KR101872588B1 - Use of the CnCAP6 gene encoding a mannoslytransferase for treating mycoses or meningitis by Cryptococcus neoformans - Google Patents

Abstract

The present invention relates to the use of Cryptococcus The present invention relates to the use of the glycosyltransferase gene CnCAP6 for use in the treatment of fungal infections or meningitis by neoformans . The present invention provides a method for producing a CnCAP6 protein comprising contacting a test substance with a cell comprising a CnCAP6 protein; Measuring the level of expression or activity of the CnCAP6 protein in cells in contact with the test substance; And a step of selecting a test substance in which the degree of expression or activity of the CnCAP6 protein is decreased as compared with a control sample, to thereby screen for a therapeutic agent for an antifungal agent or meningitis. The present invention also provides a pharmaceutical composition for treating an antifungal agent or meningococcus comprising an expression or activity inhibitor of CnCAP6 protein as an active ingredient. Since homologues to the CnCAP6 protein of the present invention are not present in the human body, fungal-specific α1,2- and α1,3-mannosyltransferases can be very useful targets for the development of antifungal agents or agents for treating meningitis.

Description

Use of the glycosyltransferase gene CnCAP6 for the treatment of fungal infections or meningitis caused by Cryptococcus neoformans. ≪ Desc / Clms Page number 2 > Use of the CnCAP6 gene encoding a mannoslytransferase for treating mycobacterial or meningitis by Cryptococcus neoformans.

The present invention relates to the use of Cryptococcus The present invention relates to the use of the glycosyltransferase gene CnCAP6 for use in the treatment of fungal infections or meningitis by neoformans .

Cryptococcus neoformans , an opportunistic infectious human pathogen, is one of the fungi belonging to the heterotrophic bacillus. It is widely used in a variety of natural environments such as seawater, fresh water, soil, trees, livestock, . The genus Cryptococcus is Cryptococcus neoformans and Cryptococcus gatti (serotype B, C), and C. neoformans is classified as C. neoformans var. neoformans (serotype D), C. neoformans var. grubii (serotype A). Infected persons were first reported in 1894 and are known to cause acute, subacute, and chronic lung, meningitis, and systemic infections. Cryptococcus neoformans infections are caused by inhalation of yeast-shaped cells into the lungs in the natural environment, and are often infected with immunocompromised patients, but patients without prior disease can also become infected. In a host with normal immunity, the initial infection produces granuloma and causes an antibody response, whereas in patients with impaired immunity due to organ transplantation or acquired immunodeficiency syndrome (AIDS), the central nervous system nervous system (CNS), causing meningitis, and has been found to be the leading cause of AIDS death worldwide.

The major virulence factors of Cryptococcus neoformans include melanin synthesis ability, ability to grow at 37 ° C body temperature, and oligosaccharide capsules. In particular, It is known to play an important role in pathogenicity, such as defense against the immune system of the host, due to its unusual characteristics. The CAP gene family involved in the biosynthesis of these capsules contains various glycosylation enzymes, and CAP1, CAP4, CAP5 and CAP10 belong to the β-1,2-xylosyltransferase (β-1,2-xylosyltransferase) Is the homologue of CXT1 and is involved in the function of binding xylose to the mannose of the capsule. In addition, CAP6 and CAP59 are homologues of CMT1, an α1,3-mannosyltransferase, and CAP59 gene has been reported to fail to form capsules in the case of disrupted mutants. In addition, several CAP genes such as CAP2, CAP60 and CAP64 exist, but there are many genes whose functions are not clearly known, and it is suggested that they have other functions than capsule formation.

The cell wall of fungi is essential for the survival of fungi from the host's immune system and has a structural characteristic that does not exist in the host, making it a good target for the development of therapeutic agents for fungal infections. At the outermost part of the cell wall are several proteins that are mostly attached to N-linked or O-linked glycans as well as proteins secreted out of the cell. In particular, glycoproteins that play an important role in the intercellular communication or pathogenicity of microorganisms are subject to large amounts of O-glycosylation.

O-glycosylation of Cryptococcus neoformans is initiated by the PMT gene families PMT1, PMT2 and PMT4 in the endoplasmic reticulum (ER) lumen. Thereafter, the oligosaccharide is transferred to the Golgi apparatus to elongate the oligosaccharide. The short oligosaccharide consisting of only mannose is in the form of the main O-oligosaccharide. In the case of some O-oligosaccharides, one oligosaccharide is bonded. Interestingly, the oligosaccharide-linked oligosaccharide remains in the O-linked oligosaccharide of the mutant strain in which the gene of CnKTR3 , which is an α1,2- nosyltransferase that attaches the second mannose of the oligosaccharide to the α1,2- Respectively. This suggests that the biosynthetic processes of oligosaccharide-bound oligosaccharide and mannose oligosaccharide-linked oligosaccharide are independent of each other. In the case of Cryptococcus neoformans strain in which the CnKTR3 gene was disrupted, the pathogenicity of the strain was lower than that of the wild type in the mouse test, but the relationship between the gene involved in the extension of the xylose- .

Korean Registered Patent No. 10-1526054 (Registered on May 29, 2015)

It is an object of the present invention to provide a method for screening a test substance comprising contacting a test substance with a cell comprising a CnCAP6 protein; Measuring the level of expression or activity of the CnCAP6 protein in cells in contact with the test substance; And a step of screening a test substance in which the degree of expression or activity of the CnCAP6 protein is decreased as compared with a control sample.

It is still another object of the present invention to provide a pharmaceutical composition for treating an antifungal agent or for the treatment of meningitis comprising an inhibitor of CnCAP6 protein expression or activity as an active ingredient.

In order to accomplish the above object, the present invention provides a method for producing a test sample, comprising: contacting a test substance with a cell containing a CnCAP6 protein; Measuring the level of expression or activity of the CnCAP6 protein in cells in contact with the test substance; And a step of selecting a test substance in which the degree of expression or activity of the CnCAP6 protein is decreased as compared with a control sample, to thereby screen for a therapeutic agent for an antifungal agent or meningitis.

In addition, the present invention provides a pharmaceutical composition for treating an antifungal agent or meningococcus comprising the CnCAP6 protein expression or activity inhibitor as an active ingredient.

The present invention relates to the use of the glycosyltransferase gene CnCAP6 for the treatment of fungal infections or meningitis caused by cryptococcus neoformans, which comprises inhibiting the activity of a glycosyltransferase involved in prolonging fungal-specific O- Or a method of treating meningitis. Since the homologues for the α1,2- and α1,3-mannosyltransferases, products of the CAP gene cluster, are not present in the human body, the fungal-specific α1,2- and α1,3-mannosyltransferases have been used in the development of antifungal agents or meningitis treatments It will be used as a very useful target.

FIG. 1 is a graph showing the O-chain biosynthetic process diagram of Cryptococcus neoformans and the peak of two mannose among the O-sugar profile of the transformant strain ( ktr3 ?) In which the CnKTR3 gene was disrupted will be. ktr3 ΔM2 is the result obtained by collecting peaks consisting of two mannos in the O-oligosaccharide profile of ktr3 Δ strain and analyzing it by TSKgel Amide-80 column. ktr3 ΔM2 + 2αM2 indicates that this peak and two mannose are bound to α 1,2- And 2α-Mannobiose, and ktr3 ΔM2 + 3αM2 is the result of HPLC analysis with 3α-Mannobiose combined with α-1,3-linkage of two mannose.
FIG. 2A is a comparative analysis of amino acid sequence homology between the .alpha.1,3-mannosyltransferases of Cryptococcus neoformans.
FIG. 2B shows the amino acid sequence of the protein glycosyltransferase-related nosyltransferases of Cryptococcus neoformans as a phylogenetic tree. The CnMnn2p and CnOch1p proteins are α1,2-mannosyltransferase and α1,6-mannosyltransferase involved in N-oligosaccharide synthesis, CnKtr3p is an α1,2-mannosyltransferase involved in O- CnHoc1p and CnHoc3p are α1,6-mannosyltransferases involved in O-oligosaccharide synthesis. On the other hand, the functions of CnHoc2p and CnHoc4p have not yet been clarified.
FIG. 3A shows a schematic diagram of the introduction of a gene disruption cassette by DNA cassette and intracellular gene homologous recombination for Cryptococcus neoformans CnCAP6 gene disruption.
FIG. 3B is a graph Whether or not the CnCAP6 gene was disrupted and whether the NAT marker was inserted was confirmed by polymerase chain reaction (PCR). PCR was performed using CN_6016_orf_F and CN_6016_orf_B primers for ORF (open reading frame) and CN_6016_sc_F and B79 primers for insertion of NAT markers. ORF means nucleotide sequences that are transcribed into mRNA and are likely to become proteins.
Figure 4 is a graph showing the distribution of Cryptococcus neoformans wild type ( H99 ), CnKTR3 The gene deletion mutant ( ktr3 ?), CnCAP6 The gene deletion mutant ( cap6 ?), CnCAP6 The cap6 [ Delta] mutant ( cap6 [ Delta] :: CAP6 ), the CnKTR3 gene and CnCAP6 Mutants in which genes are simultaneously deficient ( ktr3 ? Cap6 ?), CnCAP6 It is a comparison diagram of ktr3 cap6 Δ Δ mutant (ktr3 cap6 Δ Δ :: CAP6) O- oligosaccharide profile of the resulting gene is re-introduced to the liquid chromatograph (High rerformance liquid chromatograph, HPLC) . To distinguish small peaks, the section corresponding to 23 to 35 minutes on the X axis is enlarged and shown on the right. The arrow shows the peak of oligosaccharide disappeared by fragmentation of the gene.
FIG. 5 shows the results of analysis of secretory protein glycation patterns of Cryptococcus neoformans O-chain biosynthesis-associated gene deletion mutants. Wild-type (H99), ktr3 Δ, Δ ktr3 / KTR3, cap6 Δ, Δ :: cap6 CAP6, ktr3 cap6 Δ Δ, Δ ktr3 cap6 Δ :: minimum nutrient medium of the strain CAP6 20 ml (synthetic complete media, 0.67 % yeast 2% glucose, complex amino acid) for 24 hours. The culture medium was separated, and the secreted proteins were concentrated using trichloroacetic acid. The secreted proteins of Cryptococcus neoformans ≪ / RTI > Western blot was performed.
FIG. 6A is a graph showing the results of a comparison between CnWml1p and CnWSc1p proteins having a homology to amino acid sequence homology, Pfam (http://pfam.janelia.org/search), SignalP ( www.cbs.dtu.dk/services/SignalP ) , TMHMM ( http://www.cbs.dtu.dk/services/TMHMM-2.0/ ), and YinOyang (www.cbs.dtu.dk/services/YinOYang). .
FIG. 6B shows the O-glycosylation sites of the CnWml1p and CnWSc1p proteins analyzed using the O-saccharification prediction program (http://www.cbs.dtu.dk/services/YinOYang/).
7A shows a schematic diagram of the introduction of a gene disruption cassette by DNA cassette and intracellular gene homologous recombination for CnWML1 and CnWSC1 gene disruption of Cryptococcus neoformans.
FIG. 7B is a result of analysis of physiological characteristics of CnWML1 and CnWSC1 gene deletion mutants of Cryptococcus neoformans. The culture medium used was YPD medium supplemented with YPD (1% yeast extract, 2% bacto-peptone, 2% glucose) medium, 1M NaCl and 1M NaCl + 1M sorbitol. The strains used in the experiments were wild type (WT) wml1 ?, wsc1 ?, wsc1 ? wml1 ?, wsc1 ? wml1 ? :: WSC1 .
Figure 8 is a Cryptococcal kusu neo satiety's of the wild type strain and O- linked sugar chains with a variety of genes involved in the synthesis disrupted strain (ktr3 Δ, Δ cap6, ktr3 cap6 Δ Δ) is tagged (tagging) HA (hemagglutinin) in CnWML1 < / RTI > and CnWSC1 protein. The prepared strains were cultured in YPD medium for 8 hours and cell wall fractionation experiments were conducted to distinguish the cytosolic fractions as soluble, cell wall, and insoluble proteins. To perform Western blotting.
FIG. 9 shows the results of analysis of physiological characteristics of mutants of Cryptococcus neoformans O-chain biosynthetic gene deletion mutants. The medium used was YPD medium supplemented with 0.05% SDS (sodium dodecyl sulfate), 0.05% SDS + 1M sorbitol, 1M NaCl, 1M NaCl + 1M sorbitol. The strains used in the experiments are wild type (WT), ktr3 ?, cap6 ?, cap6 ? :: CAP6 , ktr3 ? Cap6 ?, ktr3 ? Cap6 ? :: CAP6 .
Fig. 10 is a schematic diagram showing the survival rate of a model mouse by infecting the effect of deletion of genes involved in extension of O-oligosaccharide on virulence in vivo. The strains used in the experiments are wild type (WT), ktr3 ?, cap6 ?, cap6 ? :: CAP6 , ktr3 ? Cap6 ?, ktr3? Cap6 ? :: CAP6 .

The present inventors carried out a study to find a glycosyltransferase involved in the biosynthesis of O-oligosaccharide to which xylose is attached in the process of O-glycosylation of Cryptococcus neoformans and to investigate the relationship between the hospital performance. As a result, CnCAP6 , which was presumed to be involved in capsular biosynthesis, which is a major pathogenic factor of Cryptococcus neoformans, was found to be involved in the biosynthesis of O-glycosides attached to xylose of Cryptococcus neoformans The surface protein targets of O-glycosylation by CAP6 were identified for the first time, and CnCAP6, an α1,3 - nuclosyltransferase gene, and CnKTR3 gene, α1,2 - mannosyltransferase gene , It was confirmed that almost all of the O-oligosaccharide was not prolonged and the virulence of Cryptococcus neoformans was remarkably decreased. Thus, the present invention was completed.

According to an aspect of the present invention, there is provided a method for screening a test specimen comprising contacting a cell comprising a CnCAP6 protein with a test substance; Measuring the level of expression or activity of the CnCAP6 protein in cells in contact with the test substance; And selecting a test substance having a reduced degree of expression or activity of the CnCAP6 protein as compared to a control sample. Preferably, the CnCAP6 protein may be represented by SEQ ID NO: 1, but is not limited thereto.

Preferably, the expression or activity level of the CnCAP6 protein is determined by reverse transcription-polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, Western blotting Western blotting, or flow cytometry (FACS).

Specifically, the fungus may be Cryptococcus neoformans .

The present invention provides a method for producing a CnCAP6 protein comprising contacting a test substance with a cell comprising a CnCAP6 protein; Measuring the level of expression or activity of the CnCAP6 protein in cells in contact with the test substance; And a step of selecting a test substance in which the degree of expression or activity of the CnCAP6 protein is decreased as compared with a control sample. Preferably, the CnCAP6 protein may be represented by SEQ ID NO: 1, but is not limited thereto.

The term " test substance " used in reference to the screening method of the present invention refers to an unknown candidate substance used in screening in order to examine whether it affects the expression amount of a gene or affects the expression or activity of a protein. do. Such samples include, but are not limited to, chemicals, nucleotides, antisense-RNA, small interference RNA (siRNA), and natural extracts.

The present invention provides a pharmaceutical composition for an antifungal agent comprising, as an active ingredient, a CnCAP6 protein expression or activity inhibitor. Preferably, the CnCAP6 protein may be represented by SEQ ID NO: 1, but is not limited thereto.

Specifically, the CnCAP6 protein expression inhibitor may be selected from the group consisting of an antisense nucleotide complementary to mRNA of CnCAP6 gene, a small interfering RNA (siRNA) and a short hairpin RNA (shRNA) And the CnCAP6 protein activity inhibitor may be any one selected from the group consisting of a compound that specifically binds to the CnCAP6 protein, a peptide, a peptide mimetic, an aptamer, an antibody, and a natural product. Preferably, the CnCAP6 gene can be represented by SEQ ID NO: 2.

Specifically, the fungus may be Cryptococcus neoformans .

The present invention provides a pharmaceutical composition for the prevention or treatment of meningitis comprising the CnCAP6 protein expression or activity inhibitor as an active ingredient. Preferably, the CnCAP6 protein may be represented by SEQ ID NO: 1, but is not limited thereto.

The term " anti-sense nucleotide " in the present invention means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in mRNA, And it acts to inhibit the translation of.

The term " small interfering RNA (siRNA) " in the present invention means a nucleic acid molecule capable of mediating RNA interference or gene silencing. siRNA is provided as an efficient gene knock-down method or gene therapy method since it can inhibit the expression of a target gene.

The term " short hairpin RNA (shRNA) " in the present invention refers to an oligonucleotide synthesizing oligonucleotide linking 3-10 base linkers between the sense of the target gene siRNA sequence and the complementary nonsense After cloning into a plasmid vector, or shRNA inserted into a retrovirus lentivirus and adenovirus, a hairpin shRNA with a loop is formed and the siRNA is generated by Dicer in the cell. (RNA interference) effect. The shRNA shows a relatively long-term RNAi effect as compared to siRNA.

The term " peptide mimetics " in the present invention is a peptide or nonpeptide that inhibits the binding domain of the CnCAP6 protein leading to CnCAP6 activity.

In the present invention, the term " Aptamer " is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure and capable of binding to a target molecule with high affinity and specificity. Aptamers are comparable to monoclonal antibodies due to their inherent high affinity (usually pM levels) and their ability to bind to target molecules with specificity, and there is a high likelihood of being an alternative antibody, especially as a "chemoantibody".

&Quot; Antibody " of the present invention can be prepared either through CnCAP6 injection or commercially available. In addition, the antibody includes a polyclonal antibody, a monoclonal antibody, and a fragment capable of binding to an epitope.

The polyclonal antibody can be produced by a conventional method of injecting the CnCAP6 into an animal and collecting blood from the animal to obtain serum containing the antibody. Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host such as goats, rabbits, sheep, monkeys, horses, pigs, cows, dogs and the like.

Monoclonal antibodies can be prepared using any technique that provides for the generation of antibody molecules through the cultivation of continuous cell lines. Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.

The pharmaceutical composition of the present invention may contain a chemical substance, a nucleotide, an antisense, an siRNA oligonucleotide and a natural product extract as an active ingredient. The pharmaceutical composition or the combined preparation of antifungal compounds of the present invention may be prepared by using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the active ingredients. Examples of the adjuvants include excipients, disintegrants, sweeteners, binders, A solubilizing agent such as a lubricant, a lubricant, or a flavoring agent may be used. The antifungal drug composition of the present invention may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the active ingredient for administration. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile water and sterile water suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

The pharmaceutical preparation forms of the pharmaceutical composition of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions, . The pharmaceutical composition of the present invention can be administered orally, intravenously, intramuscularly, intraarterally, intraperitoneally, intrasternally, transdermally, intranasally, by inhalation, topically, rectally, ≪ / RTI > The effective amount of the active ingredient of the pharmaceutical composition of the present invention means the amount required for prevention or treatment of the disease. Accordingly, the present invention is not limited to the particular type of the disease, the severity of the disease, the kind and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, body weight, general health status, sex and diet, Rate of administration, duration of treatment, concurrent medication, and the like. For example, in the case of an adult, the inhibitor of the present invention may be administered at a dose of 0.1 ng / kg to 10 g / kg when the compound is administered once to several times a day, a polypeptide, In the case of protein or antibody, 0.1 ng / kg to 10 g / kg, antisense nucleotide, siRNA, shRNAi or miRNA can be administered at a dose of 0.01 ng / kg to 10 g / kg.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example  One : alpha 1 , 3- Combined second Mannoose  Confirm

Previous work on the N-glycosylation of Cryptococcus neoformans by the team suggested that xylose is attached to the mannose residue linked to the α1,3-form. In order to identify the mannose bound to the α1,3-linkage from the O-oligosaccharide of the cryptococcus neoformans , two peaks (M2) of the O-oligosaccharide profile of the ktr3 Δ mutant strain, NH2P-50 4E column (0.46 X 25 cm, 5 μm; Shodex). 2α-Mannobiose (Sigma Aldrich) and 3α-Mannobiose (Santa Cruz), in which two mannose are connected by different bonds, were compared with samples to distinguish the types of binding.

In comparison with 2α-Mannobiose and 3α-Mannobiose, the M2 peak of the ktr3 Δ mutant strain was analyzed. Two peaks were observed in the HPLC analysis. One of the peaks was detected at the same time as 3α-Mannobiose and the ktr3 Δ mutation The binding of the second mannose present in the M2 of the strain O-oligosaccharide was also confirmed to have an? 1,3-linkage (Fig. 1).

Example 2: in silico  Identification of α1,3-mannosyltransferase gene related to O-glycosylation pathway through analysis

In order to find an α1,3- mannosyltransferase gene involved in the biosynthesis of O-glycosyltransferase in Cryptococcus neoformans , a gene having homology with the α1,3-mannosyltransferase CnCAP59 gene associated with capsular biosynthesis was identified as serotype A The gene database of the strain H99

(http://www.broadinstitute.org/annotation/genome/cryptococcus_neoformans/MultiHome.html) CnCMT1 and CnCAP6 genes were selected (Fig. 2). These genes have a sequence corresponding to the? 1,3-mannosyltransferase domain but are not involved in capsule formation (FIG. 2A).

Example  3: O- Sugar chain  Production of disruption strains of biosynthetic pathway-related genes

In the present invention, various Cryptococcus neoformans mutants shown in Table 1 were prepared and used. As the liquid medium, yeast extract-peptone-dextrose (YPD) was used and the strains were cultured at 30 DEG C at 220 rpm.

The strain used in the present invention Strain Genotype references C. neoformans
H99 Anti-circular A MAT α J. Clin. Microbiol.
31 (12), 3305-3309 ktr3 ? MAT αCn03832 :: NAT # 159 J Biol Chem.
287 , 19501-19515 ktr3 ? / KTR3 MAT αCn03832 :: NAT # 159 / Cn03832- NEO J Biol Chem.
287 , 19501-19515 cap6 ? MAT αCn06016 :: NAT # 159 Invention cap6 Δ :: CAP6 MAT αCn06016 :: NAT # 159 Cn06016- NEO Invention ktr3 ? cap6 ? MAT αCn03832 :: NAT # 159 Cn06016 :: NEO Invention ktr3 ? cap6 ? :: CAP6 MAT αCn03832 :: NAT # 159 Cn06016 :: NEO Cn6016 -HYG Invention wml1 ? MATα Cn01255 :: NAT # 159 Invention wsc1 ? MATα Cn03328 :: NAT # 159 Invention wml1 ? wsc1 ? MATα Cn01255 :: NAT # 159 Cn03328 :: NEO Invention wml1 ? wsc1 ? :: WSC1 MATα Cn01255 :: NAT # 159 Cn03328 :: NEO
Cn03328 -HYG Invention H99 / Wml1_NHA MATα Cn01255-6HA Invention ktr3 ? / Wml1_NHA MATα Cn03832 :: NAT # 159 Cn01255-6HA Invention cap6 ? / Wml1_NHA MATα Cn06016 :: NAT # 159 Cn01255-6HA Invention ktr3 ? cap6 ? / Wml1_NHA MATα Cn03832 :: NAT # 159 Cn06016 :: NEO Cn01255 - 6HA Invention ktr3 ? / Wsc1_CHA MATα Cn03832 :: NAT # 159 Cn03328- 6HA Invention cap6 Δ / Wsc1 _ CHA MATα Cn06016 :: NAT # 159 Cn03328 - 6HA Invention ktr3 ? cap6 ? / Wsc1_CHA MATα Cn03832 :: NAT # 159 Cn06016 :: NEO Cn03328-6HA Invention

* Each NAT # signifies a Nat marker with a unique signature tag.

According to the procedure reported in CnCAP6 conventional to genetic defects are caused growth characteristics and pathogenic analysis, split marker (split-marker) and the genetic injected transgenic (biolistic transformation) of C by the double connecting PCR (double joint PCR) using . The CnCAP6 gene was disrupted in a strain of neoformans antigen A H99 (Fig. 3A). Primers necessary for gene disruption are shown in Table 2 below. A double-coupled PCR was performed on gold microcarrier beads (0.6 μm [Bio-Rad]), and the CnCAP6 gene disruption cassette was purified and transformed with the antigen A H99 and ktr3 Δ mutants. A YPD medium containing 100 μg / ml of Nourseothricin and a strain capable of growing in a geneticin G418 at a concentration of 200 μg / ml were selected and the CnCAP6 gene was disrupted by a diagnostic PCR Transformant strains ( cap 6 Δ, ktr 3 Δcap 6 Δ) were selected.

The primer used in the present invention primer The sequence (5 'to 3') purpose M13Fe GTAAAACGACGGCCAGTGAGC (SEQ ID NO: 3) Gene fragmentation
Cassette making M13Re CAGGAAACAGCTATGACCATG (SEQ ID NO: 4) Gene fragmentation
Cassette making NSL2 AACTCCGTCGCGAGCCCCATCAAC (SEQ ID NO: 5) Gene fragmentation
Cassette making NSR2 AAGGTGTTCCCCGACGACGAATCG (SEQ ID NO: 6) Gene fragmentation
Cassette making CN_6016D_L1 GTAATGACGAGTGCGAGA (SEQ ID NO: 7) CnCAP6 disruption
Cassette making CN_6016D_L2 GCTCACTGGCCGTCGTTTTACATCCGATGGGCTATACAG
(SEQ ID NO: 8) CnCAP6 disruption
Cassette making CN_6016D_R1 CATGGTCATAGCTGTTTCCTGCTTCCGCTTCTGAGACTA
(SEQ ID NO: 9) CnCAP6 disruption
Cassette making CN_6016D_R2 GCAAGGTACTCTGACATG (SEQ ID NO: 10) CnCAP6 disruption
Cassette making CN_6016D_Sc_F GTGTCCGTGCTTGTAATG (SEQ ID NO: 11) CnCAP6
Fracture diagnosis CnD-ACTsqB (B79y) TGTGGATGCTGGCGGAGGATA (SEQ ID NO: 12) CnCAP6
Fracture diagnosis CN_6016D_Sc_F2 GTCCCATCTGATGTTTCG (SEQ ID NO: 13) CnCAP6
Re-introduction diagnosis CN_06016_cp_F_Xho1 CCACTCGAGGTGTCCGTGCTTGTAATG (SEQ ID NO: 14) CnCAP6
Reintroduction CN_06016_cp_B_EcoRV TACGATATCTCGCACAACGACTTAGCA (SEQ ID NO: 15) CnCAP6
Reintroduction CN_6016_of_F GGTCAGAGTGCTACTGAT (SEQ ID NO: 16) CnCAP6
Confirm CN_6016_orf_B AACTCACCAGCAACCTGA (SEQ ID NO: 17) CnCAP6
Confirm CN_01255D_L1
caaagcaccaagccatac (SEQ ID NO: 18)
CnWML1 shredding
Cassette making CN_01255D_L2
GCTCACTGGCCGTCGTTTTACggtggagggattgtaaag
(SEQ ID NO: 19) CnWML1 shredding
Cassette making CN_01255D_R1 CATGGTCATAGCTGTTTCCTGtgtacccaggagaattgc
(SEQ ID NO: 20) CnWML1 shredding
Cassette making CN_01255D_R2
tatgcgctgagcaaggaa (SEQ ID NO: 21) CnWML1 shredding
Cassette making CNWML1D-confirmF tcgacttctatctcgtcc (SEQ ID NO: 22)
CnWML1 shredding
Diagnosis CNWML1D-confirmB ccatactcgtatccatgc (SEQ ID NO: 23)
CnWML1 shredding
Diagnosis CN_03328D_L1
agcttagtgggtgactca (SEQ ID NO: 24)
CnWSC1 shredding
Cassette making CN_03328D_L2
GCTCACTGGCCGTCGTTTTACgatgatgagtgactgacc
(SEQ ID NO: 25) CnWSC1 shredding
Cassette making CN_03328D_R1
CATGGTCATAGCTGTTTCCTGcgccatcttggctttgat
(SEQ ID NO: 26) CnWSC1 shredding
Cassette making CN_03328D_R2 aaaggctaatcggcccat (SEQ ID NO: 27) CnWSC1 shredding
Cassette making CNWSC1D-confrimF ctcttgctcatgtcgatc (SEQ ID NO: 28) CnWSC1 shredding
Diagnosis CNWSC1D-confrimB aggtagatgaagcggtag (SEQ ID NO: 29) CnWSC1 shredding
Diagnosis Not1CnWSC1D_F aagcggccgcccggtttgggttttta (SEQ ID NO: 30) CnWSC1
Reintroduction CnWSC1D_B accctcactaaagggaac (SEQ ID NO: 31) CnWSC1
Reintroduction Not1CnWSC1D_F aagcggccgcccggtttgggttttta (SEQ ID NO: 32) CnWSC1
Introduction CnWSC1D_B accctcactaaagggaac (SEQ ID NO: 33) CnWSC1
Reintroduction CN1255OF_Sal1 ccacgtcgactatcctccacgacttcga (SEQ ID NO: 34) Wml1_NHA
vector production CN1255OB_Sma1
GACCCGGGCTAGTGGTGGTGGTGGTGGTGATACCGGAAATTGGCAGC (SEQ ID NO: 35) Wml1_NHA
vector production CN1255TF_Sma1
gacccgggactgtcgtttcatcttaggct (SEQ ID NO: 36)
Wml1_NHA
vector production CN1255TB_Xba1
AGTTCTAGATACTATACGCCCGACAAC (SEQ ID NO: 37)
Wml1_NHA
vector production CN3328OF_Kpn1
ctcggtaccggacgatctgagtggttt (SEQ ID NO: 38) Wsc1_CHA
vector production CN3328OB_Sma1
GACCCGGGTTAGTGGTGGTGGTGGTGGTGCCTGTAGTCATGAGGATTGG (SEQ ID NO: 39) Wsc1_CHA
vector production CN3328TF_Sma1
gacccggggaatagtctggggcacgt (SEQ ID NO: 40)
Wsc1_CHA
vector production CN3328TB_Xba1
AGTTCTAGATATCGTCGAGTACGCAAG (SEQ ID NO: 41)
Wsc1_CHA
vector production EcoRV-HAm_F
ccgatatcgtacccatacgatgttcctg (SEQ ID NO: 42)
N-terminal
HAtagging HAm-EcoRV_B
ccgatatcttagcgtaatctggaacgtc (SEQ ID NO: 43)
N-terminal
HAtagging EcoRV-3HA_F
ccgatatctacccatacgatgttcctg (SEQ ID NO: 44)
C-terminus
HAtagging 3HA-EcoRV_B
ccgatatcagcgtaatctggaacgtc (SEQ ID NO: 45)
C-terminus
HAtagging Cn1255t_IdenB
atggcctatctattgcgg (SEQ ID NO: 46)
Introduced Wml1_NHA
Diagnosis Cn3328p_IdenF
catgatgctgttacacgc (SEQ ID NO: 47) Introduced Wsc1_CHA
Diagnosis

The prepared cap6 [ Delta] and ktr3 [ Delta] cap6 [ Delta] mutants have activity To prepare the strains into which the CnCAP6 gene was reintroduced ( cap6 [ Delta] :: CAP6 , ktr3 [ Delta] cap6 [ Delta] :: CAP6 ), a 1 kb promoter, 2 kb ORF (Open Reading Frame), and a 0.5 kb terminator ) Was amplified by PCR using primers CN_06016_cp_F_Xho1 and CN_06016_cp_F_Xho1 containing restriction enzyme sites and pJAFS1 vector with NEO marker (Neomycin / G418-resistant marker, provided by James A. Fraser, Center for Infectious Disease Research, School of Chemistry and Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072, Australia) to prepare pJAFS1-CnCAP6. In addition, NEO markers were cut out from pJAFS1-CnCAP6, and pJAFS1-CnCAP6-HYG was prepared by subcloning HyGromycin B resistant marker from pJAF-HYG. Sequencing of the pJAFS1-CnCAP6 and pJAFS1-CnCAP6-HYG and then digested with restriction enzymes EcoN1 cap6 Δ strain and ktr3 Δ Δ cap6 by transforming the strain CnCAP6 re-introduced strain (Δ cap6 confirmed by :: CAP6, ktr3 DELTA cap6 DELTA :: CAP6 ).

Example  4: O- Sugar chain  Biosynthetic gene deletion mutants Sugar chain  Profile Analysis

Each strain was cultured in 100 ml of YPD medium at 220 rpm at 30 ° C for 24 hours, and then suspended in DMSO (dimethyl sulfoxide, Sigma) to remove the capsular polysaccharide. The cells were washed and resuspended in 10 ml citrate buffer (0.1 M, pH 7.0) . After incubation at 121 ° C for 1 hour and 30 minutes, high pressure steam sterilization was carried out to purify cell surface proteins and purified with Concanavalin A to obtain mannose-bound proteins. After drying, hydrazine monohydrate (TCI) The O-oligosaccharide was isolated. The separated oligosaccharides were labeled with 2-aminobenzoic acid (2-AA) at 80 ° C for 45 min and labeled at the reducing end. TSKgel amide (4.6 × 250 mm, 5 μm) column and solvent A (2% acetic acid, 1% tetrahydrofuran in acetonitrile) and solvent B (5% acetic acid, 3% triethylamine, 1% tetrahydrofuran in water).

Cryptococcal kusu to the functionality of the neo CnCAP6 in satiety's involvement to analyze whether as nosil transferase α1,3- only O- sugar chain biosynthesis, cap6 Δ strain and ktr3 Δ Δ cap6 O- cell wall of a sugar chain attached to the protein profile of the strain Respectively. As compared to the sugar chain derived from the wild type strain O- O- oligosaccharide of cap6 Δ strains were Giles agarose residue is combined non-alcoholic (minor) peak did not appear in the sugar chain to the sugar chain of O- ktr3 cap6 Δ Δ strain is one mannose And the other peaks except for the corresponding peak were not observed. Both strains were CnCAP6 ( Cap6 [ Delta] :: CAP6 , ktr3 [ Delta] cap6 [ Delta] :: CAP6 ) showed the recovery of the extension of the non-mainstream oligosaccharide. This indicates that the second mannose residue of the non-mainstream oligosaccharide to which xylose is bound is bound by? 1,3-linkage by CnCAP6 (Fig. 5).

Example 5: Analysis of glycation pattern of secretory proteins in O-oligosaccharide-related gene deletion mutants

Wild type ( H99 ), ktr3 ?, Ktr3 ? / KTR3 cap6 Δ, cap6 Δ :: CAP6 , ktr3 Δcap6 Δ, ktr3 Δcap6 Δ :: CAP6 were cultured in 20 ml of synthetic complete media (0.67% yeast nitrogen base without amino acids, 2% glucose, For 24 hours. Only the culture medium was separated and the secreted protein was concentrated using trichloroacetic acid. Then, Western blotting was performed using an antibody recognizing the secretory proteins of Cryptococcus neoformans.

The secretory protein of the ktr3 Δ strain tended to decrease relative to that of the wild type, whereas the secretory protein of the cap6 Δ strain did not change, and the secretory protein of the ktr3 Δcap6 Δ strain showed a decrease in O-saccharification The protein appeared. These results suggest that the secretory protein of Cryptococcus neoformans exists in a protein in which the O-sugar is modified, and at least one of the proteins is modified by the sugar-transferase encoded by CnKTR3 and CnCAP6.

Example 6: Analysis of glycation pattern of cell surface proteins in O-oligosaccharide biosynthetic gene deletion mutants

Of the 7,946 proteins obtained from the amino acid sequence database of the Cryptococcus neoformans serotype A strain, 958 protein candidates were obtained as a result of the presence of more than 40% of the serine / threonine residues in the first 40 base sequences, , Only 80 proteins were selected by secondary selection of proteins having a transmembrane domain at the C-terminus. Among them, only the protein having the signal peptide without the GPI-anchor domain was further selected. As a result, 12 sensor protein candidates were obtained. Finally, whether or not O-glycosylation can occur was confirmed by NetOGlyc (http: //www.cbs.dtu.dk/services/NetOGlyc/) program to finally select two cell wall retaining sensor proteins.

Two CWI signaling pathway sensor proteins (CnWml1p, CnWsc1p) screened in Cryptococcus were obtained from Pfam (http://pfam.janelia.org/search), SignalP (www.cbs.dtu.dk/services/SignalP) As a result of domain analysis using various programs such as TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and YinOyang (www.cbs.dtu.dk/services/YinOYang) The signal sequence (SS) at the N-terminus and the transmembrane domain (TM) at the C-terminus share a serine / threonine rich domain (S / T-rich domain) (Fig. 6).

CnWML1 and CnWSC1 In order to analyze the physiological characteristics caused by the gene deletion, double-junction PCR was performed using split-marker and biolistic transformation to detect the presence of Cryptococcus serotype A H99 strain CnWML1 and CnWSC1 genes, respectively. CnWML1 and CnWSC1 gene disruption cassettes were transfected into the antigen A H99 strain and transformed with YPD medium containing 100 μg / ml of Nourseothricin. Transformant strains ( wml1 ?, Wsc1 ?) In which CnWML1 and CnWSC1 genes were disrupted were selected. Also CnWML1 and CnWSC1 gene the wml1 wsc1 Δ Δ strain and CnWSC1 crushed at the same time To prepare the wml1 Δ wsc1 Δ :: WSC1 strain into which the gene had been re-introduced, the transformants were screened using geneticin G418 and Hygromycin B resistant marker at 200 μg / ml, respectively 7A).

Each of the wml1Δ and wsc1Δ strains prepared above was pre-cultured in 2 ml of YPD medium at 220 rpm at 30 ° C. for 16 hours, and then 100 μl of sterile water was added to 100 μl of the sterilized water at an initial OD ₆₀₀ value of 1.0, The cells were inoculated with 2 쨉 l of YPD medium supplemented with 1 M NaCl, 1 M NaCl and 1 M sorbitol, respectively, and cultured at 30 째 C for 3 days.

Cryptococcal kusu neo's satiety in wild-type, O- oligosaccharide biosynthesis phenotype which strain is genetically deficient mutant of wml1 Δ, Δ wsc1, wsc1 Δ Δ wml1 CnWSC1 and reintroduced is the target of the gene results in 1M NaCl medium wml1 Δ strain Compared with the wild-type strain, there was no significant difference in growth, but wsc1Δ and wsc1Δwml1 Δ strains were obviously slower growth. Growth was restored by the addition of sorbitol to the 1M NaCl medium and growth was restored in the case of strains reintroduced with CnWSC1 into wsc1 ? Wl1 ? Strain (Fig. 7B). This suggests that the CnWSC1 protein, which is the target of the O-chain biosynthetic gene, is important for cell wall and cell membrane retention.

Comparison of Protein Expression Patterns of CnWML1 and CnWSC1 Gene Highly O-Saccharified in Ktr3 Δ, cap6 Δ, ktr3 Δcap6 Δ Strain with Cryptococcus neoformans serotype A H99 and O-glycosylation pathway For analysis, vectors expressing CnWML1 and CnWSC1 proteins tagged with HA (hemagglutinin) were prepared using the primers shown in the table, and transformed into each defective strain. Cell wall fractionation experiments were performed on the strains prepared above to examine the expression positions of CnWML1 and CnWSC1 proteins (FIG. 8).

Western analysis showed that wild type, CnKTR3 CnWML1 and CnWSC1 proteins showed higher protein sizes (140 kDa) than the predicted size (56 kDa) in the strains isolated from CnCAP6 and CnCAP6 genes, respectively. A large amount of protein was detected in the cell membrane fraction (insoluble) (Fig. 9). These results suggest that the CnWML1 and CnWSC1 proteins are highly O-glycosylated and increased in size and are expressed on the cell surface. CnWSC1 protein in a larger amount in the original shows the predicted protein size (56kDa) gene disrupted strain is not particularly CnKTR3 increased because the mannose sugar chain addition will not occur in a O- size in each shredded strains CnKTR3 and CnCAP6 gene It can be confirmed that the protein is not O-glycosylated. On the other hand, the CnWML1 protein showed a lower expression level in the strain in which the CnCAP6 gene was disrupted than in the case of the CnKTR3 gene disrupted strain compared with the wild-type strain. If O-glycosylation did not occur, the stability of the protein decreased and the CnWML1 protein became CnKTR3 Glucosyltransferase by the? 1,2-mannosyltransferase, which is a CnCAP6 protein, than the? 1,2-mannosyltransferase which is a protein. In particular, both CnWML1 and CnWSC1 proteins showed that the expression of CnKTR3 and CnCAP6 was disrupted at the same time and that O-glycosylation was rarely observed. This suggests that CnKTR3 and CnCAP6 only prolonged the O- Indicating an important factor affecting stability.

Example  7: O- Sugar chain  Analysis of physiological characteristics and in vivo pathogenicity of gene mutation mutants related to biosynthesis

Each strain was preincubated in 2 ml of YPD medium at 220 rpm at 30 ° C for 16 hours, and 100 μl of sterile water was continuously diluted 1/10 in the first OD600 starting at 1.0, followed by addition of 0.05% sodium dodecylsulfate 2 μl each of the cells was inoculated into YPD medium supplemented with dodecyl sulfate (SDS), 0.05% SDS + 1 M sorbitol, 1 M NaCl, 1 M NaCl + 1 M sorbitol and cultured at 30 ° C and 39 ° C for 3 days.

As a result of phenotypic analysis of Cryptococcus neoformans cap6 Δ strain, which has a non - mainstream O - oligosaccharide deficiency, the growth was slowed at 39 ℃ similar to that of ktr3 Δ, but it was higher than that of wild type and lower than that of ktr3 Δ strain in SDS and NaCl. ktr3 Δ cap6 Δ strain was highly inhibited at 39 ℃ and showed the highest sensitivity in SDS and NaCl. It was confirmed that growth was restored by adding sorbitol to stress except SDS, and growth was restored even when CAP6 gene was reintroduced (FIG. 9). This suggests that the CnKTR3 and CnCAP6 genes involved in the O-chain extension of cell wall proteins and the proteins that are targeted by the mannosyltransferases encoded by them are important for the synthesis and maintenance of cell walls and cell membranes.

To perform a pathogenic analysis of O-chain biosynthesis-related gene deletion mutations via the Cryptococcus mouse model, wild type, ktr3 ?, cap6 ?, cap6 ? :: CAP6 , ktr3 ? Cap6 ? And ktr3 ? Cap6 ? :: CAP6 strains The cells were cultured in YPD medium at 30 ° C for 16 hours, washed with PBS (phosphate buffered saline) buffer solution, and the number of yeast cells was adjusted to 2 × 10 ⁶ cells per ml. Ten infected mice were infected by intravenous infusion of 10 ⁵ cells into each nasal cavity of an A / J mouse (Jackson Laboratory, 18-22 g) of 10 mice per each strain for 8 weeks.

In order to investigate the effect of the oligosaccharide structure change by the disruption of CnKTR3 and CnCAP6 , which are involved in the O-chain extension of the cell wall protein, on the pathogenicity in vivo, the pathogenicity of the cap6 Δ and ktr3 Δcap6 Δ strains was examined using a mouse model Respectively.

The virulence of cap6 Δ strain did not show any difference compared to wild type, but the virulence of ktr3 Δcap6 Δ was considerably lower than that of ktr3 Δ strain, so that the virulence of the ktr3 Δcap6 Δ was not observed in the mouse. These results show that the prolongation of O-chain biosynthesis in the cell wall protein and the CnCAP6 and CnKTR3 genes involved therein have a great influence on the pathogenicity of Cryptococcus (Fig. 10). Since the homologous to the CnCAP6 gene product, α1,3-mannosyltransferase, is not present in the human body, the fungal-specific α1,3-mannosyltransferase, which has an important effect on the pathogenicity, is a useful target for the development of antifungal agents will be.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

The scope of the present invention is defined by the appended claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included within the scope of the present invention.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Use of the CnCAP6 gene encoding a mannoslytransferase for          treating mycoses or meningitis by Cryptococcus neoformans <130> ADP-2016-0171 <160> 48 <170> Kopatentin 2.0 <210> 1 <211> 575 <212> PRT <213> Cryptococcus neoformans <400> 1 Met Pro Pro Asp Ile Pro Lys Arg Lys Glu Ser Leu Pro Gln Tyr Ile   1 5 10 15 Ser Ser Gln Arg Ala Pro His Ile Arg Thr Pro Leu Ser Ser Ser Ser              20 25 30 Phe Phe Asn Thr Asn Phe Lys Val Pro Gly Arg Asn Met Ser Asn Ser          35 40 45 Arg Leu Arg Ile Ser Leu Ser Lys Pro Leu Val Arg Val Leu Leu Ile      50 55 60 Gly Ser Leu Leu Ile Ser Leu Val Leu Leu Ser Arg Ile Gly Asn Arg  65 70 75 80 Glu Asp Asp Gly Ala Trp Asp Ala Ser Ser Trp Ser Asp Arg Gly                  85 90 95 Gly Gly Arg Thr Val Ser Arg Gly Gln Arg Lys Gly Trp Ser Leu Trp             100 105 110 Asn Asn Thr Pro Lys Ile Arg Thr Asp Gln Arg Ile Pro Arg Pro Ile         115 120 125 Leu Thr Arg Gln Asn Ala Thr Leu Pro Pro Thr His Pro Gly Arg     130 135 140 Ser Arg Arg Leu Lys Pro Gly Ser Asp Pro Glu Asn Pro Glu Tyr Ile 145 150 155 160 Glu Gly Pro Leu Pro Thr Leu Asp Glu Ala Trp Glu Phe Leu His Pro                 165 170 175 Leu Leu Arg Glu Ile Lys Ser Arg Thr Pro Ser Val Pro Arg Glu His             180 185 190 Glu Leu Thr Glu Pro Ile Phe Pro Pro Phe Leu Arg Asp Asp Leu Lys         195 200 205 Glu Arg Tyr Arg His Leu Arg Asp Val Phe Asp Glu Glu Thr Gly Glu     210 215 220 Trp Val Arg Gly Pro Glu Arg Arg Trp Phe Leu Val Thr Val Cys Arg 225 230 235 240 Gln Val Ala Gly Met Leu Ala Asp Trp Phe Ala Ala Trp Thr Val Leu                 245 250 255 Ala Asp Phe Leu Gly Pro Glu Ser Leu Val Phe Ser Leu Phe Glu Gly             260 265 270 Asp Ser Ala Asp Gly Ser Gly Glu Ile Leu Ala Tyr Ala Met Arg Ala         275 280 285 His Leu Leu Asn Ile Gly Val Pro Pro Ser Asn Ile His Ile Gln Thr     290 295 300 Gln Leu Pro Ala Val Asp Trp Asp His His His Arg Ile Glu Leu Leu 305 310 315 320 Ala Glu Met Arg Asn Ser Gly Met Gln Pro Phe Tyr Asp Thr Ala Ala                 325 330 335 Thr Gly Leu Ser Pro Asp Gly His Ser Trp Thr Gly Ile Val Phe Tyr             340 345 350 Asn Asp Val Tyr Leu Ser Ala Thr His Phe Leu Glu Leu Met His Gln         355 360 365 His Leu Lys Gln Asp Ala Asp Met Thr Cys Gly Trp Asp His Ala Gly     370 375 380 Lys Trp Phe Tyr Asp Gly Trp Val Ala Arg Asp Met Ser Gly Asp Leu 385 390 395 400 Phe Thr Pro Phe Pro Val Arg Glu Glu Asp Lys Asp Leu Pro Gln Lys                 405 410 415 Leu Phe Pro Ser Ser Pro Glu Thr Leu Lys Arg Tyr Asn Arg Leu Leu             420 425 430 Pro Phe Gln Ala Phe Ala Ala Trp Asn Gly Ile Thr Val Met Ser Pro         435 440 445 Glu Pro Phe Leu Pro Pro Tyr Asn Val Arg Phe Arg Arg Gly Thr Pro     450 455 460 Arg Thr Asp Phe Trp Glu Cys Gln Ala Ser Glu Ser Ser Phe Ile 465 470 475 480 Ser Trp Asp Phe Trp Lys Tyr Gly Phe Gly Arg Ile Ala Val Val Pro                 485 490 495 Gly Val His Ala Thr Tyr Gly Lys Gly Asp Ala Met Leu Arg Gly Trp             500 505 510 Val Glu Trp Pro Ser Glu Glu Asp Ser Tyr Gly Glu Thr Ile Trp Trp         515 520 525 Asp Pro Asn Pro Pro His Lys Ile Arg Cys His Asp Trp Pro Asp Lys     530 535 540 Leu Gly Lys Gly Tyr Trp Ala Trp Asp Thr Val Arg Trp Val Lys Pro 545 550 555 560 Pro Lys Leu Glu Ile Pro Ser Ala Ser Glu Thr Thr Val Gln Ser                 565 570 575 <210> 2 <211> 2025 <212> DNA <213> Cryptococcus neoformans <400> 2 atgcctcccg acatacctaa acgaaaggag tctcttcccc aatacatctc gtcacaacga 60 gcacctcaca tccggacgcc cctctcctct tcgtcattct ttaataccaa tttcaaagta 120 ccaggacgaa acatgtcaaa ctcaaggcta cgaatatcat tatcaaagcc actggtcaga 180 gtgctactga taggaagcct gttgatcagc ttggtattac tgtcaagaat aggtaacaga 240 gaagacgatg gcgcatggga cgcgtcgagc tggtcagacc gccatggagg tgggagaacg 300 gtttcgcgag gacaacgaaa aggatggtcg ctatggaata atactccaaa aatacggaca 360 gaccaacgca tacctcgtcc catccttacc agacagaatg ctacattacc cccgccaacc 420 catcctggta gatcacggcg cctgaaaccc ggttcagatc cagaaaaccc agagtatatc 480 gaaggtcctt taccgacatt ggatgaagct tgggagtttc tacatccttt gctgcgggag 540 atcaagtcgc gcacaccgtc ggtgccccgg gagcatgagc taacagagcc gatatttcct 600 ccttttctta gggatgattt gaaggagagg tatagacatc tgagggatgt gtttgacgag 660 gagacgggtg aatgggtgag agggcctgag cggaggtggt ttttggttac ggtatgccgt 720 caggttgctg gtgagttcta atttatacat gggttcgtaa aacgcatgcg ctgagtttgt 780 gtaggtatgc ttgccgactg gttcgctgca tggactgtcc tcgctgactt cttgggcccc 840 gaatcactcg tcttttcgct tttcgagggt gactctgcag acggaaggta cgttttcaca 900 tacagagtgc ggtctagagc tagctaaaac cccatttttt gcacagcggt gaaatcctcg 960 catatgctat gcgtgctcac cttcttaaca tcggcgtacc cccttctaac attcacatcc 1020 aaacccagct ccccgctgta gattgggata atcaccatcg tatcgagctc ctggcagaga 1080 tgcgcaattc gggtatgcag ccgttctacg acactgccgc gacaggtttg tctcccgacg 1140 gccattcttg gacaggtatc gtgttttata acgatgtata cctttcggcg acgcactttt 1200 tggagttgat gcatcagcat ttgaaacagg atgcggatat gacttgtgga tgggatcatg 1260 cgggcaagtg gttctatgat ggatgggttg cgagagatat gagtggagat ctgttcacgc 1320 cgttccctgt cagagaagag gataaggatc tacctcaaaa agtgagtcca tgcccatcct 1380 tatcttttca caagagtcat cccccatttg acacttaaat cagctcttcc cttcctcacc 1440 cgaaacgctc aaacgctaca accgtctgct ccccttccaa gcctttgcag cttggaacgg 1500 tatcaccgtc atgtctcccg aacccttcct ccccccatac aacgtccgtt tccgtcgagg 1560 tacccctcgc acggacgatt tctgggaatg tcaggcgtcg gagagttcct tcatttcgtg 1620 ggacttttgg aaatatggat ttggcaggat agcggtggtt cctggggtgc atgcgacgta 1680 tgggaagggg gatgcgatgc tgagaggttg ggtggagtgg ccctcagagg aggattcgta 1740 tggggaaact atttggtggg atccaaagtg ggtagttttc gcatcattac ttaacgagaa 1800 agttacttat atggttttga tagcccacca cacaaaatta gatgtcatga ctggccggat 1860 aaacttggga aaggttattg ggcatgggta agctataagt cttgcgagac ggacacccca 1920 tcaagctagg atattcgtta actactctcc caggataccg ttcgttgggt caaacctcct 1980 aagctggaga tcccttccgc ttctgagact acagttcaat cttaa 2025 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> M13Fe <400> 3 gtaaaacgac ggccagtgag c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> M13Re <400> 4 caggaaacag ctatgaccat g 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NSL2 <400> 5 aactccgtcg cgagccccat caac 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NSR2 <400> 6 aaggtgttcc ccgacgacga atcg 24 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_L1 <400> 7 gtaatgacga gtgcgaga 18 <210> 8 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_L2 <400> 8 gctcactggc cgtcgtttta catccgatgg gctatacag 39 <210> 9 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_R1 <400> 9 catggtcata gctgtttcct gcttccgctt ctgagacta 39 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_R2 <400> 10 gcaaggtact ctgacatg 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_Sc_F <400> 11 gtgtccgtgc ttgtaatg 18 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > CnD-ACTsqB (B79y) <400> 12 tgtggatgct ggcggaggat a 21 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016D_Sc_F2 <400> 13 gtcccatctg atgtttcg 18 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CN_06016_cp_F_Xho1 <400> 14 ccactcgagg tgtccgtgct tgtaatg 27 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CN_06016_cp_B_EcoRV <400> 15 tacgatatct cgcacaacga cttagca 27 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016_of_F <400> 16 ggtcagagtg ctactgat 18 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_6016_orf_B <400> 17 aactcaccag caacctga 18 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_01255D_L1 <400> 18 caaagcacca agccatac 18 <210> 19 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_01255D_L2 <400> 19 gctcactggc cgtcgtttta cggtggaggg attgtaaag 39 <210> 20 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_01255D_R1 <400> 20 catggtcata gctgtttcct gtgtacccag gagaattgc 39 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_01255D_R2 <400> 21 tatgcgctga gcaaggaa 18 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CNWML1D-confirmF <400> 22 tcgacttcta tctcgtcc 18 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CNWML1D-confirmB <400> 23 ccatactcgt atccatgc 18 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_03328D_L1 <400> 24 agcttagtgg gtgactca 18 <210> 25 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_03328D_L2 <400> 25 gctcactggc cgtcgtttta cgatgatgag tgactgacc 39 <210> 26 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> CN_03328D_R1 <400> 26 catggtcata gctgtttcct gcgccatctt ggctttgat 39 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CN_03328D_R2 <400> 27 aaaggctaat cggcccat 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CNWSC1D-confrimF <400> 28 ctcttgctca tgtcgatc 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CNWSC1D-confrimB <400> 29 aggtagatga agcggtag 18 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Not1CnWSC1D_F <400> 30 aagcggccgc ccggtttggg gttgttta 28 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CnWSC1D_B <400> 31 accctcacta aagggaac 18 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Not1CnWSC1D_F <400> 32 aagcggccgc ccggtttggg gttgttta 28 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CnWSC1D_B <400> 33 accctcacta aagggaac 18 <210> 34 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CN1255OF_Sal1 <400> 34 ccacgtcgac tatcctccac gacttcga 28 <210> 35 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> CN1255OB_Sma1 <400> 35 gacccgggct agtggtggtg gtggtggtga taccggaaat tggcagc 47 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CN1255TF_Sma1 <400> 36 gacccgggac tgtcgtttca tcttaggct 29 <210> 37 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CN1255TB_Xba1 <400> 37 agttctagat actatacgcc cgacaac 27 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CN3328OF_Kpn1 <400> 38 ctcggtaccg gacgatctga gtggttt 27 <210> 39 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> CN3328OB_Sma1 <400> 39 gacccgggtt agtggtggtg gtggtggtgc ctgtagtcat gaggattgg 49 <210> 40 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CN3328TF_Sma1 <400> 40 gacccgggga atagtctggg gcacgt 26 <210> 41 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CN3328TB_Xba1 <400> 41 agttctagat atcgtcgagt acgcaag 27 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> EcoRV-HAm_F <400> 42 ccgatatcgt acccatacga tgttcctg 28 <210> 43 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HAm-EcoRV_B <400> 43 ccgatatctt agcgtaatct ggaacgtc 28 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> EcoRV-3HA_F <400> 44 ccgatatcta cccatacgat gttcctg 27 <210> 45 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 3HA-EcoRV_B <400> 45 ccgatatcag cgtaatctgg aacgtc 26 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Cn1255t_IdenB <400> 46 atggcctatc tattgcgg 18 <210> 47 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Cn3328p_IdenF <400> 47 aagcggccgc ccggtttggg gttgttta 28 <210> 48 <211> 374 <212> PRT <213> Cryptococcus neoformans <400> 48 Met Ala Gly Gly Leu Val Phe Leu Leu His Val Leu Leu Ser Val His   1 5 10 15 Pro Thr Tyr Arg Glu Lys Thr Ser Ile Leu Asn Leu Leu Pro Gln Gln              20 25 30 Asp Gly Trp Arg Glu Gly Gln Pro Pro Pro Asn Ser Ala Ile Pro Pro          35 40 45 Val Val Gly Asp Leu Ala Glu Asn Glu Ala Ala Leu Glu Gly Arg Arg      50 55 60 Lys Ala Asn Ala Val Phe Val Val Leu Ala Arg Asn Ser Asp Leu Trp  65 70 75 80 Pro Phe Leu Asp Ser Met Arg Gln Met Glu Asp Arg Phe Asn His Trp                  85 90 95 Ala Lys Tyr Asp Tyr Val Phe Leu Asn Glu Glu Asp Phe Ser Asp Glu             100 105 110 Phe Lys Arg Tyr Thr Gln Ser Met Thr Lys Ala Lys Cys Tyr Tyr Gly         115 120 125 Lys Ile Asp Pro Glu His Trp Tyr Gln Pro Glu Trp Ile Asp Glu Asp     130 135 140 Lys Ala Ser Lys Ala Arg Glu Glu Met Ile Arg Lys Lys Val Ile Tyr 145 150 155 160 Gly His Ser Val Pro Tyr Arg Asn Met Cys Arg Phe Asn Ser Gly Phe                 165 170 175 Phe Phe Arg His Pro Leu Leu Ala Asn Tyr Asp Tyr Tyr Trp Arg Ile             180 185 190 Glu Pro Ser Val Lys Phe Phe Cys Asp Leu Ala Tyr Asp Pro Phe Leu         195 200 205 Val Met Gln Asp Gln Asn Lys Val Tyr Gly Phe Thr Leu Ser Leu Phe     210 215 220 Glu Tyr Ile Glu Thr Ile Pro Thr Leu Trp Asp Ala Val Lys Glu Phe 225 230 235 240 Ile Gly Glu His Pro Asp Tyr Leu Pro Glu Gly Asn Ala Met Gln Phe                 245 250 255 Leu Ser Asp Asp Gly Gly Glu Thr Tyr Asn Lys Cys His Phe Trp Ser             260 265 270 Asn Phe Glu Ile Gly Asp Leu Asn Phe Trp Arg Ser Gln Pro Tyr Met         275 280 285 Glu Phe Phe Asp Phe Leu Asp Lys Lys Gly Gly Phe Tyr Tyr Glu Arg     290 295 300 Trp Gly Asp Ala Pro Val His Ser Ile Gly Ala Ala Leu Phe Ala Lys 305 310 315 320 Lys Glu Gln Ile His Phe Phe Asp Asp Ile Gly Tyr Arg His Glu Pro                 325 330 335 Phe Gln His Cys Pro Gln Gly Asp Ala His Thr Arg Gly Asn Cys Trp             340 345 350 Cys Asp Gln Ala Asn Asn Phe Asp Trp Glu Trp Tyr Ser Cys Thr Lys         355 360 365 Lys Tyr Thr Glu Met Phe     370

Claims (14)

Contacting the test substance to a cell comprising the CnCAP6 protein represented by SEQ ID NO: 1 and the CnKTR3 protein represented by SEQ ID NO: 48;
Measuring the level of expression or activity of CnCAP6 protein and CnKTR3 protein in the cells to which the test substance is contacted; And
Selecting a test substance having a decreased degree of expression or activity of the CnCAP6 protein and the CnKTR3 protein as compared with a control sample. delete The method according to claim 1, wherein the level of expression or activity of the CnCAP6 protein and the CnKTR3 protein is determined by reverse transcription-polymerase chain reaction (RT-PCR), enzyme immunoassay (ELISA), immunohistochemistry, Western blotting Western blotting, and flow cytometry (FACS). &Lt; Desc / Clms Page number 19 &gt; The antifungal agent screening method according to claim 1, wherein the fungus is Cryptococcus neoformans . Contacting the test substance to a cell comprising the CnCAP6 protein represented by SEQ ID NO: 1 and the CnKTR3 protein represented by SEQ ID NO: 48;
Measuring the level of expression or activity of CnCAP6 protein and CnKTR3 protein in the cells to which the test substance is contacted; And
Selecting a test substance having decreased expression or activity level of the CnCAP6 protein and the CnKTR3 protein as compared with a control sample. delete 48. A pharmaceutical composition for an antifungal agent comprising as an active ingredient an expression or activity inhibitor of a CnCAP6 protein represented by SEQ ID NO: 1 and a CnKTR3 protein represented by SEQ ID NO: 48. delete 8. The method according to claim 7, wherein the CnCAP6 protein and CnKTR3 protein expression inhibitor is selected from the group consisting of an antisense nucleotide complementary to mRNA of CnCAP6 gene and CnKTR3 gene, a small interfering RNA (siRNA) and a short hairpin RNA ; shRNA). &lt; / RTI &gt; The method of claim 7, wherein the activity inhibitor of CnCAP6 protein and CnKTR3 protein is any one selected from the group consisting of a compound specifically binding to CnCAP6 protein and CnKTR3 protein, a peptide, a peptide mimetic, an aptamer, and an antibody Or a pharmaceutically acceptable salt thereof. 10. The pharmaceutical composition according to claim 9, wherein the CnCAP6 gene is SEQ ID NO: 2. 8. The pharmaceutical composition according to claim 7, wherein the fungus is Cryptococcus neoformans . 48. A pharmaceutical composition for preventing or treating meningitis comprising the CnCAP6 protein represented by SEQ ID NO: 1 and the CnKTR3 protein represented by SEQ ID NO: 48 as an active ingredient. delete

Images