KR102502248B1 - 5-haluracil-modified microRNA and its use in cancer treatment - Google Patents

Abstract

The present invention provides nucleic acid compositions comprising one or more molecules of halouracil. More specifically, the present invention reveals that replacement of uracil with 5-haluracil in a microRNA nucleotide sequence increases the ability of the microRNA to inhibit cancer progression and tumor formation. As such, the present invention provides various nucleic acid (e.g., microRNA) compositions in which 5-haluracil molecules are incorporated into the nucleic acid sequence and methods of using the same. The present invention also provides pharmaceutical compositions (e.g., formulations) comprising the modified nucleic acid composition and methods for treating cancer such as colorectal cancer, pancreatic cancer and lung cancer.

Description

5-haluracil-modified microRNA and its use in cancer treatment

CROSS REFERENCES TO RELATED APPLICATIONS

[0001] This application is based on U.S. Provisional Application No. 62/464,491, dated February 28, 2017, U.S. Provisional Application No. 62/422,298, dated November 15, 2016, and dated November 1, 2016, the entire contents of which are incorporated herein by reference. Priority is claimed from US provisional application Ser. No. 62/415,740.

government support

[0002] This invention was made with government support under Grant Nos. HL127522 and CA197098 awarded by the National Institutes of Health. The government has rights in this invention.

Include sequence listing reference

[0003] A sequence listing in an ASCII text file named R8859_PCT_SequenceListing.txt of 7 KB, filed on October 30, 2017 and submitted to the US Patent and Trademark Office via EFS-Web is incorporated herein by reference.

Field of the Invention

[0004] The present invention relates generally to compositions and methods for treating cancer, and more particularly, the modified microRNA alone or in combination with 5-fluorouracil to treat cancer, particularly cancer of the rectum, lung or pancreas. It's about the method used to do it.

[0005] MicroRNAs (miRNAs, miRs) are highly conserved non-regulating translations in cells or organisms that negatively regulate the expression of their target genes, thereby causing translational disruption, mRNA cleavage, or a combination thereof. It is a class of coding small RNA molecules. [Bartel DP. Cell. (2009) 136(2):215-33. By targeting multiple transcripts, miRNAs regulate a diverse range of biological processes including apoptosis, differentiation and cell proliferation, and thus aberrant microRNA function can lead to cancer ([Ambros V. Nature. (2004) 431 (7006):350-5]), thus recently miRNAs have been identified as biomarkers, oncogenes or tumor suppressors. See, eg, Croce, CM, Nat Rev Genet. (2009) 10:704-714].

Colorectal cancer (CRC) is the third most common malignancy and the second most common cause of cancer-related death in the United States. [Hegde SR, et al., Expert review of gastroenterology & hepatology. (2008) 2(1):135-49]. Although there are many chemotherapeutic agents used to treat cancer, pyrimidine antagonists, such as fluoropyrimidine-based chemotherapeutic agents (e.g., 5-fluorouracil, S-1), represent the standard for treating colorectal cancer. (gold standard). Pyrimidine antagonists block the synthesis of nucleotides containing pyrimidines (cytosine and thymine in DNA and cytosine and uracil in RNA). Because pyrimidine antagonists have similar structures compared to endogenous nucleotides, they compete with natural pyrimidines to inhibit key enzymatic activities involved in the replication process, resulting in inhibition of DNA and/or RNA synthesis and inhibition of cell division.

[0007] Pancreatic cancer is a fatal cancer that is very difficult to treat. [Siegel, R L et al. CA Cancer J. Clin. (2015) 65: 5-29]. Distinctive aspects of pancreatic cancer include a very low 5-year survival rate of less than 7% (ld.), late onset of symptoms, early metastases, and poor response to chemotherapy and radiotherapy. [Maitra A and Hruban RH, Annu Rev. Pathol. (2008) 3:157-188]. Until now, gemcitabine-based chemotherapy (2',2'-difluoro 2'-deoxycytidine) has been a representative standard for pancreatic cancer treatment, but the therapeutic intervention effect is limited due to drug resistance. [Oettle, H et al. JAMA (2013) 310: 1473-1481].

[0008] 5-Fluorouracil (i.e., 5-FU, or more specifically, 5-fluoro-1H-pyrimidine-2,4-dione) is used in many adjuvant chemotherapy treatments, such as Carac® cream. , a well-known pyrimidine antagonist used in Efudex®, Fluoroplex® and Adrucil®. 5-FU targets thymidylate synthase (TYMS or TS), an important enzyme that catalyzes the methylation of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP), an essential step in DNA biosynthesis. It is well known that doing [Danenberg P. V., Biochim. Biophys. Acta. (1977) 473(2):73-92]. However, despite steady improvements in 5-FU-based therapies, patient response rates to 5-FU-based chemotherapy are still lukewarm due to the development of drug resistance. [Longley D. B, et al., Apoptosis, Cell Signaling, and Human Diseases, (2007) p. 263-78].

[0009] Nonetheless, existing cancer therapies are still in their infancy and there are still many hurdles waiting to be improved or overcome. For example, although 5-FU is quite effective in treating various cancers, it is well known that 5-FU has substantial toxicity and can cause many side effects. With regard to miRNAs, these compounds are known to be likely to undergo enzymatic degradation upon administration, resulting in poor stability. It is also known that tumor cells evade the apoptotic pathway by developing resistance to common therapeutic agents such as 5-FU and gemcitabine. See Gottesman M. M. et al., Nature Reviews Cancer, (2002) 2(1):48-58. Therefore, more effective, stable, and less toxic drugs would be of great benefit for the treatment of cancer.

Summary of Invention

[0010] The present invention demonstrates that a nucleic acid composition (ie, microRNA) comprising 5-haluracil base has excellent efficacy as an anticancer agent. Moreover, the data of the present invention demonstrate that contacting cells with the modified microRNA compositions of the present invention modulates cell cycle progression and reduces tumor development, e.g., by reducing cancer cell proliferation and increasing the efficacy of chemotherapeutic agents. show The present invention is predicated on the discovery that the incorporation of 5-haluracil base into the nucleotide sequence of a microRNA increases the efficacy of the microRNA as an anti-cancer agent compared to the anti-cancer agent alone and/or native microRNA.

[0011] Therefore, in one aspect of the invention, a modified microRNA nucleotide sequence having one or more uracil bases (U, U bases) replaced with 5-haluracil, such as 5-fluorouracil (5-FU) A nucleic acid composition comprising is described. In certain embodiments, the modified microRNA has one or more uracils or exactly one uracil replaced with 5-haluracil. In some embodiments, the modified microRNA nucleotide sequence comprises 2, 3, 4, 5, 6, 7, 8 or more uracil bases replaced with 5-haluracil. In another embodiment, all uracil nucleotide bases of the modified mRNA are replaced with 5-haluracil.

[0012] In some embodiments, the 5-haluracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-haluracil is 5-fluorouracil.

[0013] In certain embodiments, the modified microRNA nucleotide sequence comprises one or more 5-haluracils, whereby each of the 5-haluracils is identical. In another embodiment, the modified microRNA nucleotide sequence comprises one or more 5-haluracils, whereby each of the 5-haluracils is different. In another embodiment, the modified microRNA nucleotide sequence comprises two or more 5-haluracils, whereby the modified microRNA nucleotide sequence comprises a combination of different 5-haluracils.

[0014] In one exemplary embodiment of the present invention, a nucleic acid composition containing a modified miR-129 nucleotide sequence by replacing one or more uracil nucleotide bases with 5-haluracil is provided. More specifically, the nucleic acid composition comprises at least the native miR-129 nucleotide sequence:

CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. One]

wherein at least one, two, three, four, five, six, seven, eight or all of the uracil bases in, or covalently linked to, the nucleic acid sequence shown above are 5 -Replaced by halluracil.

[0015] In a specific embodiment of the present invention, the modified microRNA,

CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0016] In another embodiment, the modified miR-129 nucleotide sequence, while the seed portion of the native miR-129 nucleotide sequence, GUUUUUGC, remains unmodified (i.e., does not contain 5-haluracil). One or more (or all) of the remaining uracil nucleotide bases in the remainder of are replaced with the same number of 5-haluracils. In a specific embodiment, the modified miR-129 microRNA of the present invention,

CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5], whereby U ^F is halouracil, specifically 5-fluorouracil.

[0017] In some embodiments, the 5-haluracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-haluracil is 5-fluorouracil.

[0018] In another embodiment of the invention, a nucleic acid containing a miR-15a nucleotide sequence modified by replacing one or more of the uracil nucleotide bases with 5-haluracil, such as 5-fluorouracil (5-FU) A composition is provided. Specifically, the nucleic acid composition comprises at least the native miR-15a nucleotide sequence:

UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2], wherein at least one, two, three, four, five, six or all of the uracil nucleotide bases in, or covalently linked to, the sequence shown above are 5-hollow it's rassil

[0019] In a specific embodiment of the present invention, the modified miR-15a microRNA,

U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 6], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0020] In another embodiment, the seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with 5-haluracil, while the rest of the miR-15a nucleotide sequence (non-seed portion) ), one or more (or all) of the remaining uracil bases are replaced by 5-haluracil.

[0021] In a specific embodiment, the modified miR-129 microRNA is

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0022] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the native miR-140 nucleotide sequence has been modified by replacing one or more of the U bases with 5-haluracil.

[0023] In one set of embodiments, exactly one of the U bases in the native miR-140 nucleic acid sequence is 5-haluracil. In a second set of embodiments, exactly 2 or 2 or more U bases in the native miR-140 nucleotide sequence are replaced with 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-140 nucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the native miR-140 nucleotide sequence are 5-haluracil. In some embodiments, exactly 5 or more than 5 U bases in the miR-140 nucleotide sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-140 nucleotide sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-140 nucleotide sequence, whether in native parts and/or in attached parts, are 5-haluracil.

[0024] In one exemplary embodiment, the modified microRNA nucleic acid composition of the present invention,

CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0025] In another exemplary embodiment, the present invention provides a nucleic acid composition comprising a modified native miR-192 or miR-215 nucleotide sequence modified by replacing one or more of the uracil bases with 5-haluracil. It is about. In some embodiments, the modified miR-192 nucleotide sequence is modified by replacing one or more of the U bases with 5-fluorouracil.

[0026] In another set of embodiments, exactly one of the U bases in the modified miR-192 nucleotide sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the modified miR-192 nucleotide sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the modified miR-192 nucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the modified miR-192 or miR-215 nucleotide sequence are 5-haluracil. In a specific embodiment, all of the U bases of the modified miR-192 or miR-215 sequence, whether in native and/or appended portions of the nucleic acid, are 5-haluracil.

[0027] In one exemplary embodiment, the nucleic acid composition of the present invention,

CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0028] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified native miR-502 nucleotide sequence modified by replacing uracil with 5-haluracil. In some embodiments, the modified miR-502 nucleotide sequence is modified by replacing one or more of the U bases with 5-fluorouracil.

[0029] In another set of embodiments, exactly one of the U bases in the miR-502 nucleotide sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-502 nucleotide sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-502 nucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-502 nucleotide sequence are 5-haluracil. In another embodiment, exactly 5 or more than 5 U bases in the miR-502 nucleotide sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-502 nucleotide sequence are 5-haluracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-502 nucleotide sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-502 nucleotide sequence, whether in native parts and/or in attached parts, are 5-haluracil.

[0030] In one exemplary embodiment, the modified miR-502 nucleic acid composition of the present invention,

AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], wherein U ^F is halouracil, specifically 5-fluorouracil.

[0031] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence comprising 5-haluracil. In some embodiments, the modified miR-506 nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil, such as 5-fluorouracil.

[0032] In another set of embodiments, exactly one of the U bases in the native miR-506 nucleotide sequence is replaced with 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In another embodiment, exactly 5 or more than 5 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In another embodiment, exactly 7 or more than 7 U bases in the modified miR-506 nucleotide sequence are 5-haluracil. In a specific embodiment, all of the U bases of the modified miR-506 nucleotide sequence, whether in native and/or appended portions, are 5-haluracil.

[0033] In one exemplary embodiment, the miR-506 nucleic acid composition of the present invention,

U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15], where U ^F is halouracil, specifically 5-fluorouracil.

[0034] In some embodiments, the 5-haluracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, or 5-iodouracil. In certain embodiments, the 5-haluracil is 5-fluorouracil, or a combination thereof.

[0035] The present invention also relates to a formulation comprising a formulation of the modified microRNA composition described herein or a combination thereof. In certain embodiments, the formulation may include a pharmaceutical formulation comprising the aforementioned nucleic acid composition and a pharmaceutically acceptable carrier.

[0036] In another aspect, the present invention relates to a method of treating cancer comprising administering to a subject an effective amount of one or more nucleic acid compositions described herein. In certain embodiments of the method of the invention, the nucleic acid composition comprises a modified miR-129, miR-15a, miR-192, miR-215, miR-140, miR-502 or miR-506 nucleotide sequence, wherein 1, 2, 3, 4, 5, 6 or more uracil nucleotide bases of the native (unmodified) nucleotide sequence are replaced with 5-haluracil. In certain embodiments, the methods of the invention comprise administering to a subject suffering from or predisposed to cancer a nucleic acid composition of the invention, whereby the nucleic acid composition is modified miR-129 or modified miR-15a is a nucleic acid In a specific embodiment of the invention, the modified microRNA administered is

CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4],

CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5],

U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6],

UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7],

CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9],

CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11],

AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], and

U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15] has a nucleic acid sequence selected from the group consisting of.

[0037] In certain embodiments, the subject is a mammal. In another embodiment, the subject to be treated is a human, dog, horse, pig, mouse or rat. In certain embodiments, the subject is a human who has been diagnosed with cancer or has been identified as having a predisposition to develop cancer. In some embodiments, the cancer to be treated may be, for example, colorectal cancer, gastric cancer, esophageal cancer, lung cancer, ovarian cancer, pancreatic cancer, or uterine cancer. In certain embodiments, the methods of the present invention treat a subject for colorectal cancer, pancreatic cancer, or breast cancer.

[0038] The data provided in the present invention surprisingly show that the modified microRNAs described in the present invention increase the efficacy of the modified microRNAs described in the present invention when compared to known anti-cancer agents such as 5-FU alone in several different cancer models including colorectal cancer, pancreatic cancer and lung cancer. show efficacy. For example, the present invention provides that the modified nucleic acid composition described above is more effective than 5-FU, miR-15a, miR-129, miR-140, miR-192, miR-215, miR-502 or miR-506 alone. , or the combination of 5-FU and the corresponding native microRNAs are substantially more potent in inhibiting cancer progression and tumorigenesis.

[0039] As such, the compositions and methods of the present invention provide the additional advantage of allowing lower dosages, which result in lower toxicity and reduced side effects. Another important advantage exhibited by the nucleic acid composition described above is that the composition exhibits greatly enhanced potency compared to miR-140, miR-192, miR-215, miR-502 or miR-506 sequences that are not modified with halouracil. is to have Thus, at least in light of the aforementioned advantages, the nucleic acid compositions disclosed herein represent substantial advances in cancer treatment.

Brief description of the drawing

[0040] Figures 1a to 1h. Chemical representations of exemplary modified microRNA nucleotide sequences of the present invention. (a) Chemical representation of the miR-129 nucleotide sequence, as described in SEQ ID NO: 4, in which all U bases are replaced with halouracil (i.e., UF). (b) chemical representation of miR-129 with a U base in which only the non-seed portion of miR-129 is replaced with halouracil, as described in SEQ ID NO: 5 (c) as described in SEQ ID NO: 6, all Chemical representation of miR-15a nucleotide sequence in which U bases are replaced with halouracil, (d) miR-15a with U bases in which only the non-seed portion of miR-15a is replaced with halouracil, as described in SEQ ID NO: 7 Chemical representation of 15a. (e) Chemical representation of the miR-140 nucleotide sequence in which specific 3 U bases have been replaced with halouracil, as described in SEQ ID NO: 9. (f) Chemical representation of the miR-192 nucleotide sequence, as described in SEQ ID NO: 11, wherein 5 U bases are replaced with halouracil. (g) Chemical representation of the miR-502 nucleotide sequence, as described in SEQ ID NO: 13, in which specific 7 U bases have been replaced with halouracil. (h) Chemical representation of the miR-506 nucleotide sequence, as described in SEQ ID NO: 15, in which all (i.e., 8) U bases have been replaced with halouracil.

[0041] Figures 2a-c. Exemplary modified miR-129 nucleic acids enter cancer cells and effectively reduce target protein expression. (a) Target (E2F3) specificity and performance of modified miR-129 (all U bases replaced with 5-FU, 5-FU-miR-129) compared to that of control miRNA and unmodified miR-129 nucleic acid graph showing. (b) Quantitative real-time PCR analysis showing that miR-129 mimics enter cancer cells. (c) miR-129 mimics enter cancer cells and degrade TS-FdUMP significantly better than 5-FU alone.

) 및 이상 발현된 (ectopically expressed) 본연의 miR-129 (○)에 비하여, 모든 U 염기가 5-FU로 대체된 예시적인 변형된 miR-129 핵산 (모방체)(

)에 의하여 4 가지 상이한 대장암 세포주 (HCT116, RKO, SW480 및 SW620)에서 대장암 세포 증식이 억제됨을 보여주는 그래프. Figure 3. Non-specific control (negative control,

) and ectopically expressed native miR-129 (○), an exemplary modified miR-129 nucleic acid (mimic) in which all U bases are replaced with 5-FU (

A graph showing the inhibition of colon cancer cell proliferation in four different colon cancer cell lines (HCT116, RKO, SW480 and SW620) by ).

4. Combination therapy with 5-FU and the modified microRNA composition of the present invention effectively inhibits cancer cell proliferation. Negative control (NC), native miR-129, 5-FU, an exemplary modified miR-129 nucleic acid mimic of the present invention (5-FU-miR-129), and 5-FU and an exemplary miR of the present invention Graphical comparison of colorectal cancer cell proliferation for cancer cells treated with the combination of -129 mimics (5-FU-miR-129 + 5-FU).

[0044] Figures 5a-b. Exemplary microRNA mimics induce apoptosis and cause cell cycle arrest in colorectal cancer cells. (a) Cell death was quantified by FITC-Annexin V apoptosis assay, and in several different colorectal cancer cell lines, the modified miR-129 nucleic acid composition of the present invention was significantly higher than the negative control, or overexpressed native miR-129. It has been shown to induce apoptosis of cancer cells at high levels. (b) Flow cytometric analysis was performed to reveal that the modified miR-129 nucleic acid composition of the present invention (Mimetic-1) increases G1 cell cycle arrest to a significantly higher level than either the negative control or overexpressed native miR-129. .

[0045] Figure 6. The modified microRNA nucleic acid composition of the present invention eliminates chemotherapy resistant cancer stem cells. HCT116-derived colorectal cancer stem cells were treated with increasing concentrations of an exemplary modified miR-129 nucleic acid (○) or 5-FU (●) of the present invention. The results show that the modified miR-129 nucleic acid killed 5-FU resistant cancer stem cells in a dose dependent manner.

[0046] Figure 7. In vivo ( in vivo ) systemic treatment using an exemplary modified miR-129 nucleic acid composition inhibits colorectal cancer metastasis without toxic side effects. A mouse model of colorectal cancer metastasis was established through tail vein injection of metastatic human colorectal cancer cells. Two weeks after metastasis was established, 40 μg of the modified miR-129 nucleic acid composition as described in SEQ ID NO: 4 was delivered by intravenous injection at a treatment frequency of 1 injection every other day for 2 weeks. The exemplary modified miR-129 nucleic acid (mimic) was able to inhibit colon cancer metastasis (right panel), whereas the negative control miRNA (left panel) had no effect. Mice treated with the modified miR-129 nucleic acid did not show any toxicity.

[0047] Figures 8a-b. Exemplary second anticancer activity of the modified microRNA of the present invention. (A) Representative Western blot comparing the ability of unmodified miR-15a (miR-15a) and the modified miR-15a nucleic acid composition (mimic-1) to regulate protein expression in colon cancer cells. Ability of modified miR-15a (mimetic-1) as described in SEQ ID NO: 6 to regulate miR-15a targets (YAP1, BMI-1, DCLK1 and ECL2) and degrade TS-FdUMP in colorectal cancer cells holds (b) Ability of modified miR-15a (mimic-1) to inhibit colorectal cancer cell proliferation in three different colorectal cancer cell lines (HCT116, RKO, SW620) compared to unmodified miR-15a (miR-15a) showed this strengthening.

Figure 9. Cell cycle for control (negative), unmodified miR-15a (miR-15a) and an exemplary modified miR-15a nucleic acid composition as described in SEQ ID NO: 6 (Mimic-1) Graph showing control. Modified miR-15a nucleic acids, as shown by the increase in G1/S ratio exhibited by colon cancer cells expressing modified miR-15a, when compared to cells aberrantly expressing native miR-15a and negative controls. Administration of induced cell cycle arrest compared to unmodified miR-15a.

[0049] Figure 10. Altered miR-15a expression reduces the ability of cancer stem cells to induce cancer cell colony formation. In colorectal cancer stem cells, expression of unmodified miR-15a (miR-15a) inhibited cancer cell colony formation compared to the ability of cancer stem cells provided using a non-specific control microRNA (negative). Treatment with an exemplary modified miR-15a (5-FU-miR-15a) of the present invention completely prevented cancer cell colony formation.

11. Modified miR-15a is an effective anti-cancer agent in vivo. A mouse model of colorectal cancer metastasis was established through tail vein injection of metastatic human colorectal cancer cells. Two weeks after metastasis was established, 40 μg of the modified miR-15a nucleic acid composition as described in SEQ ID NO:6 was delivered by intravenous injection at a treatment frequency of 1 injection every other day for 2 weeks. An exemplary modified miR-15a nucleic acid (mimic) was able to inhibit metastasis of colorectal cancer, whereas a negative control miRNA (negative) had no effect. Mice treated with the modified miR-15a nucleic acid did not show any toxicity.

[0051] Figures 12a-d. Exemplary modified miR-15a and miR-129 mimics of the present invention compared to cells treated with unmodified miR-15a (miR-15a) or unmodified miR-129 (miR-129) or a negative control in humans. of breast cancer cells (A549; c, d) and pancreatic cancer cells (Panc-1 (a); AsPC-1 (b)).

[0052] Figures 13a-b. Exemplary modified microRNAs of the present invention exhibit enhanced ability to inhibit human colon cancer cell proliferation. Additional exemplary modified microRNAs were tested for their ability to inhibit colon cancer cell proliferation in HCT116 human colon cancer cells. (a) When an exemplary modified miR-140 mimic described as SEQ ID NO: 9 was administered to human colon cancer cells and compared to a negative control microRNA, it was found that the ability to inhibit colon cancer cell proliferation was increased . (b) When an exemplary modified miR-192 mimic described as SEQ ID NO: 11 was administered to human colon cancer cells and compared to a negative control microRNA, it was found that the ability to inhibit colon cancer cell proliferation was increased .

[0053] Figures 14a-d. Exemplary modified microRNAs of the present invention exhibit enhanced ability to inhibit human pancreatic cancer and breast cancer cell proliferation. Additional exemplary modified microRNAs were tested for their ability to inhibit several types of human cancer by examining their effect on cancer cell proliferation. An exemplary modified miR-502 mimic described by SEQ ID NO: 13 was administered to human pancreatic cancer cells (PANC1, a) and human breast cancer (A549, c) and compared to the negative control microRNA, both types It was found that the ability to inhibit the proliferation of cancer cells increased. Another exemplary modified microRNA, miR-506 mimic described as SEQ ID NO: 15, was administered to human pancreatic cancer cells (PANC1, b) and human breast cancer (A549, d) and compared to negative control microRNA When administered, it was found to increase the ability to inhibit the proliferation of both types of cancer cells.

DETAILED DESCRIPTION OF THE INVENTION

[0054] The present invention provides nucleic acid compositions comprising one or more molecules of halouracil. Without being bound by any one particular theory, surprisingly, the present invention suggests that replacing uracil nucleotides in a microRNA oligonucleotide sequence with 5-haluracil improves the ability of the microRNA to inhibit cancer, onset, progression and tumorigenesis. It was found to increase As such, the present invention provides various nucleic acid (eg, microRNA) compositions having 5-haluracil molecules incorporated within their nucleic acid sequences and methods for using them. The invention also provides a pharmaceutical composition comprising a formulation, such as a modified nucleic acid composition, and a method of treating cancer comprising administration of said pharmaceutical composition to a subject in need thereof.

nucleic acid composition

[0055] The term "microRNA" or "miRNA" or "miR" refers to a messenger RNA molecule (mRNA), a small non-coding ribose nucleic acid (RNA) molecule capable of regulating the expression of a gene through interaction with DNA or protein. are used interchangeably to refer to Typically, microRNAs consist of nucleic acid sequences of about 19-25 nucleotides (bases) and are found in mammalian cells.

[0056] The terms "modified microRNA", "modified miRNA", "modified miR" or "mimic" refer to a microRNA different from a native or endogenous microRNA (unmodified microRNA) polynucleotide. are used interchangeably in the present invention for More specifically, in the present invention, the modified microRNA differs from the unaltered or unmodified microRNA nucleic acid sequence by one or more bases. In some embodiments of the invention, modified microRNAs of the invention comprise one or more uracil (U) nucleotide bases replaced with 5-haluracil. In another embodiment, the modified microRNA comprises additional nucleotides (i.e., adenine (A), cytosine (C), uracil (U) and guanine (G)) and one or more uracil bases substituted with 5-haluracil. do.

[0057] In one aspect of the invention, a modified microRNA nucleotide sequence having one or more uracil bases (U, U bases) replaced with 5-haluracil, such as 5-fluorouracil (5-FU), is Nucleic acid compositions comprising As discussed further herein, the nucleic acid compositions of the present invention are useful in the treatment of at least cancer, particularly colorectal cancer, pancreatic cancer and breast cancer.

[0058] In some embodiments, the nucleic acid composition contains a nucleotide sequence that has been modified by derivatizing one or more uracil nucleobase groups at the 5-position with a group that provides an effect similar to that of a halogen atom. In some embodiments, the groups that provide similar effects are of similar magnitude to halogen atoms in weight or spatial dimension, such as 20, 30, 40, 50, 60, 70, 80, 90 or less, or 80 g /mol or less. In certain embodiments, a group that provides a similar effect to a halogen atom is, for example, a methyl group, a trihalomethyl group (eg, a trifluoromethyl group), a pseudohalide (eg, trifluoromethanesulfonate, cyano or cyanate). ) or a deuterium (D) atom. Groups that provide effects similar to halogen atoms may be present in addition to or in the absence of 5-haluracil bases in the microRNA nucleotide sequence.

[0059] In addition, in another embodiment, a group providing an effect similar to a halogen atom may be located in the native (or seed) portion and/or accessory portion of the microRNA nucleotide sequence, which is common in the art. will be easily identified by those who have knowledge of In some embodiments, one or more (or all) of these types of groups that provide similar effects to halogen atoms are excluded from the modified miRNA nucleotide sequence. When all these alternative groups are excluded, only one or more halogen atoms are present as substituents at the 5-position of one or more uracil groups in the microRNA nucleotide sequence.

[0060] In certain embodiments, the modified microRNA has more than one or exactly one uracil replaced with 5-haluracil.

[0061] In some embodiments, the modified microRNA nucleotide sequence comprises 3, 4, 5, 6, 7, 8 or more uracil bases replaced with 5-haluracil.

[0062] In another embodiment, all uracil nucleotide bases of the modified mRNA are replaced with 5-haluracil.

[0063] In some embodiments, 5-haluracil is, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil. In certain embodiments, the 5-haluracil is 5-fluorouracil.

[0064] As used herein, the term "miR-129" means synonymous with "microRNA-129" or "miRNA-129", and refers to an oligonucleotide having the following nucleotide sequence:

CUUUUUGCGGUCUGGGCUUGC [SEQ ID NO. One],

It is understood here that C = cytosine, U = uracil and G = guanine base. The above nucleotide sequence refers to the unmodified (i.e., "native") miR-129 sequence in the present invention unless otherwise specified. miR-129 may also be referred to in this field as hsa-miR-129 or hsa-miR-129-5p, with accession numbers MI0000252 and MIMAT0000242. MiR-129 is well known and has been studied in detail. For example, [J. See Wu et al., Cell Cycle , (2010) 9:9, 1809-1818. As is well known in the art, the miR-129 sequence can be modified to create a "miR-129 mimic", which has a sequence modified from the native sequence but retains the known function or activity of native miR-129. hold Unless otherwise stated, all such modified miR-129 compositions are considered within the scope of the term "miR-129 mimic" as used herein.

[0065] Certain modified miR-129 nucleic acid sequences (mimics) of the nucleic acid sequence of interest are those miR-129 native sequences, such as CUUUUUGCGGUCUGGGCUUGC-UU [SEQ ID NO. 3] covalently appended to the terminus of two U bases (i.e., two U-containing nucleotides). In this sequence, the two terminal U bases contiguous or extend the native miR-129 sequence from 21 nucleotide bases to 23 nucleotide bases. Typically, the miR-129 mimic contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the miR-129 native sequence (i.e., as additional nucleotides), wherein the additional The bases may be selected from C, U, G, and independently from C, or the additional bases may be exclusively U. Typically, the miR-129 is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0066] In one embodiment, the present invention relates to a nucleic acid composition comprising a miR-129 nucleotide sequence modified by replacing one or more of its uracil nucleobases (i.e., U bases) with 5-haluracil. , ie wherein at least one of the U bases in the miR-129 sequence is 5-haluracil, either in its native part and/or in its appendage. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0067] In a first set of embodiments, exactly one of the U bases in the miR-129 sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-129 nucleotide sequence are 5-haluracil. In a third set of embodiments, exactly 3 or more than 3 U bases in the miR-129 nucleotide sequence are 5-haluracil. In a fourth embodiment, exactly 4 or more than 4 U bases in the miR-129 nucleotide sequence are 5-haluracil. In a fifth embodiment, exactly 5 or more than 5 U bases in the miR-129 nucleotide sequence are 5-haluracil. In a sixth embodiment, all of the U bases of the miR-129 nucleotide sequence, whether in the native part and/or in the appended part, are 5-haluracil.

[0068] In a specific embodiment, the nucleic acid composition of the present invention is SEQ ID NO. ^{4 , wherein U F is} halouracil ^, specifically 5 ^{- fluorouracil .}

[0069] The U bases replaced with 5-haluracil in the miR-129 sequence can be located in the unmodified portion of the miR-129 sequence, as shown above, or, in the case of a miR-129 mimic, also the As suggested, it may be located on one or more U bases covalently appended to native miR-129. In another embodiment, the seed portion of the native miR-129 nucleotide sequence, GUUUUUGC, remains unmodified with 5-haluracil, while one of the remaining U bases in the remainder of the miR-129 nucleotide sequence The above (or all) are replaced with equivalent numbers of 5-haluracil.

[0070] For example, in certain embodiments, the nucleic acid composition of the present invention is SEQ ID NO. 5 ^, whereby U ^{F is} halouracil, ^specifically 5 ^- fluorouracil.

[0071] In another embodiment, the nucleic acid composition contains a modified miR-129 nucleotide sequence by derivatizing one or more of the uracil (U) nucleobases at the 5-position with a group that provides a halogen atom-like effect. do. In some embodiments, the groups that provide similar effects are of similar magnitude to halogen atoms in weight or spatial dimension, such as 20, 30, 40, 50, 60, 70, 80, 90 or less, or 80 g /mol or less. Such groups that provide similar effects to halogen atoms are, for example, methyl groups, trihalomethyl groups (eg trifluoromethyl groups), pseudohalides (eg trifluoromethanesulfonates, cyano or cyanates) or deuterium (D ) can be atoms. This group, which provides a similar effect to a halogen atom, may be present in the miR-129 nucleotide sequence in addition to or in the absence of a 5-haluracil base. In addition, the group providing an effect similar to a halogen atom may be located in the native (or seed) portion and/or accessory portion of the miR-129 nucleotide sequence. In some embodiments, one or more (or all) of these types of groups that provide similar effects to halogen atoms are excluded from the miR-129 nucleotide sequence. When all these alternative groups are excluded, only one or more halogen atoms are present as substitutes at the 5-position of one or more uracil groups in the miR-129 nucleotide sequence.

[0072] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-15a nucleotide sequence. In some embodiments, the miR-15a nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil.

[0073] As used herein, the term "miR-15a" means synonymous with "microRNA-15a" or "miRNA-15a", and refers to an oligonucleotide having the following nucleotide sequence:

UAGCAGCACAUAAUGGUUUGUG [SEQ ID NO. 2],

It is understood here that A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to the unmodified (i.e., "native") miR-15a sequence in the present invention unless otherwise specified. miR-15a may also be referred to in this field as hsa-miR-15a or hsa-miR-15a-5p, with accession number MI0000069. MiR-15a is well known and has been studied in detail. For example, [Xie T, et al. Clin Transl Oncol . (2015) 17(7):504-10; and [Acunzo M, and Croce CM, Clin . Chem . (2016) 62(4):655-6]. As described above for miR-129 mimics, methods for generating miR-15a mimics are known to those skilled in the art. Unless otherwise stated, all such modified forms of miR-15a are considered within the present invention to be within the scope of the term "miR-15a mimic" as used herein.

[0074] Typically, a modified miR-15a (i.e., a miR-15a mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the native sequence of the miR-15a. and the additional bases are selected from C, U, G and independently from C, or the additional bases can be exclusively U. Typically, the miR-15a is used in single-stranded form, but double-stranded versions are also contemplated in the present invention.

[0075] In some embodiments, one or more of the U bases in the miR-15a sequence, either in its native portion and/or in an appendage portion, is 5-haluracil. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0076] In a first set of embodiments, exactly one of the U bases in the miR-15a sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-15a sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-15a oligonucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-15a sequence are 5-haluracil. In some embodiments, exactly 5 or more than 5 U bases in the miR-15a sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-15a sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-15a sequence, whether in native and/or appended portions, are 5-haluracil.

[0077] In one embodiment, the nucleic acid composition of the present invention is U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 6], where U ^F is halouracil, specifically 5-fluorouracil.

[0078] The U bases replaced with 5-haluracil in the miR-15a sequence may be located in the unmodified portion of the miR-15a sequence, as shown above, or, in the case of a miR-15a mimic, also the As suggested, it may be located on one or more U bases covalently appended to native miR-15a.

[0079] In another embodiment, the seed portion of the native miR-15a nucleotide sequence, UAGCAGCA, remains unmodified with 5-haluracil, while the remainder of the miR-15a nucleotide sequence (non-seed portion) ) at least one (or all) of the remaining U bases are replaced with 5-haluracil.

[0080] In certain embodiments, the nucleic acid composition of the present invention is UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7], where U ^F is halouracil, specifically 5-fluorouracil.

[0081] In certain embodiments, the nucleic acid composition contains a modified miR-15a nucleotide sequence by derivatizing one or more of the uracil (U) nucleobases at the 5-position with a group that provides a halogen atom-like effect. do. In some embodiments, the groups that provide similar effects are of similar magnitude to halogen atoms in weight or spatial dimension, such as 20, 30, 40, 50, 60, 70, 80, 90 or less, or 80 g /mol or less. Such groups that provide similar effects to halogen atoms are, for example, methyl groups, trihalomethyl groups (eg trifluoromethyl groups), pseudohalides (eg trifluoromethanesulfonates, cyano or cyanates) or deuterium (D ) can be atoms. This group, which provides an effect similar to that of a halogen atom, may be present in the miR-15a nucleotide sequence in addition to or in the absence of a 5-haluracil base. In addition, the group providing an effect similar to a halogen atom may be located in the native (or seed) portion and/or accessory portion of the miR-15a nucleotide sequence.

[0082] In some embodiments, one or more (or all) of these types of groups that provide similar effects to halogen atoms are excluded from the miR-15a nucleotide sequence. When all these alternative groups are excluded, only one or more halogen atoms are present as substitutes at the 5-position of one or more uracil groups in the miR-15a nucleotide sequence.

[0083] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-140 nucleotide sequence. In some embodiments, the miR-140 nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil.

[0084] As used herein, the term "miR-140" means synonymous with "microRNA-140" or "miRNA-140", and refers to an oligonucleotide having the following nucleotide sequence:

CAGUGGUUUUACCCUAUGGUAG [SEQ ID NO. 8],

It is understood here that A = adenine, C = cytosine, U = uracil and G = guanine base. The above nucleotide sequence refers to the unmodified (i.e., "native") miR-140 sequence in the present invention unless otherwise specified. miR-140 may also be called accession number NT_010498, or miRBase accession number MI0000456. MiR-140 is well known and has been studied in detail. For example, [Zhai, H. et al., Oncotarget . (2015) 6: 19735-46. As described above for exemplary mimics miR-129 and miR-15a, methods for generating miR-140 mimics are known to those skilled in the art. Unless otherwise stated, all such modified forms of miR-140 are considered within the present invention and within the scope of the term “miR-140 mimic” as used herein.

[0085] In general, a modified miR-140 nucleic acid (i.e., a miR-140 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the native sequence of miR-140. and wherein the additional base is selected independently from C, U, G and from C, or the additional base can be exclusively U. Typically, the miR-140 mimics are used in single-stranded form, but double-stranded versions are also contemplated by the present invention.

[0086] In some embodiments, one or more of the U bases in the miR-140 sequence, whether in its native portion and/or in an appendage portion, is 5-haluracil. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0087] In a first set of embodiments, exactly one of the U bases in the miR-140 mimetibody sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-140 sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-140 oligonucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-140 sequence are 5-haluracil. In some embodiments, exactly 5 or more than 5 U bases in the miR-140 mimetibody sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-140 mimetibody sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-140 sequence, whether in native and/or appended portions, are 5-haluracil.

[0088] In one exemplary embodiment, the nucleic acid composition of the present invention is CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9], where U ^F is halouracil, specifically 5-fluorouracil.

[0089] The U bases substituted with 5-haluracil in the miR-140 mimic sequence may be located in the unmodified portion of the miR-140 sequence, as shown above, or, as shown above, the native miR-140 sequence. It may be located on one or more U bases covalently appended to the 140 sequence.

[0090] In another embodiment, the seed portion of the native miR-140 nucleotide sequence remains unmodified with 5-haluracil, while the remainder of the miR-140 nucleotide sequence (non-seed portion) One or more (or all) of the remaining U bases are replaced with 5-haluracil.

[0091] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-192 nucleotide sequence. In some embodiments, the miR-192 nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil.

[0092] As used herein, the term "miR-192" means synonymous with "microRNA-192", "miRNA-192", "microRNA-215", "miR215" or "miRNA-215", Refers to an oligonucleotide having the following nucleotide sequence:

CUGACCUAUGAAUUGACAGCC [SEQ ID NO. 10],

It is understood here that A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to the unmodified (i.e., "native") miR-192 sequence in the present invention unless otherwise specified. miR-192 may also be referred to as hsa-mir-192, has-mir-215, or miRBase accession number MI0000234, or MIMAT0000222. MiR-192 is well known and has been studied in detail. For example, [Song, B. et al., Clin. Cancer Res . (2008), 14: 8080-8086], and [Song, B. et al., Mol. Cancer . (2010), 9:96 pp. 1476-4598]. As described above for exemplary mimics miR-129, miR-140 and miR-15a, methods for generating miR-192 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-192 nucleic acid forms are considered herein to be within the scope of the term "miR-192 mimic" as used herein.

[0093] Typically, a modified miR-192 (i.e., a miR-192 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the native sequence of the miR-192. and the additional bases may be selected from C, U, G and independently from C, or the additional bases may be exclusively U. Typically, the miR-192 mimics are used in single-stranded form, but double-stranded versions are also contemplated by the present invention.

[0094] In some embodiments, one or more of the U bases in the miR-192 or miR-215 sequence, either in its native portion and/or in an appendage portion, is 5-haluracil. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[0095] In another set of embodiments, exactly one of the U bases in the miR-192 mimetibody sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-192 sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-192 oligonucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-192 sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-192 sequence, whether in native and/or appended portions, are 5-haluracil.

[0096] In one exemplary embodiment, the nucleic acid composition of the present invention is CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11], where U ^F is halouracil, specifically 5-fluorouracil.

[0097] The U bases replaced with 5-haluracil in the miR-192 mimic sequence can be located in the unmodified portion of the miR-192 sequence, as shown above, or, as shown above, the native miR-192 sequence. It may be located on one or more U bases covalently appended to the 192 sequence.

[0098] In another embodiment, the seed portion of the native miR-192 nucleotide sequence remains unmodified with 5-haluracil, while the remainder of the miR-192 nucleotide sequence (non-seed portion) One or more (or all) of the remaining U bases are replaced with 5-haluracil or a combination thereof.

[0099] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-502 nucleotide sequence. In some embodiments, the miR-502 nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil.

[00100] As used herein, the term "miR-502" means synonymous with "microRNA-502" or "miRNA-502", and refers to an oligonucleotide having the following nucleotide sequence:

AUCCUUGCUAUCUGGGUGCUA [SEQ ID NO. 12],

It is understood here that A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to the unmodified (i.e., "native") miR-502 sequence in the present invention unless otherwise specified. miR-502 may also be called hsa-mir-502, or miRBase accession number MI0003186, or MIMAT0002873. MiR-502 is well known and has been studied in detail. See, for example, Zhai, H, et al., Oncogene . (2013), 32:12 pp. 1570-1579]. As described above for exemplary mimics miR-129, miR-140, miR-192 and miR-15a, methods for generating miR-502 mimics are known to those skilled in the art. Unless otherwise stated, all such modified miR-502 nucleic acid forms are considered within the present invention and within the scope of the term "miR-502 mimic" as used herein.

[00101] Typically, a modified miR-502 (i.e., a miR-502 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the native sequence of the miR-502. and the additional bases may be selected from C, U, G and independently from C, or the additional bases may be exclusively U. Typically, the miR-502 mimics are used in single-stranded form, but double-stranded versions are also contemplated by the present invention.

[00102] In some embodiments, one or more of the U bases in the miR-502 sequence, either in its native portion and/or in an appendage portion, is 5-haluracil. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[00103] In another set of embodiments, exactly one of the U bases in the miR-502 mimetibody sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-502 sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-502 oligonucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-502 sequence are 5-haluracil. In another embodiment, exactly 5 or more than 5 U bases in the miR-502 sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-502 sequence are 5-haluracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-502 sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-502 sequence, whether in the native part and/or in the appended part, are 5-haluracil.

[00104] In one exemplary embodiment, the nucleic acid composition of the present invention is AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], where U ^F is halouracil, specifically 5-fluorouracil.

[00105] The U bases replaced by 5-haluracil in the miR-502 mimic sequence may be located in the unmodified portion of the miR-502 sequence, as set forth above, or, as set forth above, the native miR -502 may be located on one or more U bases covalently appended to the sequence.

[00106] In another embodiment, the seed portion of the native miR-502 nucleotide sequence remains unmodified with 5-haluracil, while the remainder of the miR-502 nucleotide sequence (non-seed portion) One or more (or all) of the remaining U bases are replaced by 5-haluracil or a combination thereof.

[00107] In another exemplary embodiment, the present invention relates to a nucleic acid composition comprising a modified miR-506 nucleotide sequence. In some embodiments, the miR-506 nucleotide sequence is modified by replacing one or more of the U bases with 5-haluracil.

[00108] As used herein, the term "miR-506" means synonymous with "microRNA-506" or "miRNA-506" and refers to an oligonucleotide having the following nucleotide sequence:

UAUUCAGGAAGGUGUUACUUAA [SEQ ID NO. 14],

It is understood here that A = adenine, C = cytosine, U = uracil and G = guanine base. The nucleotide sequence refers to the unmodified (i.e., "native") miR-506 sequence in the present invention unless otherwise specified. miR-506 may also be called hsa-mir-506, or miRBase accession number MI0003193, or MIMAT0022701. MiR-506 is well known and has been studied in detail. For example, [Li, J, et al., Oncotarget . (2016), 7:38 pp. 62778-62788], and [Li, J. et al., Oncogene. (2016) 35 pp. 5501-5514]. As described above for exemplary mimics miR-129, miR-140, miR-502, miR-192 and miR-15a, methods for generating miR-506 mimics are known to those skilled in the art. will be. Unless otherwise stated, all such modified miR-506 nucleic acid forms are considered herein to be within the scope of the term “miR-506 mimic” as used herein.

[00109] Typically, a modified miR-506 (i.e., a miR-506 mimic) contains no more than 1, 2, 3, 4 or 5 additional bases covalently appended to the native sequence of the miR-506. and the additional bases may be selected from C, U, G and independently from C, or the additional bases may be exclusively U. Typically, the miR-506 mimics are used in single-stranded form, but double-stranded versions are also contemplated by the present invention.

[00110] In some embodiments, one or more of the U bases in the miR-506 sequence, whether in its native portion and/or in an appendage portion, is 5-haluracil. The 5-haluracil may be, for example, 5-fluorouracil, 5-chlorouracil, 5-bromouracil or 5-iodouracil.

[00111] In another set of embodiments, exactly one of the U bases in the miR-506 mimetibody sequence is 5-haluracil. In a second set of embodiments, exactly 2 or more than 2 U bases in the miR-506 sequence are 5-haluracil. In another set of embodiments, exactly 3 or more than 3 U bases in the miR-506 oligonucleotide sequence are 5-haluracil. In another embodiment, exactly 4 or more than 4 U bases in the miR-506 sequence are 5-haluracil. In another embodiment, exactly 5 or more than 5 U bases in the miR-506 sequence are 5-haluracil. In another embodiment, exactly 6 or more than 6 U bases in the miR-506 sequence are 5-haluracil. In another embodiment, exactly 7 or more than 7 U bases in the miR-506 sequence are 5-haluracil. In a specific embodiment, all of the U bases of the miR-506 sequence, whether in native and/or appended portions, are 5-haluracil.

[00112] In one exemplary embodiment, the nucleic acid composition of the present invention is U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15], wherein U ^F is halouracil, specifically 5-fluorouracil.

[00113] The U bases replaced with 5-haluracil in the miR-506 mimic sequence may be located in the unmodified portion of the miR-506 sequence, as set forth above, or, as set forth above, the native miR-506 sequence. It may also be located on one or more U bases covalently appended to the 506 sequence.

[00114] In another embodiment, the seed portion of the native miR-506 nucleotide sequence remains unmodified with 5-haluracil, while the remainder of the miR-506 nucleotide sequence (non-seed portion) One or more (or all) of the remaining U bases are replaced with 5-haluracil or a combination thereof.

[00115] The modified microRNA nucleic acid compositions described herein can be synthesized using any known method for synthesizing nucleic acids. In certain embodiments, the nucleic acid composition is prepared by any well-known process utilizing automated oligonucleotide synthesis, such as phosphoramidite chemistry. In order to introduce one or more 5-haluracil bases into a modified miR sequence (e.g., miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence or miR-129 sequence), 5-haluracil nucleoside phosphoramidites are included as precursor bases, along with phosphoramidite derivatives of nucleosides containing natural bases (e.g., A, U, G and C) to form the nucleic acid sequence can be included in

[00116] In some embodiments, the nucleic acid composition of the present invention is biosynthetically, such as using in vitro RNA transcription from a plasmid, PCR fragment or synthetic DNA template, or recombinant (in vivo ) RNA expression It can be prepared by using the method. See, eg, CM Dunham et al., Nature Methods , (2007) 4(7), pp. 547-548]. The microRNA sequence (e.g., miR-15a sequence, miR-140 sequence, miR-192 sequence, miR-502 sequence, miR-506 sequence or miR-129 sequence) is, by techniques well known in the art, It can be further chemically modified, such as by functionalization with polyethylene glycol (PEG) or hydrocarbons or a cancer cell targeting agent, such as a targeting agent, in particular folic acid. To include such groups, reactive groups (eg, amino, aldehyde, thiol or carboxylate groups) that can be used to attach the desired functional groups can first be included in the oligonucleotide sequence. Such reactive or functional groups may be incorporated on as-produced nucleic acid sequences, but reactive or functional groups may be incorporated into non-nucleoside phosphoramidites or reactive groups containing reactive groups. It can be incorporated more easily by using automated oligonucleotide synthesis in which precursor groups are included.

Modified Nucleic Acid Formulations

[00117] In another aspect, the present invention relates to formulations of the modified nucleic acid compositions described herein. For example, a nucleic acid composition of the present invention may be formulated for pharmaceutical use. In certain embodiments, a formulation is a pharmaceutical composition containing a nucleic acid composition described herein and a pharmaceutically acceptable carrier. In another embodiment, the preparation of the present invention is a modified miR-129 nucleic acid, a modified miR-15a nucleic acid, a modified miR-140 nucleic acid, a modified miR-192 nucleic acid, a modified miR-502, a modified miR-506 nucleic acids or combinations thereof and pharmaceutically acceptable carriers. More specifically, the modified microRNA nucleic acid described by the nucleotide sequence below can be formulated for pharmaceutical utilization and use; CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4], CUUUUUGCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 5], U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO.6], UAGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 7], CAGU ^F GGUUUUACCCU ^F AUGGU ^F AG [SEQ ID NO. 9], CU ^F GACCU ^F AU ^F GAAU ^F U ^F GACAGCC [SEQ ID NO. 11], AU ^F CCU ^F U ^F GCUAU ^F CU ^F GGGU ^F GCU ^F A [SEQ ID NO. 13], and U ^F AU ^F U ^F CAGGAAGGU ^F GU ^F U ^F ACU ^F U ^F AA [SEQ ID NO. 15].

[00118] The term "pharmaceutically acceptable carrier" is used herein synonymously with pharmaceutically acceptable diluent, vehicle or excipient. Depending on the type of pharmaceutical composition and intended mode of administration, the nucleic acid composition may be dissolved or suspended (eg, as an emulsion) in the pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier can be any liquid or solid compound, material, composition and/or dosage form suitable for use in contact with a tissue of a subject, within the scope of sound medical judgment. A carrier must be “acceptable” in the sense of not being detrimental to the subject to which it is provided and must be compatible with the other ingredients of the formulation, ie, do not alter its biological or chemical function.

[00119] Some, non-limiting examples of substances that can function as pharmaceutically acceptable carriers include: sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as ethylene glycol and propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic salt solution; pH buffer solution; and other non-toxic commercial substances used in pharmaceutical formulations. Pharmaceutically acceptable carriers may also include manufacturing aids (eg lubricants, talc magnesium, calcium or zinc stearate or stearic acid), solvents or encapsulating materials. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. Other suitable excipients are found in standard pharmaceutical texts, such as ["Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, ^19th Ed. Mack Publishing Company, Easton, Pa., (1995).

[00120] In some embodiments, the pharmaceutically acceptable carrier may include a diluent that increases the volume of the solid pharmaceutical composition and makes the pharmaceutical dosage form easier to handle by patients and caregivers. Diluents for solid compositions include, for example, microcrystalline cellulose (eg Avicel ^® ), microfine cellulose, lactose, starch, pregelatinized starch, calcium carbonate, calcium sulfate, sugars, dextrates, Dextrin, dextrose, dibasic calcium phosphate dihydrate, tribasic calcium phosphate, kaolin, magnesium carbonate, magnesium oxide, maltodextrin, mannitol, polymethacrylates (such as Eudragit ^® ), potassium chloride, powdered cellulose, sodium chloride , sorbitol and talc.

[00121] Nucleic acid compositions of the present invention can be formulated into compositions and dosage forms according to methods known in the art. In certain embodiments, the formulated composition may be specially formulated for administration in solid or liquid form, including those tailored for administration of: (1) oral administration, e.g., tablets, capsules, powders, granules. , pastes, aqueous or non-aqueous solutions or suspensions, drenches or syrups for application to the tongue; (2) parenteral administration, such as by subcutaneous, intramuscular or intravenous injection as a sterile solution or suspension; (3) topical application, eg, as a cream, ointment or spray applied to the skin, lungs or mucous membranes; or (4) administered vaginally or rectally, eg, as a pessary, cream or foam; (5) administered sublingually or buccally; (6) ocular administration; (7) administered transdermally; or (8) administered intranasally.

[00122] In some embodiments, the dosage form of the present invention comprises a solid pharmaceutical preparation compressed into a dosage form such as a tablet, excipients whose function is to help bind the active ingredient and other excipients together after compression. can include Binders for solid pharmaceutical compositions include acacia, alginic acid, carbomer (eg, carbopol), carboxymethylcellulose sodium, dextrin, ethylcellulose, gelatin, guar gum, hydrogenated vegetable oil, hydroxyethyl cellulose, hydroxypropyl cellulose ( eg Klucel ^® ), hydroxypropyl methyl cellulose (eg Methocel ^® ), liquid glucose, magnesium aluminum silicate, maltodextrin, methylcellulose, polymethacrylates, povidone (Kollidon ^® , Plasdone ^® ), pregelatinized starch, sodium alginates and starch.

[00123] The dissolution rate of a compressed solid pharmaceutical composition in the stomach of a subject can be increased by adding a disintegrant to the composition. Disintegrants include alginic acid, carboxymethylcellulose calcium, carboxymethylcellulose sodium (eg Ac-Di-Sol ^® , Primellose ^® ), colloidal silicon dioxide, croscarmellose sodium, crospovidone (eg Kollidon ^® , Polyplasdone ^® ), guar gum, magnesium aluminum silicate, methyl cellulose, microcrystalline cellulose, polacrylin potassium, powdered cellulose, pregelatinized starch, sodium alginate, sodium starch glycolate (eg ^Explotab® ) and starch.

[00124] Therefore, in certain embodiments, a glidant may be added to the formulation to improve the flowability of the non-compressed solid formulation and enhance the accuracy of administration. Excipients that can function as lubricants include colloidal silicon dioxide, magnesium trisilicate, powdered cellulose, starch, talc and tribasic calcium phosphate.

[00125] When a dosage form such as a tablet is prepared by compression of a powder composition, the composition is subjected to pressure from a punch and dye. Some excipients and active ingredients tend to adhere to the surface of the punch and dye, which may cause pitting or other surface inhomogeneities in the product. A lubricant may be added to the composition to reduce adhesion and facilitate release of the product from the dye. Lubricants include magnesium stearate, calcium stearate, glyceryl monostearate, glyceryl palmitostearate, hydrogenated castor oil, hydrogenated vegetable oil, mineral oil, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, sodium stearyl puma rate, stearic acid, talc and zinc stearate.

[00126] A pharmaceutical composition formulated for tableting or capsule filling may be prepared by wet granulation. In wet granulation, some or all of the active ingredients and excipients in powder form are blended and then further mixed in the presence of a liquid, typically water, which causes the powder to agglomerate into granules. The granules are screened and/or milled, dried and then screened and/or milled to the desired particle size. The granules may then be tableted, or other excipients such as glidants and/or lubricants may be added prior to tabletting. Tabletable compositions may be prepared conventionally by dry blending. For example, a blended composition of active ingredients and excipients may be compressed into slugs or sheets and then pulverized into compressed granules. The compressed granules can then be compressed into tablets.

[00127] In another embodiment, as an alternative to dry granulation, the formulated composition may be directly compressed into a compressed dosage form using direct compression techniques. Direct compression produces more uniform tablets without granulation. Excipients particularly well suited for direct compression tabletting include microcrystalline cellulose, spray dried lactose, dicalcium phosphate dihydrate and colloidal silica. For direct compression tableting, the appropriate use of these and other excipients is known to those of ordinary skill in the art having experience and skill in formulating trials, especially for direct compression tableting. Capsule filling may include any of the foregoing formulations and granules described for tableting; They do not undergo a final purification step.

[00128] In the liquid pharmaceutical composition of the present invention, the drug and any other solid excipients are dissolved or suspended in a liquid carrier such as water, distilled water for injection, vegetable oil, alcohol, polyethylene glycol, propylene glycol or glycerin. The liquid pharmaceutical composition may contain an emulsifier for uniformly dispersing the active ingredient or other excipients insoluble in the liquid carrier throughout the composition. The liquid formulation may be used as an injectable, enteric or emollient type formulation. Emulsifiers that may be useful in the liquid compositions of the present invention include, for example, gelatin, egg yolk, casein, cholesterol, acacia, tragacanth, chondrus, pectin, methyl cellulose, carbomer, cetostearyl alcohol and cetyl alcohol can be

[00129] In some embodiments, the liquid pharmaceutical composition of the present invention may also contain a viscosity enhancing agent to improve the mouthfeel of the product and/or to coat the lining of the gastrointestinal tract. These preparations include acacia, alginate bentonite, carbomer, calcium or sodium carboxymethylcellulose, cetostearyl alcohol, methyl cellulose, ethyl cellulose, gelatin guar gum, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, malto dextrin, polyvinyl alcohol, povidone, propylene carbonate, propylene glycol alginate, sodium alginate, sodium starch glycolate, starch tragacanth and xanthan gum. In another embodiment, the liquid composition of the present invention may also contain a buffering agent, such as gluconic acid, lactic acid, citric acid or acetic acid, sodium gluconate, sodium lactate, sodium citrate or sodium acetate.

[00130] Sweetening agents such as sorbitol, saccharin, sodium saccharin, sucrose, aspartame, fructose, mannitol and invert sugar may be added to certain formulations of the present invention to improve taste. Flavoring agents and flavor enhancers can make the dosage form more palatable to the patient. Common flavoring agents and flavor enhancers of pharmaceutical products that may be included in the compositions of the present invention include maltol, vanillin, ethyl vanillin, menthol, citric acid, fumaric acid, ethyl maltol and tartaric acid.

[00131] Preservatives and chelating agents such as alcohols, sodium benzoate, butylated hydroxy toluene, butylated hydroxyanisole and ethylenediamine tetraacetic acid may be added at levels safe for ingestion to improve storage stability. Solid and liquid compositions may also be dyed using any pharmaceutically acceptable colorant to improve their appearance and/or facilitate patient identification of the product and unit dosage level.

[00132] The dosage form of the present invention may be a capsule containing the composition, such as a powdered or granulated solid composition of the present invention, in a hard or soft shell. The shell may be made of gelatin and may optionally contain plasticizers, such as glycerin and sorbitol, and opacifying agents or colorants.

cancer treatment methods

[00133] As described above, the modified microRNA nucleic acid compositions of the present invention and their formulations exhibit unexpected activity when compared to known cancer therapies (chemotherapy) such as 5-FU and/or by native microRNAs. It shows exceptional anticancer activity. Therefore, another aspect of the present invention provides a method for treating cancer in a mammal by administering to the mammal an effective amount of at least one of the modified microRNA nucleic acid composition or formulation thereof of the present invention.

[00134] As shown in Figures 2A and 8A, exemplary modified microRNA nucleic acids of the present invention, namely modified miR-15a and modified MiR-129, are effective in inhibiting BCL2 expression and activity in cancer cells of a subject. , which ultimately results in an increase in the amount of available pro-apoptotic proteins that increase cancer phagocytosis. miR-129 regulates apoptosis by directly targeting, for example, BCL2 and affecting other important apoptosis-related proteins. In addition, Figure 2a shows that miR-129 reduces the expression of E2F3, a transcription factor protein that regulates cell cycle progression and reduces the protein level expression or activity of thymidylate synthase (TS), thus reducing its activity. , which results in increased cell proliferation and increased efficacy of chemotherapeutic agents.

[00135] Other exemplary microRNAs, such as modified miR-506, miR-140, miR-192 and miR-502, also inhibit cancer cell proliferation and apoptosis of cancer cells, as shown in Figures 13a-b and 14a-d. to adjust

[00136] Indeed, FIGS. 7 and 11 show that intravenous treatment with two exemplary modified microRNAs of the present invention (e.g., modified miR-129 and modified miR-15a) inhibits tumor growth and development by It shows that it effectively treats colorectal cancer.

[00137] In general, a method of treating cancer of the present invention comprises a nucleic acid composition of the present invention (e.g., a modified miR-129 nucleic acid, a modified miR-15a nucleic acid, a modified miR-140 nucleic acid, a modified miR-192 nucleic acid , modified miR-502, modified miR-506 nucleic acid, or a combination thereof) to the subject. In certain embodiments, the nucleic acid composition may be administered as a formulation comprising the nucleic acid composition and a carrier. In another embodiment, the nucleic acid composition of the present invention can be administered in the absence of a carrier (ie, naked).

[00138] As used herein, the term "subject" refers to any mammal. Although the methods of the present invention are usually directed to humans, the mammal may be any mammal. As used herein, the phrase “a subject in need thereof” is included in the term subject, in particular any mammal in need of treatment that is cancerous or has medically determined increased risk of a cancerous or precancerous disease. refers to the object In certain embodiments, the subject includes a human cancer patient. In some embodiments, the subject has colorectal cancer or has a medically determined increased risk of colorectal cancer. In another embodiment, the subject is suffering from pancreatic cancer or has a medically determined increased risk of developing pancreatic cancer, such as diagnosed with chronic pancreatitis. In another embodiment, the subject has lung cancer or is at a medically determined increased risk of lung cancer.

[00139] The terms "treatment" "treat" and "treating" are synonymous with the term "administering an effective amount". These terms refer to medical management aimed at treating, ameliorating, stabilizing, reducing or preventing one or more symptoms of a disease, condition or disorder, such as cancer. These terms are used interchangeably and include active treatment, i.e. treatment specifically directed for the amelioration of a disease, pathological condition or disorder, as well as causal treatment, i.e. the cause of a related disease, pathological condition or disorder. Includes treatment directed to eliminate Treatment may also include palliative treatment, ie treatment designed for symptomatic relief rather than treatment of the associated disease, pathological condition or disorder; prophylactic treatment, ie treatment directed at minimizing or partially or completely suppressing the development of the associated disease, pathological condition or disorder; and adjuvant treatment, that is, treatment used to supplement another specific therapy directed toward amelioration of the related disease, pathological condition or disorder. It is understood that treatment is aimed at treating, ameliorating, stabilizing or preventing a disease, pathological condition or disorder, but need not actually result in treatment, amelioration, stabilization or prevention. The effectiveness of treatment can be measured or evaluated as appropriate for the disease, pathological condition or disorder involved, as described herein and as is known in the art. Such measurements and evaluations may be made from a qualitative and/or quantitative point of view. Thus, for example, a characteristic or characteristic of a disease, pathological condition or disorder and/or a symptom of a disease, pathological condition or disorder may be reduced to any effect or by any amount.

[00140] In certain embodiments, nucleic acid compositions of the invention are used to treat cancer, such as colorectal cancer.

[00141] As used herein, the term "cancer" includes any disease caused by uncontrolled division and growth of abnormal cells, including malignant and metastatic growth of tumors. The term "cancer" also includes precancerous conditions or conditions characterized by an increased risk of cancerous or precancerous conditions. Thus, treatment of cancer in the present invention is also contemplated to include methods of preventing cancer or preventing the transformation of a precancerous condition to a cancerous condition or to a completely non-cancerous condition. Cancer or precancerous conditions (neoplastic conditions) can be located in any part of the body, including internal organs and skin. Examples of possible body sites that contain cancer cells include the colon, rectum (including anus), stomach, esophagus, digestive tract, lungs, pancreas, and liver. A cancer or neoplasia may also include the presence of one or more carcinomas, sarcomas, lymphomas, blastomas or teratomas (germ cell tumors). In some embodiments, the cancer may also be a form of leukemia.

[00142] In certain embodiments, the nucleic acid compositions described herein are used to treat colorectal cancer (ie, colon or rectal cancer), pancreatic cancer, or lung cancer at any stage, as described below. As is well known, cancer spreads to a subject by the blood by invading the normal, non-cancerous tissues surrounding the tumor through the lymph nodes and blood vessels, and after the tumor has invaded the subject's veins, capillaries, and arteries. When cancer cells separate from the primary tumor (“metastasis”), secondary tumors develop through the diseased subject forming metastasized lesions.

[00143] For example, there are four stages of colorectal cancer, which are generally characterized by the extent of metastases. In stage 0, or carcinoma in situ, abnormal, potentially cancerous cells are found in the mucous membrane (innermost layer) of the colon wall. In stage I, cancerous cells form in the mucous membrane of the colon wall and spread to the submucosa (tissue layer below the mucosa) and may spread to the muscular layer of the colon wall. Stage II consists of three subclasses: Stage IIA, in which cancerous tissue spreads through the muscular layer of the colon wall into the serous layer (outermost layer) of the colon wall; Stage IIB where the tumor has spread through the serous layer of the colon wall but has not spread to nearby organs; and Stage IIC, in which the cancer has spread through the serous layer of the colon wall and has invaded nearby organs. Stage III is also divided into three subclasses: the cancer has spread through the mucosa of the colon wall into the submucosa and muscle layer and has spread to 1-3 nearby lymph nodes or tissues adjacent to those nodes; or Stage IIIA where the cancer has spread through the mucosa to the submucosa and 4-6 nearby lymph nodes; the tumor has spread through the muscular layer of the colon wall into the serous layer or spread through the serous layer but has not spread to nearby organs and the cancer has spread to 1-3 nearby lymph nodes or tissues near the lymph nodes; or to the muscular or mucosal layer and to 4-6 nearby lymph nodes; Stage IIIB, which has spread through the mucosa to the submucosa, spreads to the muscle layer, and spreads to 7 or more nearby lymph nodes. In stage IIIC colorectal cancer, the tumor spreads through the serous layer of the colon wall but not to nearby organs and the cancer spreads to 4-6 nearby lymph nodes; the cancer has spread through the muscular layer to the serosal layer or spreads through the serous layer but not to nearby organs and the cancer has spread to 7 or more nearby lymph nodes; or the cancer has spread through the serosal layer to nearby organs and to one or more nearby lymph nodes or to tissues near said lymph nodes. Finally, stage IV colorectal cancer is divided into two subclasses: Stage IVA, in which the cancer has spread through the colon wall and has spread to nearby organs and one organ not near the colon or distant lymph nodes; and stage IVB where the cancer has spread through the colon wall and spread to nearby organs and to one or more organs not near the colon or to the lining of the abdominal wall.

[00144] Another example of tumor staging is the Dukes classification system for colorectal cancer. Here, the stages include stage A, where the tumor is confined to the intestinal wall; Stage B where the tumor showed invasion through the intestine but not the lymph nodes; stage C, in which cancerous cells or tissues are found in the subject's lymph nodes; and Stage D, in which the tumor exhibits extensive metastasis to multiple organs of the subject.

[00145] The Astler Coller classification system may alternatively be used. Herein, stage A colorectal cancer is defined as cancer present only in the intestinal mucosa; Stage B1 is defined as the tumor extending into the muscularis propria but not penetrating through it and the tumor not metastasizing to the lymph nodes; ; Stage C1 is characterized by a tumor that extends into the muscle layer but has not penetrated through it and the tumor has not metastasized to the lymph nodes; Stage C2 colorectal cancer is classified as a tumor that has infiltrated through the muscle layer where the tumor has metastasized to the lymph nodes; Step D describes tumors that have metastasized throughout the individual or subject.

[00146] In some embodiments, the treatment methods of the present invention are more particularly directed to cancer subjects exhibiting reduced levels of miR-129 expression, miR-15a expression, miR-506 expression, miR-502, miR-140 or a combination thereof. it's about In this regard, it is known that miR-15a is downregulated in cancer. For example, RI Aqeilan, et al., Cell Death and Differentiation (2010) 17, pp. 215-220]. In addition, cancerous cells with reduced levels of miR-129 expression are known to be resistant to 5-fluorouracil, as described, for example, in US Patent Application Publication No. 2016/0090636, the contents of which are incorporated by reference in their entirety. It is also known that pancreatic cancer cells show reduced levels of miR-506. For example, [Li, J, et al. Oncogene. 35 pp. 5501-5514].

[00147] In another example, the microRNA mimics of the present invention are used to treat pancreatic cancer. Pancreatic cancer arises from precursor lesions called pancreatic intraepithelial neoplasia (PanINs). These lesions are usually located in the small ducts of the exocrine pancreas and, depending on the degree of cellular dysplasia, can be classified as low-grade dysplasia, intermediate dysplasia or high degree dysplasia. These lesions usually show the presence of activating mutations in the KRAS gene, with specific inactivating mutations in CDKN2A, TP53 and SMAD4. Collectively, these genetic mutations lead to the formation of invasive cancers. Pancreatic cancer is determined by the size of the primary tumor and whether it has grown outside the pancreas and into surrounding organs; Stages are based on whether the tumor has spread to nearby lymph nodes and whether it has spread to other organs in the body (eg, liver, lungs, abdomen). This information is then combined and used to present specific steps: 0, 1A, 1B, 2A, 2B, 3 and 4 steps. In stage 0, the pancreatic tumor is confined to the uppermost layer of pancreatic cells and does not invade deeper tissues. The primary tumor does not metastasize outside the pancreas, such as pancreatic carcinoma in situ or pancreatic intraepithelial neoplasia III. Stage 1A pancreatic tumors are usually confined to the pancreas and are 2 cm in size or less. Also, stage 1A pancreatic tumors do not spread to nearby lymph nodes or distant locations. Stage 1B pancreatic tumors confined to the pancreas are larger than 2 cm in size. Stage 1B pancreatic tumors do not spread to nearby lymph nodes or distant sites. Stage 2A pancreatic tumors represent tumors that grow outside the pancreas but not into major blood vessels or nerves, and the cancer has not spread to nearby lymph nodes or distant locations. Patients presenting with stage 2B pancreatic cancer have tumors confined to the pancreas, or growing outside the pancreas but not into major blood vessels or nerves, and spreading to nearby lymph nodes. Subjects exhibiting stage 3 pancreatic cancer represent tumors that have grown outside the pancreas into major blood vessels or nerves and have spread to distant locations. Stage 4 pancreatic cancer has metastasized to distant locations, lymph nodes and organs.

[00148] In another example, the modified microRNA nucleic acid composition of the present invention is used to treat lung cancer. The methods include treatment of non-small cell lung cancer, such as squamous cell carcinoma, adenocarcinoma and large cell carcinoma. Lung cancer often arises from a malignant tumor in the bronchi of the lung and spreads to other parts of the body, such as the lymph nodes. For example, in the case of small cell lung cancer, cancerous lesions often, once found in the lung, spread to the second lung, lung (pleural) periphery or neighboring organs. Lung cancer is staged based on the size of the primary tumor and whether it has grown outside the lungs into the lymph nodes and has spread to other organs in the body (eg bone, liver, breast, brain). This information is then combined and used to present specific steps, namely steps 0, 1, 2, 3 and 4. For stage 0, ie carcinoma in situ, the cancer is small and does not spread to deeper lung tissue or outside the lung. Stage 1 lung cancer shows cancerous cells present in the lower lung tissue, but the lymph nodes are not affected. Stage 2 lung cancer shows that the cancer has spread to nearby lymph nodes or the chest wall. Stage 3 lung cancer is classified by whether it has spread continuously from the lungs to the lymph nodes or to nearby structures and organs such as the heart, trachea, and esophagus. Stage 4 lung cancer represents cancer that has spread throughout the body, which may affect the liver, bones or brain.

[00149] The nucleic acid composition according to the present invention may be administered by any route commonly known in the art. This includes, for example, (1) oral administration; (2) parenteral administration, such as subcutaneous, intramuscular or intravenous injection; (3) topical administration; or (4) vaginal or rectal administration; (5) sublingual or buccal administration; (6) ocular administration; (7) transdermal administration; (8) intranasal administration; and (9) direct administration to organs or cells in need thereof.

[00150] The amount (dosage) of the nucleic acid composition of the present invention administered depends on several factors, such as the type and stage of cancer, the presence or absence of a pre- or adjuvant drug, and the weight, age, health status and Depends on several factors including tolerance to the agent. Depending on these various factors, dosages may be, for example, about 2 mg/kg body weight, about 5 mg/kg body weight, about 10 mg/kg body weight, about 15 mg/kg body weight, about 20 mg/kg body weight, about 25 mg/kg body weight. Body weight kg, about 30 mg/kg body weight, about 40 mg/kg body weight, about 50 mg/kg body weight, about 60 mg/kg body weight, about 70 mg/kg body weight, about 80 mg/kg body weight, about 90 mg/body weight kg, about 100 mg/kg body weight, about 125 mg/kg body weight, about 150 mg/kg body weight, about 175 mg/kg body weight, about 200 mg/kg body weight, about 250 mg/kg body weight, about 300 mg/kg body weight , about 350 mg/kg body weight, about 400 mg/kg body weight, about 500 mg/kg body weight, about 600 mg/kg body weight, about 700 mg/kg body weight, about 800 mg/kg body weight, about 900 mg/kg body weight, or about 1000 mg/kg body weight, wherein the term "about" is generally understood to be within ± 10%, 5%, 2% or 1% of the indicated value. The dosage may also be within a range limited by any of the above values. The effect of compounds on cancerous or precancerous diseases, or microRNAs (e.g., miR-15a, miR-129, miR-140, miR-192, miR-502, miR-506) expression level or activity, or effect on BCL 2 level or activity, or effect on TS level or activity, or E2F3 level However, by monitoring the effect on disease pathology, an appropriate dosage regimen for each patient can be determined. Any of the above exemplary nucleic acid dosages may be administered once, twice or multiple times per day, depending on the various factors discussed above.

[00151] The ability of the nucleic acid compositions described herein and, optionally, any additional chemotherapeutic agents for use with the methods of the present invention, can be assessed using pharmacological models well known in the art, such as cytotoxicity assays, apoptosis It can be determined using staining assays, xenograft assays, and binding assays.

[00152] The nucleic acid compositions described herein may also be administered with or without one or more chemotherapeutic agents, which may be pre-drugs or adjuvant drugs different from the nucleic acid compositions described herein.

[00153] The phrase "chemotherapy" or "chemotherapeutic agent" as used herein is an agent useful in the treatment of cancer. Chemotherapeutic agents useful in conjunction with the methods described herein include any agent that directly or indirectly modulates BCL2, E2F3 or TS. Examples of chemotherapeutic agents are: anti-metabolites such as methotrexate and fluoropyrimidine-based pyrimidine antagonists, 5-fluorouracil (5-FU) (Carac® cream, Efudex®, Fluoroplex®, Adrucil®) and S -One; antifolates such as polyglutamatable antifolate compounds; raltitrexed (Tomudex®), GW1843 and pemectrexed (Alimta®) and non-polyglutamated folate antagonist compounds; Nolatrexed (Thymitaq®), Plebitrexed, BGC945; folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; and purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacytidine, 6-azuridine, kamufur, cytarabine, dideoxyuridine, doxifuridine, enocitabine, phloxuridine. In certain embodiments of the present invention, the chemotherapeutic agent is a gene or gene product involved in a signaling pathway involved in abnormal cell proliferation or apoptosis, such as YAP1, BMI1, DCLK1, BCL2, thymidylate synthase or E2F3 expression or compounds capable of inhibiting activity; and pharmaceutically acceptable salts, acids or derivatives of any one of the above compounds.

[00154] In some embodiments, the chemotherapeutic agent is an anti-cancer drug, or a tissue sensitizer or other stimulator for an anti-cancer drug. In some embodiments, the co-drug can be another nucleic acid, or another miRNA, such as a microRNA mimic of the invention, gemcitabine, or free 5-FU.

[00155] In certain embodiments, the other nucleic acid is a short hairpin RNA (shRNA), siRNA or nucleic acid complementary to the BCL2 3'UTR portion.

[00156] In another embodiment, the chemotherapy is any one of the following cancer drugs, such as methotrexate, doxorubicin, cyclophosphamide, cis-platin, oxaliplatin, bleomycin, vinblastine, gemcitabine, vincristine, epi It may be one or more of rubicin, folinic acid, paclitaxel, and dositaxel. The chemotherapeutic agent may be administered before, during or after treatment with the nucleic acid composition begins.

[00157] In some embodiments, the chemotherapeutic agent is a co-drug.

[00158] E2F transcription factor 3, E2F3 (RefSeq NG_029591.1, NM_001243076.2, NP_001230005.1) is a transcription factor that binds to DNA and interacts with an effector protein, which is a gene involved in cell cycle regulation. retinoblastoma proteins that regulate expression. Thus, any drug that inhibits the expression of E2F3 can be considered a co-drug in the present invention.

[00159] B cell lymphoma 2 (BCL2), (RefSeq NG_009361.1, NM_000633, NP_000624) including its isoforms α (NM_000633.2, NP_000624.2) and β (NM_000657.2, NP_000648.2) are Bcl- Encoded by 2 genes, the Bcl-2 gene is a member of the BCL2 family of regulatory proteins that regulate mitochondria-regulated cell death through the intrinsic apoptotic pathway. BCL2 is a mitochondrial outer membrane integral protein that blocks cell apoptosis by binding BAD and BAK proteins. Non-limiting examples of BCL2 inhibitors include antisense oligonucleotides such as Oblimersen (Genasense; Genta Inc.), BH3 mimetic small molecule inhibitors such as ABT-737 (Abbott Laboratories, Inc.), ABT-199 (Abbott Laboratories, Inc.), and Obatoclax (Cephalon Inc.). Any drug that inhibits the expression of BCL2 can be considered a co-drug in the present invention.

[00160] Thymidylic acid synthase (RefSeq: NG_028255.1, NM_001071.2, NP_001062.1) is a ubiquitous enzyme, and it is essential for generating dTMP, one of the four bases constituting DNA, of dUMP. catalyzes methylation. This reaction requires CH H4-folic acid as a cofactor both as a methyl group donor and inherently as a reducing agent. Because of the constant demand for CH H4-folate, thymidylate synthase activity is strongly related to the activity of two enzymes responsible for replenishing the cell's folate stores: dihydrofolate reductase and serine transhydroxymethylase. means Thymidylic acid synthase is a homodimer of 30-35 kDa subunits. The active site binds both the folic acid cofactor and the dUMP substrate simultaneously, with dUMP covalently linked to the enzyme via a nucleophilic cysteine residue. (See Carreras et al, Annu. Rev. Biochem., (1995) 64:721-762). The thymidylate synthase reaction is an important part of the pyrimidine biosynthetic pathway to generate dCTP and dTTP for incorporation into DNA. This reaction is required for DNA replication and cell growth. Thus, thymidylate synthetase activity is required in all rapidly dividing cells, such as cancer cells. Because of its association with DNA synthesis, and therefore cell replication, thymidylate synthetase has been a target of anti-cancer drugs for many years. Non-limiting examples of thymidylate synthetase inhibitors include folic acid and dUMP analogs such as 5-fluorouracil (5-FU). Any drug that inhibits the expression of thymidylate synthetase can be considered a co-drug in the present invention.

[00161] If desired, administration of a nucleic acid composition described herein may be combined with one or more non-pharmacological therapies, such as radiation therapy and/or surgery. As is well known in the art, radiation therapy and/or chemotherapeutic agents (in this case, the nucleic acid composition described herein, and optionally any of additional chemotherapeutic agents) may be given. As is also well known in the art, administration of radiation therapy and/or chemotherapeutic agents may be given after surgery to destroy any remaining cancer.

[00162] The following examples are presented for purposes of illustration and to describe certain specific embodiments of the invention. However, the scope of the present invention is not limited in any way by the examples described in the present invention.

Example

Example 1. Materials and Methods

[00163] Modified miR-129: The 5-FU modified miR-129 molecule was synthesized by an automated oligonucleotide synthesis process and purified by HPLC. The mature modified 5-FU-miR-129 was prepared by annealing the two strands. More specifically, a method called "2'-ACE RNA synthesis" was used. 2'-ACE RNA synthesis is based on a protecting group pattern in which a silyl ether is used to protect the 5'-hydroxyl group in combination with an acid-labile orthoester protecting group (2'-ACE) on the 2'-hydroxyl do. This combination of protecting groups is then used with standard phosphoramidite solid phase synthesis techniques. For example, SA Scaringe, FE Wincott, and MH Caruthers, J. Am. Chem . Soc . , 120 (45), 11820-11821 (1998)]; International PCT application WO/1996/041809; [MD Matteucci, MH Caruthers, J. Am. Chem . Soc . , 103, 3185-3191 (1981)]; [SL Beaucage, MH Caruthers, Tetrahedron Lett . 22, 1859-1862 (1981)].

[00164] Exemplary modified miR-15a nucleic acids, modified miR-140 nucleic acids, modified miR-192 nucleic acids, modified miR-502, modified miR-506 nucleic acids or any of the nucleic acids replacing uracil with 5-haluracil Other modified microRNAs can be synthesized in the same way as miR-129a.

[00165] Some exemplary structures of currently used protected and functionalized ribonucleoside phosphoramidites are shown below.

[00166] Cell culture . Human colon cancer cell lines HCT116, RKO, SW480, SW620 and normal colon cell line CCD 841 CoN, pancreatic cancer cell lines ASPC-1, Panc-1 and lung cancer cell line A549 were obtained from American Type Culture Collection (ATCC) and maintained in McCoy's 5A medium (HCT-116 ), DMEM (RKO, SW480, SW620) and MEM (CCD 841 CoN) (Thermo Fischer). Medium was supplemented with 10% fetal bovine serum (Thermo Fischer).

[00167] For transfection, 1×10 ⁵ cells were plated in a 6-well plate and 24 hours later, each using Oligofectamine (Thermo Fischer) according to the manufacturer's protocol, each 100 nM miR-15a precursor, non-specific miRNA (Thermo Fischer) or a modified miR-15a mimic (Dharmacon). For drug-free transfection, cells were plated in 6 well plates at (1×10 ⁵ ) cells per well. After 24 hours, 100 pmol miRNA (control, miR-15a, mimic-1) was diluted in Optimem (Thermo Fischer) and added to the plate. The medium was changed after 24 hours. Medium was supplemented with 10% fetal bovine serum (Thermo Fischer). Briefly, cells were cultured in DMEM/F12 (Life Technologies) supplemented with B27, 10 ng/mL bFGF and 20 ng/mL EGF in ultra-low attachment flasks. Spheroid cells were maintained by gentle centrifugation, dissociation into single cells and collection via replating.

[00168] Western Immunoblot analysis : 48 hours after transfection, an equal amount of protein (15 μg) extracted from cells lysed in RIPA buffer containing a protease inhibitor (Sigma) was incubated in 10%-12% sodium dodecane using a standard method. It was separated on a seal sulfate-polyacrylamide gel. Primary antibodies used for analysis were rabbit anti-YAP1 monoclonal antibody (1:10000) (Cell Signaling Technologies), anti-DLCK1 (1:500) (Abcam), anti-BCL2 (1:500) (NeoMarkers), Anti-BMI-1 (1:10000) (Cell Signaling Technologies), mouse anti-human TS antibody (1:500), anti-α-tubulin (1:50000) (Santa Cruz Biotech Inc.), anti-GAPDH (1:100000) (Santa Cruz Biotech Inc.), anti-E2F3 (1:500) (Santa Cruz Biotech Inc.). As a secondary antibody, horseradish peroxidase-conjugated antibody (1:5000, Santa Cruz Biotech Inc.) against mouse or rabbit was used. Protein bands were visualized with autoradiographic film using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fischer). Western blot densities were quantified using Image J software.

[00169] Cell Proliferation Assay : 24 hours after transfection, cells were seeded in 96-well plates at a density of 2000 cells per well. Cell proliferation assay was performed on days 1 to 5 by incubating 10 μl WST-1 (Roche Applied Science, Mannheim, Germany) for 1 hour in culture medium and reading the absorbance at 450 and 630 nm. The cell proliferation rate was calculated by subtracting the absorbance at 450 nm from the absorbance at 630 nm. Experiments for cell proliferation assays were performed at least three times. OD was calculated by subtracting the absorbance at 630 nm from the absorbance at 450 nm. Proliferation experiments were performed in triplicate.

[00170] Anchorage-independent proliferation was studied to determine the ability of cancer cells to form colonies. Cancer cells were trypsinized, counted, and transfected with 25 nM of modified microRNA or native miR or negative control miRNA using oligofectamine in a total of 1×10 ⁵ cells per well in a 6-well plate. Cells were counted again 6 hours after the infection. In a 35-mm dish, a total of 20,000 cells in 0.35% agar (Bacto Agar, Becton Dickinson) were plated on top of a layer of 1 mL of solidified 0.6% agar. Growth medium containing B27, 10 ng/mL bFGF and 20 ng/mL EGF was included in both layers. After 2 weeks of culture, colonies with a diameter of 50 mm or more were counted.

[00171] Cell Cycle Assay : 24 h after transfection, cells were harvested and cultured at 0.5 to 1 x 10 ⁶ cells/mL in modified Krishan buffer supplemented with 0.02 mg/mL RNase H and 0.05 mg/mL propidium iodide. was resuspended with Stained cells were detected by flow cytometry and the results were analyzed by Modfit LT™ software. Experiments for cell cycle analysis were performed at least three times.

[00172] Apoptosis assay . A fluorescein isothiocyanate (FITC)-Annexin assay was performed to distinguish between early and late apoptosis (Becton Dickinson). HCT116, RKO, SW480 and SW620 cells were plated in a 6-well plate at cells per well (1×10 ⁵ ), and after 24 hours, the cells were transfected with 25 nM modified miRNA using Oligofectamine. 48 hours after transfection, cells were harvested and stained with propidium iodide and anti-Annexin-V antibody according to the manufacturer's protocol (Annexin V-FITC Apoptosis Detection kit, Invitrogen, CA, USA), Cells were detected by flow cytometry.

[00173] 5-FU treatment and cytotoxicity assay : 24 hours after transfection, cancer cells were plated in triplicates in 96-well plates at 2 x 10 ³ cells per well in 100 μl medium. After 24 hours, 2-μM 5-FU alone, 50 nM native microRNA, 50 nM modified microRNA (e.g., modified miR-129), or 2 mM 5-FU and 50 nM modified microRNA of the present invention. Fresh medium containing a combination of microRNAs, such as modified miR-129, was added and the cells were cultured for an additional 72 hours. Cell viability was measured using the WST-1 assay.

[00174] Lentivirus production : Briefly, 1.5 x 10 ⁶ 293T cells were plated in 10-cm dishes containing 10 mL DMEM + 10% FBS. Two days later, pEZX-MR03, a lentiviral plasmid expressing miR-129 or hsa-miR-15a, was transfected with the Lenti-Pac HIV expression packaging kit according to the manufacturer's protocol. After 48 hours, virus was harvested and concentrated with Lenti-Pac lentiviral concentration solution. Then, the titer of the virus was measured using the Lenti-Pac™ HIV qRT-PCR titration kit (approximately 1011 viral particles/ml). In addition, serially diluted viruses (0.1 μL, 0.5 μL, 2 μL, 10 μL, 50 μL) were used for transduction of 5×10 ⁴ HCT116 CSCs and the transduction efficiency was determined. Cells were infected with mice for in vivo treatment experiments using the lowest concentration (2 μL) to achieve 100% positive expression.

[00175] Real-time qRT - PCR analysis of nucleic acid expression . The expression levels of microRNAs in cancer cells were quantified. Briefly, primers specific for the microRNA of interest and the internal control RNU44 gene were obtained from Ambion. cDNA synthesis was performed using a High Capacity cDNA Synthesis Kit (Applied Biosystems) using miRNA-specific primers. Real-time qRT-PCR was performed on an Applied Biosystems 7500 Real-Time PCR instrument using miRNA-specific primers by TaqMan Gene Expression Assay (Applied Biosystems). Expression levels of exemplary miRs of the present invention were calculated by the ΔΔCT method based on the internal control RNU44, normalized to the control and plotted as relative quantification.

[00176] Human cancer stem cells Profiler : RNA was extracted from cancer cells transfected with exemplary microRNAs or negative miRNAs of the present invention using TRIzol reagent (Thermo Fischer) according to the manufacturer's protocol. RNA was transcribed into first strand cDNA using the RT2 First Strand Kit (Qiagen). Next, the cDNA is mixed with the RT2 SYBR Green Mastermix (Qiagen), and the mixture is dispensed into the wells of the Human Cancer Stem Cells RT2 Profiler PCR Array (Qiagen). An Applied Biosystems 7500 Real-Time PCR instrument was used for qRT-PCR (Applied Biosystems), and relative expression values were determined using the ΔΔCT method.

[00177] Mouse subcutaneous tumor implantation model : 2 days before injection, HCT116 cancer stem cells were plated in 6-well ultra-low-attachment plates at 5 x 10 ⁵ /well. Cells were transduced or transfected with 20 μL of virus or 100 pmoles of modified miR-129 or modified miR-15a. After 48 hours, cells were harvested and resuspended at 10 ⁶ /ml in DMEM/F12 knockout medium containing 30% Matrigel. 10 to 12 week old NOD/SCID mice (Jackson Laboratories, Bar Harbor, MA, USA) were used for tumor transplantation. Mice were anesthetized with isoflurane inhalation. 100 μL of the cell suspension was subcutaneously injected on both sides of the lumbar region. Tumor size was measured using a caliper, and tumor volume was calculated using the formula V=length×width ^2/2 .

[00178] For in vivo miRNA delivery experiments, colorectal cancer cells expressing the lenti-luc reporter gene were generated by infecting parental HCT116 cells with recombinant lentivirus. Luciferase-expressing HCT116 cells (2.0x10 ⁶ cells per mouse) were suspended in 0.1 mL of PBS solution and injected through the tail vein of each mouse. Two weeks after colon cancer cell injection, mice were treated with 40 μg of negative control or modified miR(s) packaged with in vivo-jetPEI (Polyplus Transfection) via tail vein injection. Mice were treated every other day (8 times) for 2 weeks. After treatment, mice were screened using the IVIS Spectrum In vivo Imaging System (IVIS) (PerkinElmer).

[00179] RNA isolation : For mouse xenotransplantation, each sectioned tissue was deparaffinized, hydrated, and digested with proteinase K. Total RNA was then isolated using TRIzol ^® reagent. In addition, total RNA was isolated from clinical specimens via a TRIzol ^® -based approach.

[00180] Statistical analysis . All experiments were repeated at least three times. All statistical analyzes were performed with SigmaPlot software. Statistical significance between the two groups was determined using Student's t-test (paired t -test for clinical samples and unpaired t-test for all other samples) . To compare two or more groups, one-way ANOVA followed by Bonferroni-Dunn test was used. Data were expressed as mean ± standard error of the mean (SEM). Statistical significance is described in the figure legend or indicated by an asterisk (*). * = P<0.05; ** = P<0.01; *** = P<0.001.

Example 2: Modification of the present invention microRNA is has anticancer activity.

[00181] As shown in Figures 3, 8b, 12a-b, 13a-b and 14a-d, modified miRNAs (modified miRs: 129, 15a, 192 (215), 140, 502 and 506) are It is more effective in inhibiting colon cancer, pancreatic cancer, and lung cancer cell proliferation than modified miRNA precursors. In addition, the modified miRNA can be delivered to cancer cells without transfection reagent (data not provided). Notably, the results show that cancer cell proliferation is significantly inhibited when compared to cancer cells treated with control microRNA across several different colorectal cancer cell lines, pancreatic cancer cell lines and lung cancer cell lines.

Example 3: deformed miR -129 nucleic acids have anticancer activity.

[00182] In the next experiment, 5-FU was incorporated into miR-129. In one experiment, as shown in the structure provided in Figure 1A, all U bases of miR-129 were replaced with 5-FU, where "U ^F " represents 5-fluorouracil or the other 5-haluracil. In another experiment, all U bases except for the seed region of miR-129 were replaced with 5-FU as shown in the structure provided in Figure 1b.

[00183] Target specificity analysis : The results of Western immunoblot experiments in colorectal cancer HCT-116 cells show that exemplary modified miR-129 polynucleotides of the present invention may retain their target specificities for TS, BCL2 and E2F3 prove The results are shown in Figures 2a and 2b, which show SEQ ID. NO: Results are shown for a modified miR-129 nucleic acid in which all U bases are replaced with 5-FU as obtained by two separate operators, as described in 4. More importantly, exemplary miR-129 mimics were found to be more potent than unmodified (control) miR-129 in reducing expression levels of TS, BCL2 and E2F3.

[00184] Functional enhancement of modified microRNAs of the present invention. The effect of exemplary modified miR-129 on colon cancer cell proliferation was compared with native miR-129. Results show that 5-FU-miR-129 at 50 nM concentration can completely inhibit HCT-116 tumor cell growth. Also, as shown in the results of Fig. 3, 5-FU-miR-129 is much stronger than native miR-129, thereby providing a significantly higher inhibitory effect. This inhibition is specific as the scramble control miR has no effect on cell proliferation.

[00185] Next, the efficacy of modified miR-129 and 5-FU on cell proliferation was compared using HCT-116 colorectal cancer cells. As shown by the results presented in Figure 4, 50 nM (40-fold less than 5-FU) of modified miR-129 is unexpectedly much more potent at inhibiting tumor cell proliferation than 2 μM 5-FU.

[00186] Exemplary modified microRNAs of the present invention induce apoptosis in colon cancer cells . Using BCL2, an important target of miR-129, the effect of the modified miR of the present invention on apoptosis was investigated. Specifically, cell death using an apoptosis assay in HCT116, RKO, SW480 and SW620 colorectal cancer cells transfected with a negative control miRNA, native miR-129 or an exemplary miR-129 mimic of SEQ ID NO: 4 was quantified. The results showed that, through fluorescence-activated cell sorting (FACS)-based FITC-Annexin assay, miR-129 mimics were 2- to 30-fold higher in cells compared to native miR-129 and negative control miRNA in all four colorectal cancer cell lines. It shows that it can induce apoptosis (Fig. 5a).

[00187] miR -129 mimics trigger G1/S cell cycle checkpoint regulation . Cell cycle analysis was performed using flow cytometry in HCT-116 cells treated with scramble control, miR-129 precursors and exemplary miR-129 mimics. As shown in Figure 5b, cell cycle analysis showed that miR-129 mimics affected colorectal cancer cell growth by inducing G1 arrest, and such an effect was much more potent (over 2-fold) than native miR-129. Turns out.

[00188] miR -129 mimics eliminate chemotherapy-resistant colorectal cancer stem cells . To determine the effect of a specific exemplary modified microRNA (i.e., miR-129 mimic) of the present invention on 5-FU resistant colorectal cancer stem cells, HCT116 derived colorectal cancer stem cells were treated with various concentrations of mimic-1 or with 5-FU. Data shown in Figure 6 show that exemplary microRNA mimics of the present invention can eliminate up to 80% of 5-FU resistant colorectal cancer stem cells at a concentration of 100 nM, whereas at a lethal dose of 5-FU of 100 μM, tumor stem cells are eliminated. indicates minimal effect on cell viability.

[00189] Taken together, these results show that exemplary modified microRNA polynucleotides of the present invention can inhibit cell proliferation of HCT116 colorectal cancer stem cells (FIG. 6). This inhibitory effect by miR-129 was much stronger than native miR-129, as proliferation was almost completely blocked by 25 nM miR-129 on day 6 (FIG. 6). We also demonstrated the effect of cell therapy with modified miR-129 on non-adherent cell growth using a soft agar assay. Modified miR-129 treated colorectal cancer stem cells and did not form noticeable spheres compared to cells treated with native miR-129 or control miRNA (similar to that seen in Figure 10).

[00190] miR -129 mimics inhibit colorectal cancer metastasis in vivo . The therapeutic effect of miR-129 nucleic acid modification was evaluated using a colorectal cancer metastasis model. Two weeks after metastasis establishment, 40 μg of miR-129 nucleic acid of SEQ ID NO: 4 was delivered intravenously at a treatment frequency of once every other day injection for 2 weeks.

[00191] The results shown in FIG. 7 show that the modified microRNA-129 inhibits colorectal cancer metastasis, while the negative control miRNA has no effect, but without toxic side effects.

Example 3. Transformed miR -15a and its anticancer activity.

[00192] Exemplary modified miR -15a compositions have anticancer activity . As shown in FIGS. 1C and 1D, all uracil bases of the miR-15a nucleic acid sequence are replaced with 5-haluracil (i.e., 5-fluorouracil) (FIG. 1C) or non-seed of the miR-15a nucleic acid sequence. Exemplary modified miR-15a mimics were synthesized as described above, in which only the uracil bases of the region were replaced with 5-haluracil (i.e., 5-fluorouracil) (FIG. 1D).

[00193] Three days after transfection of the exemplary modified miR-15a described in FIG. 1C into HCT-116 colorectal cancer stem cells, proteins were collected and Western blotting was performed to determine the modified miR-15a of the present invention. It was confirmed that the nucleic acid composition retains the ability to modulate key miR-15a targets. As shown in Figure 8a, miR-15a targets YAP1, BMI1, DCLK1 and BCL2 showed reduced protein levels upon transfection with unmodified miR-15a (native-miR15a) or modified miR-15a compositions, This indicated that the 5-haluracil modification did not inhibit the ability of miR-15a to regulate their target in cells.

[00194] Modified miR -15a has increased therapeutic efficacy in vitro . To determine whether the modified miR-15a composition of the present invention exhibits increased efficacy in colorectal cancer cell lines compared to unmodified miR-15a, HCT-116 colorectal cancer cells were used as a negative control (non-specific oligo oligomers) as described in FIG. nucleotide), unmodified miR-15a or an exemplary modified miR-15a composition.

[00195] The WST-1 assay was used to evaluate cancer cell proliferation. As shown in Figure 8b, 6 days after transfection, unmodified miR-15a reduced cell proliferation by 53% compared to the control group. In the case of modified miR-15a, cell proliferation was reduced by 84%. Taken together, the experimental results show that modified miR-15a is more effective in reducing cancer cell proliferation than unmodified miR-15a.

[00196] Modified miR-15a nucleic acids were also assayed for their ability to inhibit cell cycle progression in cancer cells. 9 shows that unmodified miR-15a induces cell cycle arrest and leads to an approximately 3-fold increase in G1/S ratio. 9 also shows that exemplary modified miR-15a compositions of the present invention were more effective in arresting cell cycle progression when compared to their native counterparts. For example, a 7-fold increase in G1/S ratio was exhibited by cells expressing modified miR-15a nucleic acids exemplary of the present invention when compared to controls. Thus, modified miR-15a is more effective in inducing cell cycle arrest in colorectal cancer cells than unmodified miR-15a.

[00197] The effect of an exemplary modified miR-15a composition on colony formation by colon cancer stem cells in a Matrigel matrix was also investigated. As shown in Figure 10, cells transfected with control miRNA formed many colonies (Figure 10, negative), but cells transfected with unmodified miR-15a formed almost no colonies. (FIG. 10, miR-15a). In contrast, no colonies were observed for cells transfected with modified miR-15a (Fig. 10, 5-FU-miR-15a). These results indicate that the exemplary modified miR-15a compositions of the present invention are indeed more potent inhibitors of cancer formation and colorectal cancer progression.

[00198] Modified miR -15a inhibits cancer development and progression in vivo . To further our understanding of miR-15a in colonic CSCs, we established a mouse xenograft model comprising colon cancer cells pre-transfected with modified miR-15a or a negative control miRNA. Tumors were measured and harvested 8 weeks after injection. As shown in Figure 11, there was a significant reduction (>25x) in tumor size of tumors established from CSCs expressing modified miR-15a mimics (n = 8).

[00199] The data presented herein show that halouracil (e.g., 5-FU) is incorporated into miRNA nucleic acid sequences to enhance the chemotherapeutic function of native microRNA molecules, with or without the use of other chemotherapeutic agents. Support the feasibility of the novel variant incorporated.

SEQUENCE LISTING <110> The Research Foundation for The State University of New York <120> 5-HALOURACIL-MODIFIED MICRORNAS AND THEIR USE IN THE TREATMENT OF CANCER <130> 34085 PCT <150> 62/464,491 <151> 2017-02-28 <150> 62/422,298 <151> 2016-11-15 <150> 62/415,740 <151> 2016-11-01 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Homo sapiens <400> 1 cuuuuugcgg ucugggcuug c 21 <210> 2 <211> 22 <212> DNA <213> Homo sapiens <400> 2 uagcagcaca uaaugguuug ug 22 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> modified microRNA129 with additional uracils on the 3' end of the nucleic acid sequences <220> <221> misc_feature <222> (22)..(23) <223> uracil nucleotides <400> 3 cuuuuugcgg ucugggcuug cuu 23 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-129 nucleic acid with all uracils modified <220> <221> misc_feature <222> (2)..(6) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (18)..(19) <223> halouracil nucleotides <400> 4 cuuuuugcgg ucugggcuug c 21 <210> 5 <211> 21 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-129 nucleic acid with all uracils in non-seed modified <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (18)..(19) <223> halouracil nucleotides <400> 5 cuuuuugcgg ucugggcuug c 21 <210> 6 <211> 22 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-15a nucleic acid with all uracils modified <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(19) <223> halouracil nucleotides <220> <221> misc_feature <222> (21)..(21) <223> halouracil nucleotides <400> 6 uagcagcaca uaaugguuug ug 22 <210> 7 <211> 22 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-15a nucleic acid with all uracils in the non-seed portion of the nucleic acid sequence modified <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (14)..(14) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(19) <223> halouracil nucleotides <220> <221> misc_feature <222> (21)..(21) <223> halouracil nucleotides <400> 7 uagcagcaca uaaugguuug ug 22 <210> 8 <211> 22 <212> DNA <213> Homo sapiens <400> 8 cagugguuuu acccuauggu ag 22 <210> 9 <211> 22 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-140 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (4)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (15)..(15) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 9 cagugguuuu acccuauggu ag 22 <210> 10 <211> 21 <212> DNA <213> Homo sapiens <400> 10 cugaccuaug aauugacagc c 21 <210> 11 <211> 21 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-192 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (2)..(2) <223> halouracil nucleotides <220> <221> misc_feature <222> (7)..(7) <223> halouracil nucleotides <220> <221> misc_feature <222> (9)..(9) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(14) <223> halouracil nucleotides <400> 11 cugaccuaug aauugacagc c 21 <210> 12 <211> 21 <212> DNA <213> Homo sapiens <400> 12 auccuugcua ucugggugcu a 21 <210> 13 <211> 21 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-502 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (2)..(2) <223> halouracil nucleotides <220> <221> misc_feature <222> (5)..(6) <223> halouracil nucleotides <220> <221> misc_feature <222> (11)..(11) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (17)..(17) <223> halouracil nucleotides <220> <221> misc_feature <222> (20)..(20) <223> halouracil nucleotides <400> 13 auccuugcua ucugggugcu a 21 <210> 14 <211> 22 <212> DNA <213> Homo sapiens <400> 14 uauucaggaa gguguuacuu aa 22 <210> 15 <211> 22 <212> DNA <213> artificial sequence <220> <223> an exemplary modified microRNA-506 nucleic acid with certain uracils modified <220> <221> misc_feature <222> (1)..(1) <223> halouracil nucleotides <220> <221> misc_feature <222> (3)..(4) <223> halouracil nucleotides <220> <221> misc_feature <222> (13)..(13) <223> halouracil nucleotides <220> <221> misc_feature <222> (15)..(16) <223> halouracil nucleotides <220> <221> misc_feature <222> (19)..(20) <223> halouracil nucleotides <400> 15 uauucaggaa gguguuacuu aa 22

Claims (22)

A nucleic acid composition comprising a modified microRNA nucleotide comprising one or more uracil nucleic acids,
said at least one uracil nucleic acid is 5-haluracil;
The modified microRNA nucleotide,
CU ^F U ^F U ^F U ^F U ^F GCGGU ^F CU ^F GGGCU ^F U ^F GC [SEQ ID NO. 4], and
U ^F AGCAGCACAU ^F AAU ^F GGU ^F U ^F U ^F GU ^F G [SEQ ID NO. 6], wherein U ^F is 5-haluracil. The composition according to claim 1, wherein the 5-haluracil is 5-fluorouracil. The composition of claim 1 , wherein at least two of said uracil nucleic acids within said nucleotides are 5-haluracil. 4. The composition of claim 3, wherein at least three of said uracil nucleic acids within said nucleotides are 5-haluracil. 5. The composition of claim 4, wherein at least 4 of said uracil nucleic acids within said nucleotides are 5-haluracil. 6. The composition of claim 5, wherein at least 5 of said uracil nucleic acids within said nucleotides are 5-haluracil. 7. The composition of claim 6, wherein at least 6 of said uracil nucleic acids within said nucleotides are 5-haluracil. The composition according to claim 1, wherein all uracil nucleic acids within the nucleotide are 5-haluracil. A pharmaceutical composition comprising the nucleic acid composition according to any one of claims 1 to 8 and a pharmaceutically acceptable carrier for preventing or treating cancer in a subject. The pharmaceutical composition according to claim 9, wherein the subject has been diagnosed with cancer or has a predisposition to develop cancer, and the treatment is inhibition of cancer progression. The pharmaceutical composition according to claim 10, wherein the subject is a human. The pharmaceutical composition according to claim 11, wherein the subject suffers from a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, or lung cancer. The pharmaceutical composition according to claim 12, wherein the subject has colorectal cancer. delete delete delete delete delete delete delete delete delete

Images