KR20210061724A - Screening methods of anti-fungal agents targeting Eif3b - Google Patents

Abstract

The present invention relates to a screening method for an antifungal agent targeting Eukaryotic translation initiation factor 3 subunit B (Eif3b). Specifically, by screening a target gene of terbinafine, an antifungal agent, from a heterozygous-defective fission yeast library to select Eif3b, a new target gene of terbinafine, the present invention is useful for screening a novel antifungal agent targeting Eif3b.

Description

Screening methods of anti-fungal agents targeting Eif3b (Eukaryotic translation initiation factor 3 subunit B) {Screening methods of anti-fungal agents targeting Eif3b}

The present invention relates to a method for screening antifungal agents targeting Eif3b (Eukaryotic translation initiation factor 3 subunit B).

In recent decades, new antifungal agents have been developed as the frequency of severe infections caused by fungi has increased significantly. Depending on the site of action, antifungal agents i) azoles that inhibit the synthesis of ergosterol, ii) polyenes that form pores through which substances in the cytoplasm can leak by binding to sterols in the fungal cell membrane. , iii) allylamine, which prevents ergosterol biosynthesis and accumulates toxic squalene in cells, iv) candin, a cell wall inhibitor that inhibits the synthesis of β-1,3-glucan, an important structure of the cell wall. ), and v) a flucytosine system that inhibits protein and DNA synthesis. With the recent increase in the use of antifungal agents, resistance to antifungal agents, which was very rare before the 1990s, has emerged as an important problem in certain disease groups, such as HIV-infected patients, resulting from long-term administration of antifungal agents (White TC, Marr KA, Bowden RA Clinical, cellular, andmolecular factors that contribute to antifungal drug resistance Clin Microbiol Rev 1998; 11:382-402).

Terbinafine, the first allylamine-based oral antifungal agent, inhibits squalene epoxidase (Erg1 protein), interfering with the early stages of ergosterol biosynthesis, leading to ergosterol depletion. Because sterols are essential components of membrane integrity and growth, depletion of sterols is important for the survival of fungal cells. In addition, inhibition of Erg1 results in intracellular accumulation of squalene, a toxic metabolite, resulting in rapid cell death (bactericidal effect). Squalene epoxidase is present in many organisms, from fungi to mammals, but terbinafine exhibits 1,000 times higher specificity for the fungal squalene epoxidase compared to the squalene epoxidase in mammals, so it is selectively toxic to fungi. Show.

Sterols are important for membrane preservation and growth, but their regulatory mechanisms are not well known. Sterol homeostasis is continuously studied by collecting information from single cells including humans to multicellular organisms. The sterol synthesis pathway is conserved between species and uses multiple layers of feedback regulation through transcription and post-transcription controls. Among the enzymes involved in the sterol synthesis pathway, Erg1p is considered to be the center of feedback regulation in response to sterols because it promotes the rate-limiting step of the biosynthesis of sterols with very low specific activity in the budding yeast Saccharomyces serbiziae. Reported. Under cholesterol-supplemented conditions, yeast ergosterol is supplied only through de novo synthesis, which requires a large amount of oxygen, whereas mammalian cells induce a series of genes required for sterol absorption and synthesis. Induces a series of genes required for sterol synthesis under hypoxia conditions. Despite the different induction conditions, both mammalian and yeast cells require a common transcription factor sterol regulatory element binding protein (SREBPs in mammals and Sre1 in fission yeast), which are membrane-specific. It is buried and moves to the nucleus after proteolytic cleavage to activate the set of genes required for ergosterol synthesis. In budding yeast, another co-activator, the Spt-Ada-Gcn5 acetyltransferase (SAGA) complex, is also required for transcriptional activation. When genes involved in sterol homeostasis are engineered, many changes in cleavage time, stress response and antifungal drug sensitivity are observed.

To bridge the gap between drug discovery and development, studies are needed to identify the target genes of drugs and characterize the mechanisms of action to better understand drugs. For example, if there are non-target properties of a drug, it is predicted that it will help in the development of a safe and effective drug even after the target is well established. Recent breakthroughs in genomic technology have enabled systematic screening of drug targets using a variety of model organisms such as yeast, nematodes, fruit flies, zebrafish and human cell lines.

Among various model organisms for drug targeting, fission yeast gene deletion libraries are particularly useful for systematic target gene selection for antifungal agents. We previously constructed a full-length gene deletion library in fission yeast with built-in barcodes in a gene-specific manner (Kim, DU et al. Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe. Nat Biotechnol 28 , 617-623, doi:10.1038/nbt.1628 (2010).), which is disclosed in Korean Patent No. 10-1799062 as a target gene screening method for a drug using a heterozygous deficient fission yeast strain.

The availability of barcodes for yeast opened an era of parallel analysis of target genes affected under arbitrary conditions by the principle of drug-induced haploinsuffiency. Most systematic screening analyzes were performed with a haploid gene deletion library composed of only non-essential genes.However, since the ideal target of a pathogen is an essential gene well preserved in the species, screening of a defective library that encompasses all genes other than non-essential genes is desirable. Do.

Accordingly, the present inventors use a gene deletion library containing all essential and non-essential genes of fission yeast that covers all essential genes and has terbinafine sensitivity better than the germinating yeast deletion library. In order to identify the terbinafine target gene under the principle of drug-induced haploinsufficiency, 25 terbinafine target genes were selected by performing microarray and spotting analysis. Thereafter, the target gene was narrowed down to 15 through a sensitivity cutoff. Among them, Eif3b, an essential gene, was first revealed to bind to terbinafine to further inhibit ribosome translation. Therefore, Eif3b, a new target gene of terbinafine, can be usefully used as a target gene for screening a new antifungal agent.

An object of the present invention is a screening method for an anti-fungal agent for selecting a test substance whose expression level of Eif3b protein decreases compared to a control without treatment with the test substance using Eif3b, which has been found to be a new target gene for terbinafine. Is to provide.

In order to achieve the above object, the present invention

1) treating the fungal cells with a test substance;

2) measuring the expression level of Eif3b (Eukaryotic translation initiation factor 3 subunit B) protein in the cells of step 1);

3) selecting a test substance whose expression level of the Eif3b protein in step 2) decreases compared to the control group not treated with the test substance; It provides a screening method for an anti-fungal agent comprising a.

The present invention relates to a method for screening an antifungal agent targeting Eif3b (Eukaryotic translation initiation factor 3 subunit B), and more specifically, a novel method of terbinafine by screening a target gene of an antifungal agent terbinafine from a heterozygous deficient cleavage yeast library. By selecting the target gene Eif3b, the present invention can be usefully used for screening new antifungal agents targeting Eif3b.

Figure 1a is a diagram measuring the relative erg1 mRNA level in the heterozygote of 15 target genes of terbina pin.
1B is a diagram measuring the concentration of squalene, a substrate of Erg1, in heterozygous for 15 target genes of terbinafine.
1C is a diagram measuring the sensitivity of several antifungal agents in heterozygous for 15 target genes of terbinafine.
2A is a diagram measuring the sensitivity of various antifungal agents of non-essential genes among 15 target genes of terbinapine.
2B is a diagram showing the expression levels of erg1 and sre1 mRNA after terbinafine treatment in spt7 and spt20 heterozygotes among non-essential genes.
FIG. 3A is a diagram illustrating an isobologram analysis to determine whether or not a synergistic or antagonistic effect of terbinafine and econazole in a heterozygous conjugate of erg1 and three essential genes exhibits a synergistic effect or an antagonistic effect.
3B is a diagram showing cell viability when erg1 and eif3b are overexpressed to confirm that the low erg1 mRNA level in the Eif3b heterozygote is caused by Eif3b.
FIG. 4 is a diagram illustrating an isobologram analysis to confirm whether or not a synergistic effect or an antagonistic effect is exhibited upon co-treatment of terbinafine and cycloheximide in a heterozygous conjugate of erg1 and three essential genes.
5A is a diagram showing the binding energy between terbinafine and erg1 or eif3b in human, sprouted yeast, and fission yeast, measured through molecular modeling.
5B is a diagram confirming that the translation was inhibited in a dose-dependent manner of the treated terbinafine.

Hereinafter, the present invention will be described in detail.

The term "Haploinsufficiency (HI)" as used in the present invention refers to a phenomenon in which the product of a gene exhibiting an abnormal phenotype such as a growth defect in a normal condition exhibits a reduced level. Lack of monophasic is a gene product that can be brought against wild-type conditions by substantially losing the function of the gene when only one functional copy of the gene in a diploid organism and the other copy is not activated by mutation. As it is not sufficiently produced, it leads to abnormal growth or disease conditions.

The term "drug-induced monophasic deficit" as used herein refers to a phenomenon that affects a diploid gene of an organism under a given drug and thus exhibits an abnormal phenotype such as a growth defect as the expression of the gene product is decreased.

The present invention

1) treating the fungal cells with a test substance;

2) measuring the expression level of Eif3b (Eukaryotic translation initiation factor 3 subunit B) protein in the cells of step 1);

3) treating the test material in which the expression level of the Eif3b protein in step 2) decreases compared to the control group not treated with the test material; It provides a screening method for an anti-fungal agent comprising a.

In the above method, the fungal cells of step 1) are Aspergillus sp., Candida sp., Cryptococcus sp., Pneumocystis sp., and Pneumocystis sp. It may be any one selected from the group consisting of Rhizopus sp., Mucor sp., and Absidia sp., but is not limited thereto.

In the above method, the test material in step 1) may be any one selected from the group consisting of peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, or animal tissue extracts, but limited thereto. It doesn't work.

The test substance may be a single compound, a mixture of compounds (eg, a natural extract or cell or tissue culture), an antibody or a peptide, or may be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and SigmaAldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA) and It is commercially available from MycoSearch (USA).

The eif3b is one type of 12 eukaryotic initiation factors (eifs), which are initiation factors that control the initiation of protein synthesis, and eif3b is a subunit of the eif3 translation initiation factor complex. eif3b is the presumed name and the system ID is SPAC25G10.08.

The eif3b may bind to terbinafine, an antifungal agent.

The Eif3b protein of step 2) can inhibit translation.

The antifungal agents terbinafine and cycloheximide act competitively on the Eif3b protein of step 2), thereby exhibiting antagonistic action.

Cycloheximide inhibits protein synthesis in eukaryotic cells, and its specific mechanism of action is not yet fully known, but it binds to the E site of a ribosome large unit (60S ribosome) and elongation of amino acids in the translation process. ) Is known to inhibit ( Nat Chem Biol . 2010 March; 6(3): 209-217).

In the above method, the protein expression level in step 2) is Western blotting, immunoprecipitation assay, dual luciferase reporter assay, enzyme immunoassay (ELISA), and immunohistochemistry. It may be measured by any one method selected from the group consisting of methods, but is not limited thereto.

The antifungal agent screened in step 3) may be administered simultaneously with terbinafine to exhibit a synergistic effect.

In a specific embodiment of the present invention, 15 target genes showing high sensitivity to terbinapine were screened from the heterozygous deficient cleavage yeast library, and the level of Erg1 mRNA was significantly reduced in the single-phase deficiency state of the 15 target genes, and , It was confirmed that the level of squalene, which is a substrate of Erg1, was significantly increased (see FIGS. 1A and 1B). In addition, as a result of performing isobologram analysis by simultaneously treating terbinapine and econazole, it was confirmed that no synergistic effect was observed in the erg1 and eif3b heteroconjugates (see FIG. 3A ). In addition, when eif3b or erg1 was overexpressed in eif3b monophasic deficiency, the survival rate increased (see Fig. 3b), and it was confirmed that the low erg1 level of the eif3b heterozygote was due to eif3b. In addition, eif3b showed a low binding energy with terbinafine (FIG. 5A), and it was confirmed that translation was inhibited by terbinafine (see FIG. 5B), confirming that eif3b is a new target gene of terbinafine.

Therefore, the present invention can be usefully used to screen new antifungal agents targeting eif3b through the existing antifungal agent terbinafine targeting eif3b related to translation.

Hereinafter, the present invention will be described in detail by the following examples and experimental examples.

However, the following Examples and Experimental Examples are for illustrative purposes only, and the present invention is not limited thereto.

<Example 1> Microarray screening of terbinafine targets using a heterozygous gene deletion library

Microarray screening and spotting analysis were performed using a heterozygous gene-deficient fission yeast library to screen for the target gene of the antifungal agent terbinafine.

<1-1> Construction of heterozygous gene deletion library

The heterozygous gene deletion library used for screening is Kim, DU et al. Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe. It was constructed as described in Nat Biotechnol 28, 617-623, doi:10.1038/nbt.1628 (2010). The deletion library consists of 1,260 essential genes and 3,576 non-essential genes representing 98.4% (4,836/4,914) of all protein-encoding genes in fission yeast. Briefly, a deletion cassette containing a pair of unique molecular barcodes (up tag and down tag) was created, resulting in a diploid SP286 strain (h ⁺ /h ⁺ ; ade6-M210/ade6-M216 using the KanMX gene as a selectable marker). , leu1-32/leu1-32, ura4-D18/ura4-D18). The heterozygous deletion strain was constructed by homologous recombination of the deletion cassette and then YES (0.5% yeast extract, 3% glucose and appropriate amino acid supplements containing 100 μg/ml G418 (Duchefa Biochemie, cat#. G0175, Haarlem, NL). ) Was selected from the plate. For functional studies of non-essential target genes, cognate haploid strains were derived from heterozygous deletion strains when available, and ED668(h ⁺ ; ade6-M216, leu1-32, ura4-D18) was used as a haploid control strain. All strains used in this study were obtained from Bioneer. Unless otherwise stated, yeast cells were cultured at 30° C. in complete YES medium (Moreno et al., 1991). The fission yeast was treated with terbinafine (Korea United Pharmacy, Seoul, Korea) at a concentration of 20 nM in the medium and 40 nM in the plate.

<1-2> Microarray screening of terbinafine target genes

Systematic screening of terbinafine target genes has been previously reported (Lee, AR et al. Editor's Highlight: A Genome-wide Screening of Target Genes Against Silver Nanoparticles in Fission Yeast. Toxicol Sci 161, 171-185, (2018) .) was carried out through a microarray with slight modifications.

Specifically, the vial of the pooled library was activated in 25 ml YES medium of the flask with vigorous stirring for 24 to 30 hours until an _{OD 600} reached 2 (about 4.4×10 ^{7 cells/ml).} _{Then, the cells were diluted to OD 600} = 0.05 in 25 ml YES medium and cultured to ^{OD600 = 1.6 (about 3.5 × 10 7} cells) with or without 20 nM terbinafine under vigorous aeration conditions, which was 4 per 5 generations. Times, up to 20 generations were repeated. Aliquots of 3.5×10 ⁷ cells were harvested every 5 generations and genomic DNA was prepared using a ZR-Fungal/Bacterial DNA kit (Zymo Research, Irvine, CA). Microarray screening was performed using a custom GeneChip (48K KRIBB_SP2; Thermo Fisher Scientific, MA, Waltham, MA) and a fluorescent-labeled probe prepared by PCR. After two independent microarray experiments, 34 target strains were selected as primary targets with a relative growth suitability criterion of 0.94 (P<0.05) compared to the untreated sample (0.1% DMSO). Then, using the Gene Ontology (GO) resource (http://geneontology.org/), GO analysis was performed to find out the biological mechanism of the target gene.

The screened primary targets were identified using a spotting assay based on individual growth suitability for secondary screening. For spotting analysis, logarithmic cells _{were diluted to OD 600} = 0.5 in YES medium and spotted with 5 times serial dilution on YES agar plates with or without 40 nM of terbinafine. Then to SSS (> 25 times sensitivity) when the growth suitability is reduced by two or more serial dilutions according to the degree of susceptibility to terbinafine; With SS (5-25 times sensitivity) when growth suitability is reduced by 1-2 serial dilutions; When growth suitability was reduced by less than one serial dilution, it was marked as S (<5 times sensitivity).

As a result, as shown in Table 1, among the 34 primary targets, 3, 12 and 10 genes each showed very high sensitivity (SSS), medium sensitivity (SS), and weak sensitivity (S), for a total of 25 target genes. Was confirmed, and it was confirmed that the translation process composed of 15 targets was remarkably concentrated as much as 13 times through GO (Gene Ontology) analysis for confirming the biological mechanism.

In addition, the target was classified by gene dispensing, and 14 target genes excluding erg1 were translated (3 essential genes eif3b, rpl2501 and rpl31; and 8 non-essential genes rps2402, rps2801, rps1002, rps1601, rps1802, rps1901, rpl1602 and sks2) and transcription (three non-essential genes, spt7, spt20 and elp2). All target genes described as ribosomal protein (RP) were analyzed by STRING to indicate the number of protein interactions with three digits. Indeed, it has been reported that macromolecular complexes such as ribosomal proteins are frequently involved in haploinsufficiency. In particular, all 15 targets have been found to be associated with various human diseases such as Diamond-Blackfan Anemia (DBA) and cancer. In addition, when 10 of the 15 target genes were deleted, an abnormal form was displayed. Thus, these findings indicate that sterol metabolism is crucial for cell homeostasis in yeast and humans.

Gene name Gene description a GOb Dispensability c Number of interactions d Morphology e Relationship with disease OMIMf references erg1 Squalene monooxygenase
Ergosterol synthesis E(SSS) 6 Misshapen Nerve cancer, liver cancer eif3b* Translation E(SSS) 155 No germination Bladder, prostate cancer rpl2501 60S RP L25 E(SS) 188 Rounded Rheumatoid arthritis rpl31 60S RP L31 E(SS) 199 Limited cell division Diamond-black plate anemia (DBA) (617415) ^‡ rps2402 40S RP S24 V(SS) 187 Wild type Diamond-black plate anemia (DBA) (610629) ^† rps2801 40S RP S28 V(SS) 152 Wild type Diamond-black plate anemia (DBA) (606164) ^† rps1002 40S RP S10 V(SS) 180 Wild type Diamond-black plate anemia (DBA) (613308) ^† rps1601 40S RP S16 V(SS) 160 Long Melanoma, colon cancer rps1802 40S RP S18 V(SS) 184 Misshapen Colorectal cancer rps1901 40S RP S19 V(SS) 184 Long Diamond-black plate anemia (DBA) (105650) ^† rpl1602 60S RP L13/L16 V(SS) 182 Wild type Inflammatory disease sks2 Ribosomal chaperone V(SS) 43 Wild type Non-small cell lung cancer (NSLC) spt7 SAGA subunit Warrior V(SSS) 19 Long branched spt20 SAGA subunit V(SS) 19 Long branched Mycosis fungus elp2 RNAP II elongator subunit V(SS) 7 Long Mental retardation (617270) Myeloid neoplasm

a: The genetic description is presented in PomBase (https://www.pombase.org).

b: GO analysis was performed in terms of biological processes using Gene Ontology Resource (http://geneontology.org/). If not, the GO term of PomBase was used.

c: Dispensability data was obtained from the tetrad analysis of this specification.

d: The number of interactions was obtained using STRING (https://string-dborg/).

e: Morphological data were obtained from previous studies and from this specification.

f: The genetic disease was identified as OMIM (https://www.omim.org/). The numbers in parentheses indicate the phenotypic MIM number ^† or the gene/locus MIM number ^‡ .

E is an essential gene; V is a viable gene; SSS is very sensitive; SS has medium sensitivity; S is for low sensitivity.

<Example 2> Analysis of the effects of 15 selected terbinafine target genes on Erg1 mRNA and protein

Erg1 mRNA, protein levels, and sensitivity to antifungal agents of other classes were analyzed in a state of haploinsufficiency of 15 target genes of terbinafine selected in Example 1 above.

<2-1> Erg1 mRNA level measurement of 15 selected terbinafine target genes

Specifically, in quantitative polymerase chain reaction (qPCR) to measure the expression level of Erg1 mRNA, RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) and reverse transcribed into cDNA using Quantiscript Reverse Transcriptase (Qiagen, Hilden, Germany). Became. Then cDNA (100 ng) was amplified by PCR using iQ SYBR Green Supermix in a CFX96 touch real-time detection system (Bio-Rad Laboratories, Hercules, CA). Primer sequences are shown in Table 2 below, and actin was used as an endogenous control for normalization.

Sequence (5'→3') Sequence number erg1 forward primer CGCTATATGAAGGCTCTTGAATCG SEQ ID NO: 1 erg1 reverse primer GATGAGAAGGGCTATGGTCTAAAC SEQ ID NO: 2 act1 forward primer TCCAACCGTGAGAAGATGACT SEQ ID NO: 3 act1 reverse primer CGACCAGAGGCATACAAAGAC SEQ ID NO: 4 sre1 forward primer ACGCTGACGACGTTTTCTCT SEQ ID NO: 5 sre1 reverse primer ATCAGCGGCATACCATGAGG SEQ ID NO: 6

As a result, considering that 15 heterozygous targets were identified due to the monophasic deficiency induced by terbinafine, the cellular level of Erg1 mRNA or protein should be lower than the diploid control SP286. As expected, all 15 target genes showed levels of erg1 mRNA in the range of 30% to 80% of the SP286 erg1 level measured before terbinafine treatment, resulting in significantly lower erg1 mRNA levels (P <0.05) (Fig. ).

<2-2> Measurement of squalene, an Erg1 substrate, of 15 selected terbinafine target genes

The higher the squalene level, the lower the Erg1 enzyme level. Since a low erg1 mRNA level does not always indicate a low Erg1 protein level, the level of squalene, the substrate of Erg1, was evaluated as a second reading of the Erg1 protein level.

Specifically, the intracellular squalene level, a substrate of squalene epoxidase (Erg1), was slightly modified by Takami, T. et al. A genetic and pharmacological analysis of isoprenoid pathway by LC-MS/MS in fission yeast. Measured as described in PLoS One 7, e49004, doi:10.1371/journal.pone.0049004 (2012). After culturing the cells until _{OD 600} = 5 to 10 in the presence of ^{150 nM terbinafine, 3 × 10 8} cells were washed twice with ultrapure water and 1 ml of solvent (chloroform/methanol, 2 :1 (v/v)) and glass beads (d=0.4 to 0.6 mm). The samples were then sonicated for 10 minutes to dissolve and mixed overnight. The supernatant was harvested by centrifugation at 16,110×g for 5 minutes and evaporated to dryness for 30 minutes using a centrifugal vacuum evaporator. Squalene was extracted from the dried supernatant with 50 μl of 100% methanol. The amount of squalene was analyzed using Agilent 1260 HPLC (gilent Technologies, Santa Clara, CA) and YMC column (Cat#. JH08S04-2546WT; YMC, Japan) at room temperature at a flow rate of 1 ml/min and acetonitrile:acetone ( 60:40, v/v) mobile phase. The amount of squalene in the cells was detected by measuring A220. For the standard curve, four different concentrations of squalene (10, 50, 100 and 150 ppm) were used.

As a result, as shown in FIG. 1b, when terbinafine was not treated, squalene of the cells was hardly detected, but all 15 target strains were compared with SP286 in response to terbinafine treatment (150nM for 18 hours). There was a significant difference (2-10 fold; P <0.05) in the squalene level. In particular, the eif3b heteroconjugate exhibited a level of squalene similar to the erg1 heteroconjugate, a well-known target of terbinafine.

<2-3> Sensitivity analysis of 15 terbinafine target genes to other types of antifungal agents

In order to analyze the sensitivity to antifungal agents of different classes, pattern maps of different colors were used based on the spotting analysis of Example 1-2. Relative sensitivities were very high (>25 times), moderate sensitivity (10 to 25 times), weak sensitivity (<10 times), and insensitivity compared to the sensitivity of ED668 or SP286 control cells to haploid or heterologous conjugates, respectively. Has been defined.

If all target strains have lower Erg1 mRNA and protein levels, they will also be sensitive to a similar class of antifungal agents targeting ergosterol synthesis. As expected, all targets were terbinafine (Erg1 targeting allyl amine), tolnaphtate (TOL; thiocarbamate targeting Erg1 similar to allyl amine), econasol (ECON) and myco Similar sensitivity patterns were shown for similar types of antifungal agents, including Nazol (MICON; the azole class targeting Erg11, the next step of Erg1) (Fig. 1c). In addition, it showed susceptibility to DES (diethylstilbestrol), a steroid drug for breast cancer, which acts as an ergosterol analog, which induces a negative feedback loop of sterol synthesis, which is believed to reduce ergosterol levels. Compared to SP286, the target genes were of a different antifungal class and were not sensitive to flucytosine (FLU) targeting nucleic acid synthesis. In contrast, the SP286 control as well as the target targeted DNA integrity and showed sensitivity to doxorubicin (DOX), another antifungal drug used in cancer chemotherapy due to strong cytotoxicity.

Taken together, the sensitivity of 15 heterozygous targets selected by low Erg1 mRNA and protein levels to terbinafine increases, indicating a sensitive response to a similar class of antifungal agents targeting ergosterol synthesis. I could confirm.

<Example 3> Analysis of molecular mechanism of terbinafine target gene

<3-1> Sensitivity analysis of non-essential target genes to antifungal

To elucidate the molecular mechanism of the target gene, a loss of function experiment was performed. Of the 11 non-essential target genes, the molecular mechanism was analyzed with 10 cognate haploid strains (except elp2) consisting of 8 RP-related genes and 2 SAGA-subunit genes.

Specifically, using the sensitivity pattern map analysis method used in Example 2-3, the sensitivity pattern of the cognate haploid was analyzed for drugs including ergosterol synthesis target antifungal agents (TER, ECON and DES), H2O2 and DOX. I did.

As a result, as shown in Figure 2a, none of the eight RP-related haploids showed sensitivity to antifungal drugs targeting ergosterol synthesis, but the two SAGA subunit haploids (spt7 and spt20) were compared with the ED668 control group. It was sensitive. All targets showed moderate or severe sensitivity to common toxic chemicals used as positive controls (1.5 mM H2O2 and 35 μM DOX). However, like their allogeneic conjugates, they showed insensitive or weak sensitivity to antifungal FLU (10 mM). Therefore, in the haploid, it was found that two SAGA-subunit genes are targets of terbinafine, but eight RP-related genes are not target genes of terbinafine.

<3-2> Characterization of 11 non-essential genes

The characteristics of 11 terbinafine target genes were analyzed as follows.

Specifically, using the qPCR method used in Example 2-1, erg1 mRNA level before terbinafine treatment, cell wall integrity (degradation enzyme sensitivity), growth suitability (doubling time), cell cycle progression (FACS analysis) ) And several properties of cognate haploid targets, including cellular protein levels, were investigated and compared to each other.

As a result, as shown in Table 3, the two SAGA-subunit haploids (spt7 and spt20) showed significantly lower erg1 mRNA levels (P <0.05), whereas all of the eight RP-related haploids were significantly It showed a higher level (3-6 times; P <0.05). All target genes were found to be significantly insensitive to lyticase reflecting cell wall integrity than the ED668 control (P<0.05). As shown in Table 1, the two SAGA-subunit strains were not sensitive to lytic enzymes because they exhibited an abnormal long-branched morphology and had resistance. In terms of growth suitability, all haploids tested showed significantly slower growth rates (2 to 3 times; P <0.001) than ED668. Moreover, four RP-related (rps2801, rps1002, rpl1602 and sks2) and two SAGA-subunit haploids showed arrest and defect in the G2/M phase of cell division in flow cytometry. Therefore, it was confirmed that the eight RP-related genes were not target genes of terbinafine.

Strain erg1 mRNA level Cell wall integrity (%) Doubling time(h) FACS Protein Amount (Mole./cell) Average amount of protein ED668 0.3±0.0 73.1±1.1 2.6±0.0 normal NA 159729.8 △rps2402 1.1±0.2 102.1±1.2 4.8±0.2 normal 38394.4 △rps2801 1.5±0.3 100.5±2.4 3.9±0.3 G2/M stop 71318.9 △rps1002 1.2±0.2 100.0±2.6 4.1±0.1 G2/M stop 596956.9 △rps1601 1.3±0.3 102.9±2.5 4.5±0.1 normal 90216.2 △rps1802 0.8±0.1 101.7±2.1 5.6±0.1 normal NA △rps1901 1.1±0.2 99.9±2.5 6.4±0.1 normal 63964.7 △rpl1602 1.9±0.3 102.9±6.0 5.6±0.3 G2/M stop 90460.5 △sks2 1.9±0.4 102.4±6.6 4.5±0.4 G2/M stop 205191.5 △spt7 0.2±0.0 99.4±1.9 6.7±0.5 Cell separation defect 3266.7 1991.9 △spt20 0.1±0.0 100.3±4.4 3.7±0.1 717.7 △elp2 NA NA NA NA 9649.2

<3-3> Measurement of erg1 mRNA levels in spt7 and spt20

The levels of erg1 mRNA of spt7 and spt20, the target genes of terbinafine identified in Example 3-1, were confirmed.

When the identified protein is a terbinafine target, erg1 mRNA levels can be induced in response to terbinafine. In addition, the sre1 transcription factor of erg1 transcription tends to be induced by compensatory effects under sterol supplementation conditions, such as during terbinafine treatment. Therefore, the folding induction of erg1 and sre1 mRNA was measured in two SAGA-subunit heterozygotes (spt7 and spt20) and compared with erg1 heterozygous. The erg1 and sre1 mRNA levels were measured in the same manner as in Example 2-1.

As a result, as shown in FIGS. 3A and 3B, the erg1 mRNA level showed a rapid increase of 4 (spt20) to 8 (erg1 and spt7) times (P <0.01) 18 hours after terbinafine treatment (150 nM). . Similarly, sre1 mRNA levels showed a sharp increase from 4 (spt7 and spt20) to 7-fold (erg1) (P<0.01). Thus, compared to erg1, two SAGA-subunit genes were identified as relatively less sensitive terbinafine targets.

<Example 4> Functional analysis of three new essential target genes

<4-1> Isobologram analysis of three essential target genes

It is well known that essential genes are ideal target genes for therapeutic agents against pathogens (Rancati, G., Moffat, J., Typas, A. & Pavelka, N. Emerging and evolving concepts in gene essentiality. Nat Rev Genet 19, 34- 49, doi:10.1038/nrg. 2017.74 (2018).). Isobologram analysis was performed to functionally analyze three essential genes (eif3b, rpl2501 and rpl31) other than erg1 among the terbinafine targets selected in Example 1 above.

To determine the synergistic (or antagonistic) effect of co-treatment with terbinafine and econazole (or cycloheximide), isobologram analysis was performed as described in the following literature (Lee, SJ et al. Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells Exp Mol Med 46 , e76, doi:101038/emm2013149 (2014).) Briefly, after measuring the IC50 value of each compound, the value Was plotted. A diagonal line is drawn between the IC50 values of a single treatment with terbinafine or econazole (or cycloheximide), indicating the addition line as a control. Several data sets corresponding to the same IC50 were plotted after treatment with various concentrations of terbinafine and econazole (or cycloheximide). The results indicate that there is synergy when the point is below the diagonal, and that there is an additive effect when it is above the diagonal.

1A and 1B, the four essential target genes showed lower Erg1 mRNA and protein levels compared to SP286. Since Erg1 is involved in feedback regulation in addition to the role of squalene epoxidase enzyme in the ergosterol synthesis pathway, a synergistic effect was expected with high Erg1 levels. As shown in Figure 3a, the diploid SP286 control showed the strongest synergistic effect of econazole and terbinafine, and the RP-related genes rpl31 and rpl2501 heterozygous strains showed a synergistic effect. However, the eif3b and erg1 heterozygous strains exhibited an additive effect because they did not have a sufficient amount of Erg1 to show a synergistic effect. Based on the isobologram, the Erg1 levels of the three heterozygous were shown as SP286>rpl31>rpl2501>eif3b=erg1. The results are consistent with the results of Example 2-2 above indicating squalene levels as readings of Erg1 protein (Fig. 1B). The Erg1 level of the eif3b heterozygote was the lowest among the three essential target genes, and the erg1 mRNA level (SP286> rpl2501> eif3b> rpl31> erg1) showed a similar level to that of the erg1 heterozygous. The above results indicate that eif3b is a potent target gene of terbinafine.

<4-2> Confirmation of whether the sensitivity of terbinafine of the eif3b heterozygous conjugate is due to a decrease in the level of Erg1 protein

We tested whether the lowest Erg1 levels in the eif3b heterozygote could be compensated for by gain-of function.

Specifically, the erg1 or eif3b gene was ectopically expressed under the nmt1 promoter in the pREP4X vector. The cloned expression plasmid was transformed with Δeif3b/eif3b heteroconjugate through the lithium acetate method and cultured in a plate containing the selection marker nourseothricin (Sigma-Aldrich). For the complementary test, the growth suitability of transformants was analyzed in plates containing 25 nM terbinafine via spotting analysis.

As a result, as shown in Fig. 3b, when the erg1 or eif3b gene is overexpressed in the eif3b heterozygote, the sensitivity of terbinafine was similar to that of the SP286 control group. This indicates that the low erg1 mRNA level of the eif3b monophasic deficiency is attributed to eif3b.

<Example 5> Isobologram analysis of erg1 and three essential target genes

In principle, co-treatment with two different antifungal agents that block unrelated targets will have an additional effect in the isobologram analysis. Since all three new essential target genes are related to translation, isobolograms in the same manner as in Example 4-1 were co-treated with cycloheximide and terbitapine, which target the elongation stage of translation. The analysis was carried out.

As a result, as shown in Figure 4, the SP286 control and the co-treatment of terbinafine and cycloheximide of the four essential gene heterozygotes showed an antagonistic effect. The degree of antagonistic effect was ranked as eif3b> SP28> rpl31= rpl2501> erg1, which did not depend on erg1 level. Thus, we speculated on the mechanism of the antagonistic effect using the unique isobolographic pattern of the eif3b heterozygote; Due to the similar Erg1 levels, it did not show a similar effect to the erg1 heteroconjugate, and the eif3b heteroconjugate showed a more severe antagonistic effect compared to SP286. These results suggest that Eif3b is a common target of the two antifungal agents.

<Example 6> Measurement of whether terbinapine directly binds to Eif3b and the rate of translation inhibition

<6-1> Measurement of binding energy between erg1 and eif3b and terbinafine in humans and yeast

Molecular modeling was performed to determine whether Eif3b, which is believed to be a target gene of terbinafine, directly interacts with terbinafine.

Specifically, based on the available crystal structures of the protein (human SQLE, human EIF3B and germinating yeast Prt1p), the unknown structure of the desired protein (fission yeast Erg1 and Eif3b; germinating yeast Erg1p) was constructed as a homology model. The docked binding mode and the interaction of terbinafine in the binding site were obtained using a homology structural model. Where possible, protein data bank (PDB) data were retrieved from the RCSB PDB (https://www.rcsb.org/) and all amino acid sequence data were obtained from the UniProt database (http://www.uniprot.org org). The information retrieved is as follows: human SQLE (574 amino acids) 5, PDB code: 6C6P, UniProt ID: Q14534; Human EIF3B (814 amino acids), PDB code: 5K1H, UniProt ID: P55884; Budding yeast Erg1p (496 amino acids), UniProt ID: P32476; Sprouted yeast Prt1p (763 amino acids), PDB code: 4U1F, UniProt ID: P06103; Fission yeast Erg1 (457 amino acids), UniProt ID: Q9C1W3; Fission yeast Eif3b (725 amino acids), UniProt ID: Q10425. All amino acid sequences were searched in the UniProt database and aligned via BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi cgi). Using a protein of a known structure as a template, an unknown protein structure was built through MODELER version 9.2040 in Discovery Studio 2019 (BIOVIA, San Diego, CA, USA). Among several homologous structural models, the most suitable model was selected based on the lowest probability density function (PDF) total energy and discrete optimized protein energy (DOPE) score. Next, AutoDock 4.2.6 software41 was used for molecular docking. The three-dimensional (3D) structure of the protein and terbinafine was processed using AutoDock Tools 1.5.6 (Sanner et al., 1999). The AutoGrid program was used to create a 3D preference grid field with the grid size and spacing set to 40 × 40 × 40 Å ^{3 and 0.375 Å.} A total of 100 docking runs, 25×10 ⁵ energy evaluation and 27,000 iterations were performed using the Lamarckian genetic algorithm method (Morris et al., 1998).

As a result, as shown in FIG. 5A, in the case of Erg1, terbinafine exhibited lower binding energy in sprouted and fission yeast than -3.73 kcal/mol of human SQLE, so that erg1 and terbinapine were better bound in yeast. Indicated that it can be done. Regarding Eif3b, terbinafine showed lower binding energy in sprouted and fission yeast than -2.33 kcal/mol of human SQLE, indicating that Eif3b and terbinafine could bind better in yeast. The above results indicate that the fission yeast Eif3b may be a secondary target of terbinafine through potential direct binding, and terbinafine does not bind well to human Eif3b, but binds well to the yeast Eif3b gene, making it a new target for antifungal agents. Indicates that you can.

<6-2> Measurement of translation inhibition rate by terbinafine treatment

If terbinafine binds to Eif3b, terbinafine treatment will affect translation yield in a dose-dependent manner. Therefore, the present inventors measured the translation yield for terbinafine treatment using GST as a reporter in wheat germ extract.

Specifically, the inhibition of translation by terbinafine was analyzed using a wheat germ extract kit (TnT-binding wheat germ extract system; Promega, Madison, WI) and reporter mRNA. For the preparation of reporter mRNA, the pcGlobin2 plasmid carrying the GST gene was transcribed into mRNA in vitro using the mMESSAGEmMACHINE T7 kit (Thermo Fisher Scientific). GST mRNA (400 ng) was mixed with wheat germ extract in a final volume of 20 μl and incubated for 120 minutes at 37° C. in the presence of 2, 20 or 200 nM terbinafine according to the manufacturer's protocol. The degree of inhibition of in vitro translation by terbinafine was evaluated by Western blotting analysis using GST antibodies (1:500; # sc-9996; Santa Dallas Biotechnology, Dallas, TX).

As a result, as shown in FIG. 5B, terbinafine treatment significantly inhibited up to 50% GST translation (P<0.01) in a dose-dependent manner. In other words, it is indicated that terbinafine can act as an antifungal agent through two different mechanisms of action: novel translational inhibition through Eif3b binding and classical inhibition of Erg1 enzyme.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Screening methods of anti-fungal agents targeting Eif3b <130> 2019P-10-028 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> erg1 forward primer <400> 1 cgctatatga aggctcttga atcg 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> erg1 reverse primer <400> 2 gatgagaagg gctatggtct aaac 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> act1 forward primer <400> 3 tccaaccgtg agaagatgac t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> act1 reverse primer <400> 4 cgaccagagg catacaaaga c 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sre1 forward primer <400> 5 acgctgacga cgttttctct 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sre1 reverse primer <400> 6 atcagcggca taccatgagg 20

Claims (5)

1) treating the fungal cells with a test substance;
2) measuring the expression level of Eif3b (Eukaryotic translation initiation factor 3 subunit B) protein in the cells of step 1);
3) selecting a test substance whose expression level of the Eif3b protein in step 2) decreases compared to the control group not treated with the test substance; Screening method for an anti-fungal agent comprising a.
The screening for antifungal agents according to claim 1, wherein the test substance in step 1) is any one selected from the group consisting of peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, or animal tissue extracts. Way.
The method of claim 1, wherein the Eif3b protein of step 2) inhibits translation.
The method of claim 1, wherein the antifungal agent screened in step 3) exhibits a synergistic effect by administering it simultaneously with terbinafine.
The method of claim 1, wherein the protein expression level in step 2) is Western blotting, immunoprecipitation assay, dual luciferase reporter assay, enzyme immunoassay (ELISA), and immunity. The method for screening an antifungal agent is measured by any one method selected from the group consisting of histochemical method.

Images