared by compression of a powder composition, the composition is subjected to pressure from a punch and a dye. Some excipients and active ingredients have a tendency to adhere to the surface of the punch and dye, which can lead to pitting or other surface inhomogeneities in the product. Lubricants can be added to the composition to reduce adhesion and facilitate release of the product from the dye. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, glyceryl palmitostearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl puma. lactate, stearic acid, talc and zinc stearate.

[0223] A pharmaceutical composition formulated for tableting or capsule filling may be prepared by wet granulation. In wet granulation, some or all of the active ingredient and excipients in powder form are blended and then further mixed in the presence of a liquid, usually water, which causes the powder to agglomerate into granules. The granules are screened and/or milled, dried and then screened and/or milled to the desired particle size. The granules may then be tableted or other excipients such as glidants and/or lubricants may be added prior to tableting. Tableting compositions can be prepared conventionally by dry blending. For example, the combined composition of active ingredient and excipient may be compressed into slugs or sheets and then ground into compacted granules.

[0224] In another embodiment, as an alternative to dry granulation, the formulated composition can be directly compressed into a compressed dosage form using direct compression techniques. Direct compression produces more uniform tablets without granules. Excipients that are particularly well suited for direct compression tableting include microcrystalline cellulose, spray dried lactose, dicalcium phosphate dihydrate and colloidal silica. For direct compression tableting, the appropriate use of these and other excipients is known to those skilled in the art with experience and skill in formulating trials specifically for direct compression tableting. Capsule fillings may include any of the aforementioned formulations and granules described for tableting; They do not undergo a final tableting step.

[0225] In the liquid pharmaceutical composition of the present invention, the medicament and any other solid excipients are dissolved or suspended in a liquid carrier such as water, distilled water for injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol or glycerin. The liquid pharmaceutical composition may contain an emulsifier for uniformly dispersing the active ingredient or other excipient insoluble in the liquid carrier throughout the composition. The liquid formulation can be used as an injectable, enteric or emollient type formulation. Emulsifiers that may be useful in the liquid compositions of the present invention include, for example, gelatin, egg yolk, casein, cholesterol, acacia, tragacanth, chondrus, pectin, methyl cellulose, carbomer, cetostearyl alcohol and cetyl. alcohol may be mentioned.

[0226] In some embodiments, the liquid pharmaceutical composition of the present invention may also contain a viscosity enhancing agent to improve the mouthfeel of the product and/or to coat the gastrointestinal tract lining. These agents include acacia, bentonite alginate, carbomer, carboxymethylcellulose calcium or sodium, cetostearyl alcohol, methyl cellulose, ethylcellulose, gelatin guar gum, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, malto dextrin, polyvinyl alcohol, povidone, propylene carbonate, propylene glycol alginate, sodium alginate, sodium starch glycolate, starch tragacanth and xanthan gum. In another embodiment, the liquid composition of the present invention may also contain a buffer, such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate or sodium acetate.

[0227] Sweetening agents such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol and invert sugar can be added to certain formulations of the present invention to improve taste. Flavoring agents and flavor enhancers can make the dosage form more palatable to the patient. Typical flavoring agents and flavor enhancers of pharmaceutical products that may be included in the compositions of the present invention include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol and tartaric acid.

[0228] Preservatives and chelating agents such as alcohol, sodium benzoate, butylated hydroxy toluene, butylated hydroxyanisole and ethylenediamine tetraacetic acid can be added at levels safe for ingestion to improve storage stability. Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and/or to facilitate patient identification for product and dosage level.

[0229] The dosage form of the present invention may be a capsule containing the above composition, such as a powdered or granulated solid composition of the present invention, in a hard or soft shell. The shell may be made of gelatin and may optionally contain plasticizers such as glycerin and sorbitol, and opacifying agents or coloring agents.

How to treat cancer

[0230] As described above, the modified microRNA nucleic acid composition of the present invention and formulations thereof have an activity exhibited by exogenous expression of the corresponding unmodified native microRNA and/or known cancer therapy (chemotherapy), such as 5 -Shows unexpected and exceptional anticancer activity when compared to FU. Therefore, another aspect of the present invention provides a method of treating cancer in a mammal by administering to the mammal an effective amount of one or more of the modified microRNA nucleic acid composition of the present invention or a formulation thereof.

[0231] As shown in Figures 2A and 8A, exemplary modified microRNA nucleic acids of the present invention, i.e., modified miR-15a and modified MiR-129, inhibit BCL2 expression and activity in cancer cells of a subject. , which ultimately results in increasing the amount of available pro-apoptotic proteins that increase cancer cell death. miR-129 regulates apoptosis by, for example, directly targeting BCL2 and influencing other important apoptosis-related proteins. In addition, FIG. 2a shows that miR-129 reduces the expression of E2F3, a transcription factor protein that regulates cell cycle progression and reduces the expression or activity of the protein level of thymidylic acid synthase (TS), thus reducing its activity It has been shown that this results in increased cell proliferation and increased efficacy of chemotherapeutic agents.

[0232] Also, and as shown in Figures 12A-12D, 13A-13B and 14A-14, all exemplary modified microRNAs regulate cancer cell proliferation and induce cancer cell apoptosis. More specifically, the modified miR-15a was used in the following experimental models, pancreatic cancer cells ( FIGS. 12A-12B and 14A ), lung cancer ( FIGS. 12D and 14D ), colorectal cancer ( FIG. 8B ), gastric cancer ( FIG. 14B ), and breast cancer ( FIG. 14C ). ) and hematologic cancers, i.e., leukemia (Fig. 14e). In addition, the modified miR-129 was used in the following experimental models, pancreatic cancer cells (FIG. 14A), lung cancer (FIGS. 12C and 14D), colorectal cancer (FIG. 3), gastric cancer (FIG. 14B), breast cancer (FIG. 14c) and blood cancer, i.e. , have been shown to decrease cancer cell proliferation throughout leukemia (Fig. 14e). Modified miR-192 and modified miR-140 were also used in the following experimental models, pancreatic cancer cells (Fig. 14a), lung cancer (Fig. 14d), colorectal cancer (Fig. 13a-13b), gastric cancer (Fig. 14b), breast cancer (Fig. 14c). and the ability to reduce cancer cell proliferation across hematologic malignancies, ie, leukemia ( FIG. 14E ). Moreover, each of the modified microRNAs of the present invention (i.e., modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR- 200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7) inhibit cancer cell proliferation in all of the following experimental cancer models: pancreatic cancer (FIG. 14A), gastric cancer (FIG. 14B) , breast cancer ( FIG. 14C ), lung cancer ( FIG. 14D ) and hematologic cancer ( FIG. 14E ).

[0233] In addition, the modified miR compositions of the present invention were tested and found to be therapeutically effective in vivo. For example, FIGS. 7 and 11 show that intravenous treatment with two exemplary modified microRNAs of the present invention (eg, modified miR-129 and modified miR-15a) inhibits tumor growth and development in vivo, thereby showing cancer cancer. (e.g., colon cancer) has been shown to be effectively treated.

[0234] Therefore, the methods of treating cancer disclosed above may include one or more modified nucleic acid compositions of the invention (eg, modified miR-129 nucleic acid, modified miR-15a nucleic acid, modified miR-140 nucleic acid, modified miR- 192 nucleic acid, modified miR-502, modified miR-506 nucleic acid, modified miR-34 nucleic acid, modified miR200a nucleic acid, modified miR-200b nucleic acid, modified miR-200c nucleic acid, modified miR-145 nucleic acid, modified miR-194 nucleic acid, modified miR-let-7 nucleic acid, or a combination thereof) to the subject. In certain embodiments, the nucleic acid composition may be administered as a formulation comprising the nucleic acid composition and one or more pharmaceutical carriers.

[0235] In certain embodiments, a nucleic acid composition of the invention may be administered (ie, naked) in the absence of a delivery vehicle or pharmaceutical carrier. See, eg, FIGS. 17A-17B.

[0236] As used herein, the term "subject" refers to any mammal. Although the methods of the present invention generally relate to humans, the mammal may be any mammal. As used herein, the phrase "subject in need thereof" is encompassed by the term subject, in particular any mammal in need of treatment that is cancer or whose increased risk of cancerous or precancerous disease has been medically determined. say the object. In certain embodiments, the subject comprises a human cancer patient.

[0237] In some embodiments, the human subject is suffering from or at an increased risk of having a medically determined colorectal cancer.

[0238] In another embodiment, the subject is afflicted with pancreatic cancer or has an increased risk of having a medically determined pancreatic cancer, such as diagnosed with chronic pancreatitis.

[0239] In certain embodiments, the subject of the invention is suffering from or at an increased risk of developing a medically determined breast cancer. In certain embodiments, the breast cancer is triple negative breast cancer, ductal carcinoma or lobal carcinoma.

[0240] In some embodiments, the subject is suffering from or at an increased risk of developing a medically determined hematologic cancer. In certain embodiments, the hematologic cancer is leukemia. In one embodiment, the leukemia is acute lymphocytic leukemia.

[0241] In another embodiment, the subject has stomach cancer or is at an increased risk of developing a medically determined gastric cancer. In one embodiment, the gastric cancer to be treated is stomach cancer.

[0242] The terms “treatment” “treat” and “treating” are synonymous with the term “administering an effective amount”. These terms refer to medical management that has the purpose of treating, ameliorating, stabilizing, reducing or preventing one or more symptoms of a disease, pathology or disorder such as cancer. These terms are used interchangeably and include active treatment, i.e., treatment specifically directed to amelioration of a disease, pathological condition or disorder, and also causal treatment, i.e., the cause of the related disease, pathological condition or disorder. Includes treatment directed to remove In addition, treatment may include palliative treatment, ie, treatment designed for symptom relief rather than treatment of the related disease, pathological condition or disorder; prophylactic treatment, ie, treatment directed at minimizing or partially or completely inhibiting the development of the related disease, pathological condition or disorder; and adjuvant treatment, i.e., treatment used to supplement another specific therapy directed towards amelioration of the related disease, pathological condition or disorder. It is understood that treatment, although aimed at treating, ameliorating, stabilizing or preventing a disease, pathological condition or disorder, need not actually result in treatment, amelioration, stabilization or prevention. The effect of treatment can be measured or assessed as described herein and as known in the art as appropriate for the disease, pathological condition or disorder involved. Such measurements and evaluations may be made qualitatively and/or in perspective. Thus, for example, a characteristic or characteristic of a disease, pathological condition or disorder and/or a symptom of a disease, pathological condition or disorder may be reduced to any effect or to any amount. In certain embodiments, treating a disease, such as cancer, comprises inhibiting the proliferation of cancer cells. In some embodiments, treatment of cancer can be determined by detecting a decrease in the amount of proliferating cancer cells, a decrease in tumor growth, or a decrease in tumor size in a subject.

[0243] In a specific embodiment, the nucleic acid composition of the present invention is used to treat cancer.

[0244] As used herein, the term "cancer" includes any disease caused by unregulated division and abnormal cell growth, including malignant and metastatic growth of tumors, for example. The term "cancer" also includes precancerous conditions, or conditions characterized by an increased risk of cancerous or precancerous conditions. Cancers or precancers (neoplastic conditions) can be located in any part of the body, including internal organs and skin. As is well known, cancer invades the normal, non-cancerous tissue surrounding the tumor through lymph nodes and blood vessels, and then spreads through the subject by blood after the tumor invades the subject's veins, capillaries, and arteries. When cancer cells break away from the primary tumor (“metastasis”), secondary tumors form metastatic lesions and develop throughout the affected subject.

[0245] Some non-limiting examples of cancer cells applicable for treatment using the methods of the present invention include colon, rectum (including anus), stomach, esophagus, kidney, prostate, skin, lung, breast, pancreas, brain, blood and liver. can be heard A cancer or neoplasm may also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas or teratomas (germ cell tumors). In some embodiments, the cancer may also be a form of leukemia.

[0246] In certain embodiments, the nucleic acid composition described herein is for treating colorectal cancer (i.e. colon or rectal cancer), pancreatic cancer, breast cancer, stomach cancer, lung cancer or blood cancer at any stage as further described below. used

[0247] For example, there are four stages of colorectal cancer, which are generally characterized by the extent of metastasis. In stage 0 or carcinoma in situ, abnormal, potentially cancerous cells are found in the mucosa (innermost layer) of the colon wall. In stage I, cancerous cells can form in the mucous membrane of the colon wall, spread to the submucosal layer (the tissue layer below the mucosa) and spread to the muscle layer of the colon wall. Stage II consists of three subclasses: stage IIA, in which cancerous tissue spreads through the muscular layer of the colon wall to the serous layer (outermost layer) of the colon wall; stage IIB, in which the tumor has spread through the serous layer of the colon wall but not to nearby organs; and stage IIC, in which the cancer has spread through the serous layer of the colon wall and invaded nearby organs. Stage III is also divided into three subclasses: cancer has spread through the mucosa of the colon wall to the submucosal and muscular layers and has spread to 1-3 nearby lymph nodes or tissues near them; or stage IIIA, in which the cancer has spread through the mucosa to the submucosa and 4-6 nearby lymph nodes; the tumor has spread through the muscular layer of the colon wall into the serous layer or has spread through the serous layer but has not spread to nearby organs and the cancer has spread to 1-3 nearby lymph nodes or tissues near the lymph nodes; or spread to the muscular or mucosal layer and 4-6 nearby lymph nodes; Stage IIIB, which spreads submucosa through the mucosa and spreads to the muscle layer to 7 or more nearby lymph nodes. In stage IIIC colorectal cancer, the tumor spreads through the serous layer of the colon wall but not to nearby organs and the cancer spreads to 4-6 nearby lymph nodes; cancer spreads through the muscle layer to the serous layer or spreads through the serous layer but not to nearby organs and the cancer has spread to 7 or more nearby lymph nodes; Or the cancer has spread through the serous layer to nearby organs and to one or more nearby lymph nodes or tissues near the lymph nodes. Finally, stage IV colorectal cancer is divided into two subclasses: stage IVA, in which the cancer has spread through the colon wall and spread to nearby organs and one period not near the colon or to distant lymph nodes; and stage IVB, in which the cancer has spread through the colon wall and to nearby organs and to one or more organs not near the colon or to the lining of the abdominal wall.

[0248] Another example of tumor staging is the Dukes classification system for colorectal cancer. Here, the stage is stage A, in which the tumor is confined to the intestinal wall; stage B where the tumor exhibits invasion through the intestine but has not invaded the lymph nodes; stage C, wherein cancerous cells or tissues are found within the subject's lymph nodes; and stage D in which the tumor exhibits widespread metastasis to multiple organs in the subject.

[0249] The Astler Coller classification system may alternatively be used. Here, stage A colorectal cancer is defined as cancer that exists only in the intestinal mucosa; In stage B1, the tumor has expanded to the muscularis propria, but has not penetrated through it and the tumor has not metastasized to the lymph nodes. Stage B2 colorectal cancer is defined as a tumor that has penetrated through the muscle layer, and the tumor does not metastasize to the lymph nodes. ; Stage C1 was characterized by a tumor that extended to the muscle layer but did not penetrate through it and the tumor did not metastasize to the lymph nodes; Stage C2 colorectal cancer is classified as a tumor that has penetrated through the muscle layer where the tumor has metastasized to the lymph nodes; Stage D describes an individual or tumor that has metastasized through the subject.

[0250] In some embodiments, the method of treatment of the present invention is more particularly administered to a cancer subject exhibiting reduced levels of miR-129 expression, miR-15a expression, miR-506 expression, miR-502, miR-140 or a combination thereof. it's about In this regard, it is known that miR-15a is downregulated in cancer. See, eg, RI Aqeilan, et al., Cell Death and Differentiation (2010) 17, pp. 215-220]. Cancerous cells with reduced miR-129 expression levels are also known to be resistant to 5-fluorouracil, as described, for example, in US Patent Application Publication No. 2016/0090636, the contents of which are incorporated by reference in their entirety. It is also known that pancreatic cancer cells exhibit reduced miR-506 levels. For example, [Li, J, et al. Oncogene. 35 pp. 5501-5514].

[0251] In another example, the microRNA mimic of the present invention is used to treat pancreatic cancer. As shown in Figure 14a and 15a-15b, each of the modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR- 200a, miR-200b, miR-200c, miR-145, miR-194, and miR-let-7 can be used to treat pancreatic cancer. Pancreatic cancer arises from precursor lesions called paninreatic intraepithelial neoplasia (PanINs). These lesions are usually located in the small ducts of the exocrine pancreas, and depending on the degree of cellular dysplasia, they can be classified as low-grade dysplasia, moderate dysplasia, or high-grade dysplasia. These lesions usually show the presence of activating mutations in the KRAS gene, along with specific inactivating mutations in CDKN2A, TP53 and SMAD4. Collectively, these genetic mutations lead to the formation of invasive cancer. Pancreatic cancer depends on the size of the primary tumor and whether it has grown outside the pancreas and into surrounding organs; The tumor is staged based on whether the tumor has spread to nearby lymph nodes and whether it has metastasized to other organs in the body (eg, liver, lung, abdomen). This information is then combined and used to present specific steps, namely steps 0, 1A, 1B, 2A, 2B, 3 and 4. In stage 0, pancreatic tumors are confined to the top layer of pancreatic cells and do not invade deeper tissues. Primary tumors do not metastasize outside the pancreas, such as pancreatic carcinoma in situ or pancreatic intraepithelial neoplasia III. Stage 1A pancreatic tumors are usually confined to the pancreas and are 2 cm in size or smaller. In addition, stage 1A pancreatic tumors do not spread to nearby lymph nodes or distant locations. Stage 1B pancreatic tumors confined to the pancreas are larger than 2 cm in size. Stage 1B pancreatic tumors do not spread to nearby lymph nodes or distant locations. Stage 2A pancreatic tumors represent tumors that grow outside the pancreas but do not grow into major blood vessels or nerves, and the cancer has not spread to nearby lymph nodes or distant sites. In patients presenting with stage 2B pancreatic cancer, the tumor may be confined to the pancreas or grow outside the pancreas but not into major blood vessels or nerves, but spread to nearby lymph nodes. Subjects presenting with stage 3 pancreatic cancer represent tumors that have grown outside the pancreas into major blood vessels or nerves and have spread to distant locations. Stage 4 Pancreatic cancer metastasizes to distant locations, lymph nodes and organs.

[0252] In another example, the modified microRNA nucleic acid composition of the present invention is used to treat lung cancer. For example, as shown in Figure 14d, each of the modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194, and miR-let-7 can be used to treat lung cancer. Therefore, the method includes the treatment of non-small cell lung cancer such as squamous cell carcinoma, adenocarcinoma and large cell carcinoma. Lung cancer often arises from malignant tumors in the bronchi of the lungs and spreads to other parts of the body, such as lymph nodes. For example, in the case of small cell lung cancer, cancerous lesions often spread to the second lung, the lung (pleura) surrounding fluid, or neighboring organs, once found in the lung. Lung cancer is staged based on the size of the primary tumor and whether it has grown outside the lungs into lymph nodes and has metastasized to other organs in the body (eg bones, liver, breast, brain). This information is then combined and used to present specific steps, namely steps 0, 1, 2, 3 and 4. For stage 0, ie, carcinoma in situ, the cancer is small and does not spread beyond the lungs or deeper lung tissue. Stage 1 lung cancer shows cancerous cells present in the underlying lung tissue, but lymph nodes are not affected. Stage 2 lung cancer shows that the cancer has spread to nearby lymph nodes or the chest wall. Stage 3 lung cancer is classified by whether it has spread continuously from the lungs to the lymph nodes or to nearby structures and organs such as the heart, trachea, and esophagus. Stage 4 lung cancer refers to cancer that has spread throughout the body, which can affect the liver, bones, or brain.

[0253] In another example, the microRNA mimetics of the present invention are used to treat breast cancer. As shown in Figures 14c and 16c, each of the modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR -200b, miR-200c, miR-145, miR-194 and miR-let-7 can be used in the treatment of breast cancer. There are several main forms of breast cancer. For example, ductal carcinoma begins in the cells of the ducts. Conversely, lobular carcinoma, commonly found in both breasts, develops in lobes or lobules. As such, the methods of the present invention encompass the treatment of both ductal and lobular breast cancer. More specifically, breast cancer may result from the presence of one or more genetic mutations such as HER2 or BRACA. 16A-16C , the method of the present invention is useful for the treatment of such breast cancer. Accordingly, in certain embodiments the methods of the present invention may be used to treat triple negative breast cancer.

[0254] In another example, the microRNA mimetics of the present invention are used to treat gastric cancer. As shown in Figure 14b, each of the modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR- 200b, miR-200c, miR-145, miR-194 and miR-let-7 can be used in the treatment of gastric cancer. Gastric cancer generally exists in two forms: well-differentiated intestinal adenocarcinoma, or diffuse adenocarcinoma that is poorly differentiated and does not form glandular structures. As such, the methods of the present invention include the treatment of both gastric cancer and gastric adenocarcinoma.

[0255] In another example, the microRNA mimetics of the present invention are used to treat hematologic cancer. As shown in Figures 14e and 15c, each of the modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, miR-200b, miR-200c, miR-145, miR-194 and miR-let-7 can be used in the treatment of hematologic malignancies. Several types of leukemia include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute lymphocytic leukemia (ACL), chronic lymphocytic leukemia (CLL), and chronic myelogenous leukemia (CML). have. 14E and 15C , the method of the present invention is useful for the treatment of leukemia. As such, the methods of the present invention include the treatment of ALL, ACL, AML, CLL and CML. In certain embodiments, the methods of the present invention may be used to treat acute lymphocytic leukemia (ACL).

[0256] According to the present invention, a method of treating cancer comprises administration of one or more nucleic acid compositions of the present invention by any route commonly known in the art. This may include, for example, (1) oral administration; (2) parenteral administration, such as subcutaneous, intramuscular or intravenous injection; (3) topical administration; or (4) vaginal or rectal administration; (5) sublingual or buccal administration; (6) ocular administration; (7) transdermal administration; (8) nasal administration; and (9) direct administration to an organ or cell in need thereof.

[0257] In certain embodiments, a modified microRNA composition of the invention is administered to a subject by injection. In one embodiment, a therapeutically effective amount of the modified microRNA composition is injected intravenously. In another embodiment, a therapeutically effective amount of the modified microRNA composition is injected intraperitoneally.

[0258] The amount (dosage) of the nucleic acid composition of the present invention to be administered depends on several factors, such as the type and stage of cancer, the presence or absence of a pre-drug or adjuvant drug, and the subject's weight, age, health status, and It depends on several factors, including resistance to the agent. Depending on these various factors, the dosage may be, for example, about 2 mg/kg body weight, about 5 mg/kg body weight, about 10 mg/kg body weight, about 15 mg/kg body weight, about 20 mg/kg body weight, about 25 mg/kg body weight Weight kg, about 30 mg/kg body weight, about 40 mg/kg body weight, about 50 mg/kg body weight, about 60 mg/kg body weight, about 70 mg/kg body weight, about 80 mg/kg body weight, about 90 mg/body weight kg, about 100 mg/kg body weight, about 125 mg/kg body weight, about 150 mg/kg body weight, about 175 mg/kg body weight, about 200 mg/kg body weight, about 250 mg/kg body weight, about 300 mg/kg body weight , about 350 mg/kg body weight, about 400 mg/kg body weight, about 500 mg/kg body weight, about 600 mg/kg body weight, about 700 mg/kg body weight, about 800 mg/kg body weight, about 900 mg/kg body weight, or about 1000 mg/kg body weight, wherein the term “about” is generally understood to be within ±10%, 5%, 2% or 1% of the indicated value. The dosage may also be within a range limited by any of the above values. Using routine experimentation, the effect of a compound on a cancerous or precancerous disease, or microRNA (such as miR-15a, miR-200a, miR-200b, miR-200c, miR-145, miR-194, miR-34, miR-let-7, miR-129, miR-140, miR-192, miR-502, miR-506) Appropriate dosage for each patient by monitoring effect on expression level or activity, or effect on their target such as BCL 2 level or activity, or effect on TS level or activity, or effect on E2F3 level or disease pathology therapy can be determined. Any of the above exemplary nucleic acid dosages may be administered once, twice or multiple times per day, depending on various factors described above.

[0259] The ability of the nucleic acid compositions described herein and, optionally, any additional chemotherapeutic agents for use with the methods of the invention, can be assessed using pharmacological models well known in the art, such as cytotoxicity assays, apoptosis. can be determined using staining assays, xenograft assays, and binding assays.

[0260] The nucleic acid compositions described herein may or may not be administered with one or more chemotherapeutic agents, which may also be pre-drugs or adjuvant drugs that are different from the nucleic acid compositions described herein.

[0261] As used herein, the phrase "chemotherapy" or "chemotherapeutic agent" is an agent useful for the treatment of cancer. Chemotherapeutic agents useful in combination with the methods described herein include, for example, any agent that modulates, directly or indirectly, BCL2, E2F3 or TS. Examples of chemotherapeutic agents include: anti-metabolites such as methotrexate and fluoropyrimidine-based pyrimidine antagonists, 5-fluorouracil (5-FU) (Carac® cream, Efudex®, Fluoroplex®, Adrucil®) and S -One; antifolates, such as polyglutamatable antifolate compounds; raltitrexed (Tomudex®), GW1843 and pemectrexed (Alimta®) and non-polyglutamated folate antagonist compounds; nolatrexed (Thymitaq®), plebitrexed, BGC945; folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, camufur, cytarabine, dideoxyuridine, doxyfluridine, enocitabine, floxuridine. In a specific embodiment of the present invention, the chemotherapeutic agent is a gene or gene product involved in a signaling pathway involved in abnormal cell proliferation or apoptosis, such as expression of YAP1, BMI1, DCLK1, BCL2, thymidylic acid synthase or E2F3 or compounds capable of inhibiting the activity; and a pharmaceutically acceptable salt, acid or derivative of any one of the above compounds.

[0262] In another embodiment, chemotherapy is any one of the following cancer drugs, such as methotrexate, doxorubicin, cyclophosphamide, cis-platin, oxaliplatin, bleomycin, vinblastine, gemcitabine, vincristine, epi It may be one or more of rubicin, folinic acid, paclitaxel, and docetaxel. The chemotherapeutic agent may be administered before, during or after initiation of treatment with the nucleic acid composition.

[0263] In some embodiments, the chemotherapeutic agent is an anti-cancer drug, or a tissue sensitizer or other accelerator for an anti-cancer drug. In some embodiments, the co-drug may be another nucleic acid, or another miRNA, such as a microRNA mimic of the present invention, gemcitabine or free 5-FU.

[0264] In certain embodiments, the other nucleic acid is a nucleic acid complementary to a short hairpin RNA (shRNA), siRNA or BCL2 3'UTR region.

[0265] In some embodiments, the chemotherapeutic agent is a co-drug.

[0266] E2F transcription factor 3, E2F3 (RefSeq NG_029591.1, NM_001243076.2, NP_00123305.1, NM_001243076.2, NP_001230005.1) is a transcription factor that binds to DNA and interacts with an effector protein, wherein the effector protein is Retinoblastoma proteins that regulate the expression of genes involved in cell cycle regulation, but are not limited thereto. Therefore, any drug that inhibits the expression of E2F3 can be considered a co-drug in the present invention.

[0267] B cell lymphoma 2 (BCL2), (RefSeq NG_009361.1, NM_000633, NP_000624), such as its isoforms α (NM_000633.2, NP_000624.2) and β (NM_000657.2, NP_000648.2) are Bcl- Encoded by two genes, the Bcl-2 gene is a member of the BCL2 family of regulatory proteins that regulate mitochondrial-regulated cell death through the intrinsic apoptosis pathway. BCL2 is a mitochondrial outer membrane endogenous protein that blocks cell apoptosis by binding BAD and BAK proteins. Non-limiting examples of BCL2 inhibitors include antisense oligonucleotides such as Oblimersen (Genasense; Genta Inc.), BH3 mimetic small molecule inhibitors such as ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.), and Obatoclax (Cephalon Inc.). Any drug that inhibits the expression of BCL2 may be considered a co-drug in the present invention.

[0268] Thymidylic acid synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a widely-existing (ubiquitous) enzyme of dUMP, which is essential for generating dTMP, which is one of the four bases constituting DNA. catalyzes methylation. This reaction requires CH H4-folic acid as a cofactor, both as a methyl group donor and intrinsically as a reducing agent. The constant demand for CH H4-folate is strongly correlated with the activity of thymidylic acid synthase activity, two enzymes responsible for replenishing the cell's folic acid storage space: dihydrofolate reductase and serine transhydroxymethylase. means Thymidylic acid synthase is a homodimer of 30-35 kDa subunits. The active site binds simultaneously to both the folate cofactor and the dUMP substrate, using dUMP covalently linked to the enzyme via a nucleophilic cysteine residue. (See Carreras et al, Annu. Rev. Biochem., (1995) 64:721-762). The thymidylic acid synthetase reaction is an important part of the pyrimidine biosynthetic pathway to generate dCTP and dTTP for incorporation into DNA. This reaction is necessary for DNA replication and cell growth. Thus, thymidylic acid synthase activity is required in all rapidly dividing cells, such as cancer cells. Because of its association with DNA synthesis and thus cellular replication, thymidylic acid synthase has been a target for anticancer drugs for many years. Non-limiting examples of thymidylic acid synthase inhibitors include folic acid and dUMP analogs such as 5-fluorouracil (5-FU). Any drug that inhibits the expression of thymidylic acid synthase may be considered a co-drug in the present invention.

[0269] If desired, administration of the nucleic acid compositions described herein may be combined with one or more non-drug therapies, such as radiation therapy and/or surgery. As is well known in the art, radiation therapy and/or chemotherapeutic agents (in this case, the nucleic acid composition described herein, and optionally optional of additional chemotherapeutic agents) may be given. As is also well known in the art, administration of radiation therapy and/or chemotherapeutic agents may be given after surgery to destroy any remaining cancer.

[0270] The following examples are presented for purposes of illustration and to describe certain specific embodiments of the invention. However, the scope of the present invention is not limited in any way by the examples described in the present invention.

Example

Example 1. Materials and Methods

[0271] Modified microRNA : 5-FU modified miR was synthesized by an automated oligonucleotide synthesis process and purified by HPLC. The mature modified 5-FU-miR of the present invention was prepared by annealing the two strands. More specifically, a method called "2'-ACE RNA synthesis" was used. 2'-ACE RNA synthesis is based on a protecting group format in which a silyl ether is used to protect the 5'-hydroxyl group in combination with an acid-labile orthoester protecting group (2'-ACE) on the 2'-hydroxyl. do. This combination of protecting groups is then used in conjunction with standard phosphoramidite solid phase synthesis techniques. For example, SA Scaringe, FE Wincott, and MH Caruthers, J. Am. Chem . Soc . , 120 (45), 11820-11821 (1998)]; International PCT Application WO/1996/041809; [MD Matteucci, MH Caruthers, J. Am. Chem . Soc . , 103, 3185-3191 (1981)]; [SL Beaucage, MH Caruthers, Tetrahedron Lett . 22, 1859-1862 (1981)].

[0272] Exemplary modified miR-15a nucleic acid, modified miR-140 nucleic acid, modified miR-192 nucleic acid, modified miR-502, modified miR-506 nucleic acid, modified miR-506 nucleic acid for replacing uracil with 5-halouracil miR-34 nucleic acid, modified miR-194 nucleic acid, modified miR-200a, modified miR-200b, modified miR-200c nucleic acid, modified miR-145 nucleic acid, modified miR-let-7 nucleic acid or any other Modified microRNAs can be synthesized in the same manner as described herein.

[0273] Several exemplary structures of currently used protected and functionalized ribonucleoside phosphoramidite are shown below.

[0274] Cell culture . Human colorectal cancer cell lines HCT116, RKO, SW480, SW620 and normal colon cell line CCD 841 CoN, pancreatic cancer cell lines ASPC-1, 1HS766T, Panc-1, AGS gastric cancer cell lines, SKBR3 and MDA-MB-231 breast cancer cells, REH acute lymphocytic cell line and lung cancer cell line A549 was obtained from the American Type Culture Collection (ATCC) and maintained in various types of media. For example, McCoy's 5A medium (SKBR3, HCT-116), DMEM (RKO, HS766T, SW480, SW620) and MEM (CCD 841 CoN), RPMI-1640 (REH and APSC-1) and F-12K medium (AGS, A549) ) was maintained. The medium was supplemented with 10% fetal bovine serum (Thermo Fischer).

[0275] For transfection, 1×10 ⁵ cells were plated in 6-well plates and 24 hours later, 100 nM of control non-specific miRNA (Thermo Fischer) using Oligofectamine (Thermo Fischer) according to the manufacturer's protocol, Modified microRNAs or exogenous native microRNAs were transfected. For drug-free transfection, cells were plated in 6 well plates at ^{(1x10 5 ) cells per well.} After 24 h, 100 pmol miRNA (control, miR-15a, mimic-1) was diluted in Optimem (Thermo Fischer) and added to the plate. The medium was changed after 24 hours. The medium was supplemented with 10% fetal bovine serum (Thermo Fischer). Briefly, cells were cultured in growth medium (DMEM/F12 (Life Technologies) supplemented with B27, 10 ng/mL bFGF and 20 ng/mL EGF in ultra-low attachment flasks) for up to 6 days. Spheroid cells were maintained by gentle centrifugation, dissociation into single cells and collection via re-plating.

[0276] western Immunoblot analysis : 48 hours after transfection, an equal amount of protein (15 μg) extracted from lysed cells in RIPA buffer containing protease inhibitor (Sigma) was treated with 10%-12% sodium dodecane using standard methods. It was separated on a thread sulfate-polyacrylamide gel. Primary antibodies used in the assay were rabbit anti-YAP1 monoclonal antibody (1:10000) (Cell Signaling Technologies), anti-DLCK1 (1:500) (Abcam), anti-BCL2 (1:500) (NeoMarkers), anti-BMI-1 (1:10000) (Cell Signaling Technologies), mouse anti-human TS antibody (1:500), anti-α-tubulin (1:50000) (Santa Cruz Biotech Inc.), anti-GAPDH (1:100000) (Santa Cruz Biotech Inc.), anti-E2F3 (1:500) (Santa Cruz Biotech Inc.). As the secondary antibody, horseradish peroxidase-conjugated antibody to mouse or rabbit (1:5000, Santa Cruz Biotech Inc.) was used. Protein bands were visualized with autoradiography film using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fischer). Western blot density was quantified using Image J software.

[0277] Cell proliferation assay : 24 hours after transfection, cells were seeded in 96-well plates at a density of 2000 cells per well. Cell proliferation assays were performed on days 1-5 by incubating 10 μl WST-1 (Roche Applied Science, Mannheim, Germany) in culture medium for 1 h and reading absorbance at 450 and 630 nm. The cell proliferation rate was calculated by subtracting the absorbance at 450 nm from the absorbance at 630 nm. Experiments for cell proliferation assays were performed at least three times. OD was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm. Proliferation experiments were performed in triplicate.

[0278] Anchorage-independent proliferation was studied to determine the cancer cell colony-forming ability. Cancer cells were trypsinized and counted, and a total of 1×10 ⁵ cells per well in 6-well plates were transfected with 25 nM of modified microRNA or native miR or negative control miRNA using oligofectamine, and transfected Cells were counted again 6 hours after speculation. In a 35-mm dish, a total of 20,000 cells in 0.35% agar (Bacto Agar, Becton Dickinson) were laid on top of 1 mL of a solidified 6% agar layer. Growth medium containing B27, 10 ng/mL bFGF and 20 ng/mL EGF was included in both layers. After 2 weeks of culture, colonies with a diameter of 50 mm or more were counted.

[0279] Cell cycle analysis ^{: 24 h post transfection, cells are harvested and 0.5 to 1 x 10 6} cells/mL in modified Krishan buffer supplemented with 0.02 mg/mL RNase H and 0.05 mg/mL propidium iodide. was resuspended with Stained cells were detected by flow cytometry and the results analyzed with Modfit LT™ software. Experiments for cell cycle analysis were performed at least three times.

[0280] Apoptosis Assay . In order to distinguish between early and late apoptosis, fluorescein isothiocyanate (FITC, fluorescein isothiocyanate)-Annexin analysis was performed (Becton Dickinson). HCT116, RKO, SW480 and SW620 cells ^{were plated in 6 well plates at (1×10 5} ) cells per well, and 24 hours later, cells were transfected with 25 nM modified miRNA using Oligofectamine. Forty-eight hours post-transfection, cells were harvested and stained with propidium iodide and anti-annexin-V antibody (Annexin V-FITC Apoptosis Detection kit, Invitrogen, CA, USA) according to the manufacturer's protocol. Cells were detected by flow cytometry.

[0281] 5-FU treatment and cytotoxicity assay : 24 hours after transfection, cancer cells were plated in triplicates in 96-well plates at ^{2 x 10 3 cells per well in 100 μl medium.} After 24 hours, 2-μM 5-FU alone, 50 nM native microRNA, 50 nM modified microRNA (such as modified miR-129), or 2 mM 5-FU and 50 nM modified microRNA of the invention A combination of microRNAs, such as modified miR-129, is added and cells are cultured for an additional 72 hours. Cell viability was determined using the WST-1 assay.

[0282] Lentivirus production : Briefly, 1.5 x 10 ⁶ 293T cells were plated in 10-cm dishes containing 10 mL DMEM + 10% FBS. Two days later, pEZX-MR03, a lentiviral plasmid expressing miR-129 or hsa-miR-15a, was transfected with the Lenti-Pac HIV expression packaging kit according to the manufacturer's protocol. After 48 hours, the virus was harvested and concentrated with a Lenti-Pac lentivirus concentration solution. The virus was then titered using the Lenti-Pac™ HIV qRT-PCR titration kit (approximately 1011 virus particles/ml). In addition, serial dilutions of the virus (0.1 μL, 0.5 μL, 2 μL, 10 μL, 50 μL) were used for 5 x 10 ⁴ HCT116 CSC transduction and the transduction efficiency was determined. Cells were infected with in vivo treatment mice using the lowest concentration (2 μL) to achieve 100% positive expression.

[0283] Real- time qRT -PCR analysis of nucleic acid expression . The expression level of microRNAs in cancer cells was quantified. Briefly, primers specific for the target microRNA and internal control RNU44 gene were obtained from Ambion. cDNA synthesis was performed by the High Capacity cDNA Synthesis Kit (Applied Biosystems) using miRNA-specific primers. Real-time qRT-PCR was performed in Applied Biosystems 7500 Real-Time PCR equipment using miRNA-specific primers by TaqMan Gene Expression Assay (Applied Biosystems). Expression levels of exemplary miRs of the present invention were calculated by the ΔΔCT method based on the internal control RNU44, normalized to the control group and plotted as relative quantification.

[0284] Human Cancer Stem Cells Profiler : RNA was extracted from cancer cells transfected with an exemplary microRNA or negative miRNA of the present invention using TRIzol reagent (Thermo Fischer) according to the manufacturer's protocol. RNA was transcribed into first strand cDNA using the RT2 First Strand Kit (Qiagen). Next, the cDNA is mixed with RT2 SYBR Green Mastermix (Qiagen), and the mixture is aliquoted into the wells of Human Cancer Stem Cells RT2 Profiler PCR Array (Qiagen). Applied Biosystems 7500 Real-Time PCR equipment was used for qRT-PCR (Applied Biosystems), and relative expression values were determined using ΔΔCT method.

[0285] Mouse subcutaneous tumor transplantation model : 2 days before injection, HCT116 cancer stem cells were plated at ^{5 x 10 5 /well in a 6-well ultra-low adhesion plate.} Cells were transduced or transfected with 20 μL of virus or 100 pmoles of modified miR-129 or modified miR-15a. ^{After 48 hours, cells were harvested and resuspended at 10 6} /ml in DMEM/F12 knockout medium containing 30% Matrigel. 10 to 12 week old NOD/SCID mice (Jackson Laboratories, Bar Harbor, MA, USA) were used for tumor transplantation. Mice were anesthetized by isoflurane inhalation. 100 μL of cell suspension was injected subcutaneously on both sides of the lumbar region. The tumor size was measured using a caliper, and the tumor volume was calculated using the formula ^{V = length × width 2 /2.}

[0286] For in vivo miRNA delivery experiments, colon cancer cells expressing the lenti-luc reporter gene were generated by infecting parental HCT116 cells with recombinant lentivirus. Luciferase-expressing HCT116 cells (2.0x10 ⁶ cells per mouse) were suspended in 0.1 mL of PBS solution and injected through the tail vein of each mouse. Two weeks after colon cancer cell injection, mice were treated with 40 μg of negative control or modified miR(s) packaged with in vivo-jetPEI (Polyplus Transfection) via tail vein injection. Mice were treated every other day (8 times) for 2 weeks. After treatment, mice were screened using the IVIS Spectrum In vivo Imaging System (IVIS) (PerkinElmer).

[0287] RNA Isolation : For mouse xenotransplantation, each sectioned tissue was deparaffinized, hydrated, and digested with protease K. Total RNA was then isolated using TRIzol ^{® reagent.} In addition, total RNA was isolated from clinical specimens via a ^{TRIzol ®-based approach.}

[0288] Statistical Analysis . All experiments were repeated at least 3 times. All statistical analyzes were performed with SigmaPlot software. Statistical significance between the two groups was determined using Student's t-test (paired t -test for clinical samples and unpaired t-test for all other samples). . To compare two or more groups, one-way ANOVA followed by the Bonferroni-Dunn test was used. Data were expressed as mean ± standard error of the mean (SEM). Statistical significance is described in the figure legend or marked with an asterisk (*). * = P<0.05; ** = P<0.01; *** = P<0.001.

Example 2: Modified of the present invention microRNA is It has anticancer activity.

[0289] As shown in Figures 3, 8b, 12a-d, 13a-b, 14a-e and 15a-c, modified miRNAs (modified miRs: 129, 15a, 192 (215), 140, 502, 34, 194, 200a, 200b, 200c, 145, let-7 and 506), when compared to one or more controls (ie, non-specific microRNA, non-modified miRNA precursor, or vehicle alone), colon cancer , blood cancer, breast cancer, stomach cancer, pancreatic cancer, and lung cancer cell proliferation inhibition. In addition, the modified miRNA can be delivered to cancer cells without a transfection reagent (shown in FIGS. 17A-17B ). Notably, the results showed that cancer cell proliferation across several different colorectal cancer cell lines, pancreatic cancer cell lines, breast cancer cell lines, lung cancer cell lines, gastric cancer cell lines and leukemia cell lines was significantly inhibited when compared to cancer cells treated with control microRNA or vehicle alone. show that it will be

Example 3: deformed miR -129 nucleic acid has anticancer activity.

[0290] In the next experiment, 5-FU was incorporated into miR-129. In one experiment, all U bases of miR-129 were replaced with 5-FU, as shown in the structure provided in FIG. 1A , where “U ^F ” stands for 5-fluorouracil or another 5-halouracil. In another experiment, all U bases except the seed region of miR-129 were replaced with 5-FU as shown in the structure provided in Figure 1b.

[0291] Target Specificity Assay : Results of western immunoblot experiments in colorectal cancer HCT-116 cells show that exemplary modified miR-129 polynucleotides of the present invention may retain their target specificity for TS, BCL2 and E2F3 prove the The results are shown in Figures 2a and 2b, which are SEQ ID. Results are shown for a modified miR-129 nucleic acid in which all U bases were replaced with 5-FU as obtained by two separate operators, as described in NO: 4. More importantly, the exemplary miR-129 mimic was found to be more potent than the unmodified (control) miR-129 in reducing the expression levels of TS, BCL2 and E2F3.

[0292] Enhancement of function of the modified microRNA of the present invention. The effect of exemplary modified miR-129 on colorectal cancer cell proliferation was compared with native miR-129. The results show that 5-FU-miR-129 at a concentration of 50 nM can completely inhibit HCT-116 tumor cell growth. In addition, as shown in the results of FIG. 3 , 5-FU-miR-129 is much more potent than native miR-129, thereby providing a significantly higher inhibitory effect. This inhibition is specific as the scrambled control miR has no effect on cell proliferation.

[0293] Next, the efficacy of modified miR-129 and 5-FU on cell proliferation was compared using HCT-116 colorectal cancer cells. As shown by the results presented in Figure 4, 50 nM (40 fold less than 5-FU) of modified miR-129 is unexpectedly much more potent in inhibiting tumor cell proliferation than 2 μM 5-FU.

[0294] An exemplary micro-modified RNA of the invention induces cell chair myeolsa in colon cancer cells. Using BCL2, an important target of miR-129, the effect of the modified miR of the present invention on apoptosis was investigated. Specifically, cell death using apoptosis assay in HCT116, RKO, SW480 and SW620 colorectal cancer cells transfected with negative control miRNA, native miR-129 or an exemplary miR-129 mimic of SEQ ID NO: 4 was quantified. Results showed that miR-129 mimetics in all four colorectal cancer cell lines, compared to native miR-129 and negative control miRNAs, cellularly increased 2 to 30-fold through fluorescence-activated cell sorting (FACS)-based FITC-Annexin analysis. show that it can induce apoptosis (Fig. 5a).

[0295] miR- 129 mimetics triggers G1/S cell cycle checkpoint regulation . Cell cycle analysis was performed using flow cytometry on HCT-116 cells treated with scramble control, miR-129 precursors and exemplary miR-129 mimetics. As shown in Figure 5b, cell cycle analysis showed that miR-129 mimics affect colorectal cancer cell growth by inducing G1 arrest, and that the effect is much more (two-fold or more) potent than native miR-129. turned out

[0296] miR -129 mimetic removes chemotherapy-resistant cancer stem cells. To determine the effect of certain exemplary modified microRNAs of the present invention (ie, miR-129 mimetics) on 5-FU-resistant colorectal cancer stem cells, HCT116-derived colorectal cancer stem cells were treated with various concentrations of mimic-1 or 5-FU. The data shown in Figure 6 shows that the exemplary microRNA mimic of the present invention can eliminate up to 80% or more of 5-FU-resistant colorectal cancer stem cells at a concentration of 100 nM, whereas tumor stem cells at a lethal dose of 100 μM of 5-FU It has minimal effect on cell viability.

[0297] Taken together, these results show that exemplary modified microRNA polynucleotides of the present invention can inhibit cell proliferation of HCT116 colorectal cancer stem cells ( FIG. 6 ). This inhibitory effect by miR-129 was much stronger than native miR-129, as proliferation was almost completely blocked by 25 nM miR-129 on day 6 ( FIG. 6 ). We also demonstrated the effect of cell treatment with modified miR-129 on non-adherent cell growth, using a soft agar assay. The modified miR-129 treated colorectal cancer stem cells and did not form conspicuous spheres compared to cells treated with native miR-129 or control miRNA (similar to that shown in FIG. 10 ).

[0298] miR- 129 mimetics inhibit colon cancer metastasis in vivo. The therapeutic effect of miR-129 nucleic acid modification was evaluated using a colorectal cancer metastasis model. Two weeks after metastasis establishment, 40 μg of the miR-129 nucleic acid of SEQ ID NO: 4 was delivered by intravenous injection at a treatment frequency of once every other day for two weeks. The results shown in FIG. 17 show that, although there is no toxic side effect, the modified microRNA-129 inhibited colon cancer metastasis, whereas the negative control miRNA had no effect.

Example 4. Exemplary Variations miR and its anticancer activity.

[0299] Exemplary modified miR- 15a compositions have anticancer activity . 1C and 1D , all uracil bases of the miR-15a nucleic acid sequence are replaced with 5-halouracil (ie, 5-fluorouracil) ( FIG. 1C ) or non-seed of the miR-15a nucleic acid sequence Exemplary modified miR-15a mimetics were synthesized as described above, in which only the uracil base of the region was replaced with 5-halouracil (ie, 5-fluorouracil) ( FIG. 1D ).

[0300] Three days after transfection of the exemplary modified miR-15a described in FIG. 1C into HCT-116 colorectal cancer stem cells, the protein was collected and Western blotting was performed to collect the modified miR-15a of the present invention. It was confirmed whether the nucleic acid composition retains the ability to modulate the key miR-15a target. As shown in Figure 8a, miR-15a targets YAP1, BMI1, DCLK1 and BCL2 showed reduced protein levels upon transfection with unmodified miR-15a (native-miR15a) or modified miR-15a composition, This indicated that 5-halouracil modification did not inhibit the ability of miR-15a to modulate their target in cells.

[0301] Modified miR- 15a has increased therapeutic efficacy in vitro . In order to determine whether the modified miR-15a composition of the present invention exhibits increased efficacy in colorectal cancer cell lines compared to unmodified miR-15a, HCT-116 colorectal cancer cells were treated as negative controls (non-specific oligos) as described in FIG. 1C. nucleotides), unmodified miR-15a or an exemplary modified miR-15a composition.

[0302] WST-1 assay was used to assess cancer cell proliferation. As shown in Figure 8b, 6 days after transfection, unmodified miR-15a reduced cell proliferation by 53% compared to control. For the modified miR-15a, cell proliferation was reduced by 84%. Taken together, the experimental results show that modified miR-15a is more effective in reducing cancer cell proliferation than unmodified miR-15a.

[0303] Modified miR-15a nucleic acids were also assayed for their ability to inhibit cell cycle progression in cancer cells. Figure 9a shows that unmodified miR-15a induces cell cycle arrest and leads to an approximately 3-fold increase in the G1/S ratio. 9A also shows that exemplary modified miR-15a compositions of the present invention were more effective in arresting cell cycle progression when compared to their native counterparts. For example, a 7-fold increase in the G1/S ratio was shown by cells expressing an exemplary modified miR-15a nucleic acid of the invention when compared to a control. Therefore, modified miR-15a is more effective in inducing cell cycle arrest in colorectal cancer cells than unmodified miR-15a.

Similarly, modified miR-let-7 and modified miR-145 were more effective in arresting cell cycle progression than negative controls. See Figure 9b. For example, when compared to controls, cells expressing exemplary modified miR-let-7 and modified miR-145 nucleic acids of the invention showed a significant fold increase in G1/S ratio.

[0305] As another example, modified miR-200b (5-FU-miR-200b) is a subtype of breast cancer cells in a population when compared to a control (ie, native exogenous miR-200b or vehicle alone, NC). Significantly increases the G1 and G1/S ratios. See Fig. 16c. This shows that exemplary miR-200b can also treat cancer by inhibiting cell cycle progression.

[0306] The effect of an exemplary modified miR-15a composition on colony formation by colorectal cancer stem cells in Matrigel matrix was also investigated. As shown in FIG. 10 , many colonies were formed by cells transfected with control miRNA ( FIG. 10 , negative), but few colonies were formed by cells transfected with unmodified miR-15a. was not (Fig. 10, miR-15a). In contrast, for cells transfected with the modified miR-15a, no colonies were observed ( FIG. 10 , 5-FU-miR-15a). These results indicate that the exemplary modified miR-15a composition of the present invention is indeed a more potent inhibitor of cancer generation and colorectal cancer progression.

[0307] Modified miR- 15a inhibits cancer development and progression in vivo . To further our understanding of miR-15a in colonic CSCs, we established a mouse xenograft model containing colorectal cancer cells pre-transfected with either modified miR-15a or a negative control miRNA. Tumors were measured and harvested 8 weeks after injection. As shown in Figure 11, there was a significant reduction in tumor size (>25x) (n = 8) of tumors established from CSCs expressing the modified miR-15a mimic.

[0308] The data presented herein show that halouracil (eg, 5-FU) is added to miRNA nucleic acid sequences to enhance the chemotherapeutic function of native microRNA molecules, with or without other chemotherapeutic agents. Support the feasibility of incorporating new variants.

SEQUENCE LISTING <110> The Research Foundation for The State University of New York <120> 5-HALOURACIL-MODIFIED MICRORNAS AND THEIR USE IN THE TREATMENT OF CANCER <130> 34085Z-PCT <150> PCT/US2017/059011 <151> 2017-10-30 <150> 62/464,491 <151> 2017-02-28 <150> 62/422,298 <151> 2016-11-15 <150> 62/415,740 <151> 2016-11-01 <160> 30 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Homo sapiens <400> 1 cuuuuugcgg ucugggcuug c 21 <210> 2 <211> 22 <212> DNA <213> Homo sapiens <400> 2 uagcagcaca uaaugguuug ug 22 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> modified microRNA129 with additional uracils on the 3' end of the nucleic acid sequence <220> <221> misc_feature <222> (22)..(23) <223> uracil nucleotides <400> 3 cuuuuugcgg ucugggcuug cuu 23 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-129 nucleic acid with all uracils modified <220> <221> misc_feature <222> (2)..(6) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (18)..(19) <223> halouracil nucleotides <400> 4 cuuuuugcgg ucugggcuug c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-129 nucleic acid with all uracils in non-seed modified <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (18)..(19) <223> halouracil nucleotides <400> 5 cuuuuugcgg ucugggcuug c 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-15a nucleic acid with all uracils modified <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(19) <223> halouracil nucleotides <220> <221> misc_feature <222> (21)..(21) <223> halouracil nucleotides <400> 6 uagcagcaca uaaugguuug ug 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-15a nucleic acid with all uracils in the non-seed portion of the nucleic acid sequence modified <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(19) <223> halouracil nucleotides <220> <221> misc_feature <222> (21)..(21) <223> halouracil nucleotides <400> 7 uagcagcaca uaaugguuug ug 22 <210> 8 <211> 22 <212> DNA <213> Homo sapiens <400> 8 caggguuuu acccuauggu ag 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-140 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (4)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (15)..(15) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 9 caggguuuu acccuauggu ag 22 <210> 10 <211> 21 <212> DNA <213> Homo sapiens <400> 10 cugaccuaug aauugacagc c 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-192 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (2)..(2) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (9)..(9) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(14) <223> halouracil nucleotides <400> 11 cugaccuaug aauugacagc c 21 <210> 12 <211> 21 <212> DNA <213> Homo sapiens <400> 12 auccuugcua ucugggugcu a 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-502 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (2)..(2) <223> halouracil nucleotides <220> <221> misc_feature <222> (5)..(6) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 13 auccuugcua ucugggugcu a 21 <210> 14 <211> 22 <212> DNA <213> Homo sapiens <400> 14 uauucaggaa gguguuacuu aa 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-506 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (3)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (15)..(16) <223> halouracil nucleotides <220> <221> misc_feature <222> (19)..(20) <223> halouracil nucleotides <400> 15 uauucaggaa gguguuacuu aa 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-140 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (4)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(10) <223> halouracil nucleotides <220> <221> misc_feature <222> (15)..(15) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 16 caggguuuu acccuauggu ag 22 <210> 17 <211> 22 <212> DNA <213> Homo sapiens <400> 17 uggcaguguc uuagcugguu gu 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-34 nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (9)..(9) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(12) <223> halouracil nucleotides <220> <221> misc_feature <222> (16)..(16) <223> halouracil nucleotides <220> <221> misc_feature <222> (19)..(20) <223> halouracil nucleotides <220> <221> misc_feature <222> (22)..(22) <223> halouracil nucleotides <400> 18 uggcaguguc uuagcugguu gu 22 <210> 19 <211> 22 <212> DNA <213> Homo sapiens <400> 19 uaacacuguc ugguaacgau gu 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-200a nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (9)..(9) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <220> <221> misc_feature <222> (22)..(22) <223> halouracil nucleotides <400> 20 uaacacuguc ugguaacgau gu 22 <210> 21 <211> 22 <212> DNA <213> Homo sapiens <400> 21 uaauacugcc ugguaaugau ga 22 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-200b nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (4)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 22 uaauacugcc ugguaaugau ga 22 <210> 23 <211> 23 <212> DNA <213> Homo sapiens <400> 23 uaauacugcc ggguaaugau gga 23 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-200c nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (4)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 24 uaauacugcc ggguaaugau gga 23 <210> 25 <211> 23 <212> DNA <213> Homo sapiens <400> 25 guccaguuuu cccaggaauc ccu 23 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-145 nucleic acid with modified uracils <220> <221> misc_feature <222> (2)..(2) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(10) <223> halouracil nucleotides <220> <221> misc_feature <222> (19)..(19) <223> halouracil nucleotides <220> <221> misc_feature <222> (23)..(23) <223> halouracil nucleotides <400> 26 guccaguuuu cccaggaauc ccu 23 <210> 27 <211> 22 <212> DNA <213> Homo sapiens <400> 27 uguaacagca acuccaugug ga 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-194 nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (3)..(3) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (19)..(19) <223> halouracil nucleotides <400> 28 uguaacagca acuccaugug ga 22 <210> 29 <211> 22 <212> DNA <213> Homo sapiens <400> 29 ugagguagua gguuguauag uu 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> an exemplary modified microRNA-let-7 nucleic acid with modified uracils <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (6)..(6) <223> halouracil nucleotides <220> <221> misc_feature <222> (9)..(9) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (16)..(16) <223> halouracil nucleotides <220> <221> misc_feature <222> (18)..(18) <223> halouracil nucleotides <220> <221> misc_feature <222> (21)..(22) <223> halouracil nucleotides <400> 30 ugagguagua gguuguauag uu 22

Claims (17)

A nucleic acid composition comprising a modified microRNA nucleotide sequence comprising at least one uracil nucleic acid, wherein the at least one uracil nucleic acid is 5-halouracil. The composition of claim 1 , wherein the 5-halouracil is 5-fluorouracil. The composition of claim 1 , wherein at least two of the uracil nucleic acids in the nucleotide sequence are 5-halouracil. 4. The composition of claim 3, wherein at least three of the uracil nucleic acids in the nucleotide sequence are 5-halouracil. 5. The composition of claim 4, wherein at least four of the uracil nucleic acids in the nucleotide sequence are 5-halouracil. 6. The composition of claim 5, wherein all uracil nucleic acids in the nucleotide sequence are 5-halouracil. The method of claim 1, wherein the modified microRNA nucleotide sequence is miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502, miR-506, miR-34, miR-200a, A nucleic acid composition comprising a microRNA nucleotide sequence selected from the group consisting of miR-200b, miR-200c, miR-145, miR-194 and miR-let-7. 8. The composition of claim 7, wherein the 5-halouracil is 5-fluorouracil. 8. The nucleic acid composition of claim 7, wherein the modified microRNA nucleotide sequence is selected from the group consisting of:
CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],
CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],
U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6],
UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7],
CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],
CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],
AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13],
U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15],
CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16],
UFGGCAGUFGUFCUFUFAGCUFGGUFUFGUF [SEQ ID NO. 18],
U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20],
U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22],
U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24],
GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26],
U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28], and
U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30]. A pharmaceutical composition comprising at least one nucleic acid composition according to claim 1 . 11. The pharmaceutical composition of claim 10, wherein the nucleic acid composition comprises a modified microRNA nucleotide sequence selected from the group consisting of:
CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],
CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],
U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6],
UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7],
CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],
CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],
AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13],
U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15],
CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16],
UFGGCAGUFGUFCUFUFAGCUFGGUFUFGUF [SEQ ID NO. 18],
U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20],
U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22],
U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24],
GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26],
U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28], and
U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30]. A method of treating cancer comprising administering to a subject an effective amount of the nucleic acid composition according to claim 1 , wherein the subject has cancer, and the progression of the cancer is inhibited. The method of claim 12 , wherein the subject is a human. The method of claim 12 , wherein the subject has a cancer selected from the group consisting of colon cancer, stomach cancer, pancreatic cancer, lung cancer, blood cancer, and breast cancer. 13. The method of claim 12, wherein the nucleic acid composition comprises a modified microRNA nucleotide sequence selected from the group consisting of:
CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],
CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],
U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6],
UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7],
CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],
CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],
AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13],
U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15],
CAGU ^F GGU ^F U ^F U ^F U ^F ACCCU ^F AU ^F GGU ^F AG [SEQ ID NO. 16],
UFGGCAGUFGUFCUFUFAGCUFGGUFUFGUF [SEQ ID NO. 18],
U ^F AACACU ^F GU ^F CU ^F GGU ^F AACGAU ^F GU ^F [SEQ ID NO. 20],
U ^F AAU ^F ACU ^F GCCU ^F GGU ^F AAU ^F GAU ^F GA [SEQ ID NO. 22],
U ^F AAU ^F ACU ^F GCCGGGU ^F AAU ^F GAU ^F GGA [SEQ ID NO. 24],
GU ^F CCAGU ^F U ^F U ^F U ^F CCCAGGAAU ^F CCCU ^F [SEQ ID NO. 26],
U ^F GU ^F AACAGCAACU ^F CCAU ^F GU ^F GGA [SEQ ID NO. 28],
U ^F GAGGU ^F AGU ^F AGGU ^F U ^F GU ^F AU ^F AGU ^F U ^F [SEQ ID NO. 30], and
combinations of these. The method of claim 12 , wherein the nucleic acid composition is administered to the subject by injection. The method of claim 16 , wherein the nucleic acid composition is injected intravenously or intraperitoneally.

Images