KR20210052111A - Strain with Improved Aromatic Amino Acid Production Capacity by Pyridoxal Kinase Gene Inactivation - Google Patents

Abstract

Disclosed is a mutant strain with improved aromatic amino acid production capacity by weakening or inactivating the activity of pyridoxal kinase expressed by pyridoxal kinase K (pdxK) or pyridoxal kinase Y (pdxY) gene.

Description

Strain with Improved Aromatic Amino Acid Production Capacity by Pyridoxal Kinase Gene Inactivation {Strain with Improved Aromatic Amino Acid Production Capacity by Pyridoxal Kinase Gene Inactivation}

The present invention relates to a strain having improved amino acid production capacity by inactivation of a pyridoxal kinase gene.

Aromatic amino acids, especially L-tryptophan and L-phenylalanine, are key products of feed amino acids and are a high value-added industry with an annual market of $300 billion worldwide.

Aromatic amino acids are produced using recombinant strains, and research is being actively conducted to increase their production. Chorismate is a precursor necessary for the biosynthetic pathway of aromatic amino acids. To produce it, phosphoenolpyruvate (PEP), erythrose-4-phosphate (E4P), phosphoribosyl pyrophosphate (PRPP), serine, glutamine ), etc. are required. Therefore, in the past, studies have been conducted to enhance the biosynthetic pathway of E4P, PEP, or PRPP in order to improve L-tryptophan production capacity.

However, it has not been reported that the production of aromatic amino acids is increased by inactivating the pyridoxal kinase of the strain.

Republic of Korea Registration Gazette No. 10-1830002 (2018.02.09)

According to one embodiment, by inhibiting the expression of the pyridoxal kinase gene provides a strain having improved production capacity of aromatic amino acids.

One aspect is that the activity of the pyridoxal kinase (pyridoxal kinase) expressed by the pdxK (pyridoxal kinase K) or pdxY (pyridoxal kinase Y) gene is weakened or inactivated, thereby providing a mutant strain with improved aromatic amino acid production ability.

The mutant strain may have both attenuated or inactivated activities of pyridoxal kinase expressed by pdxK (pyridoxal kinase K) and pdxY (pyridoxal kinase Y) genes.

The pdxK gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

The pdxY gene may be composed of the nucleotide sequence of SEQ ID NO: 10.

The present inventors suppressed the pyridoxal kinase activity by lowering the expression of the pdxK (pyridoxal kinase K) and/or pdxY (pyridoxal kinase Y) genes.As a result, the energy used for the production of pyridoxal phosphate (PLP) decreased. Instead, it was found that the productivity of aromatic amino acids could be improved.

The term "reduced activity" as used herein means that the expression level of a gene, which is an object, is decreased compared to the original expression level. This attenuation of activity is when the activity of the enzyme itself is decreased compared to the activity of the enzyme of the original microorganism through nucleotide substitution, insertion, deletion, or a combination of nucleotide encoding the gene, and inhibition of expression or translation of the gene encoding it. In the case where the overall degree of enzyme activity in the cell is lower than that of the natural strain or the strain before modification, a combination thereof is also included.

As used herein, the term "inactivation" refers to a case in which the expression of a gene encoding a protein such as an enzyme is not expressed at all compared to a natural strain or a strain before modification, and when there is no activity even if it is expressed.

The term "increased expression" as used herein means that the expression level of a gene, which is an object, is increased compared to the original expression level. When a gene for increasing expression does not exist in the pre-mutation strain, one or more genes can be introduced into the chromosome of the strain to increase expression, and when a gene for increasing expression is present in the pre-mutation strain In the above, one or more genes may be additionally introduced into the strain or genetically engineered to increase the expression level of an existing gene.

In the present invention, the method of modifying the expression control sequence is performed by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the nucleic acid sequence of the expression control sequence, or by using a weaker promoter. It can be carried out by a method such as replacement. The expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.

In addition, the method of modifying the gene sequence on the chromosome is performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the gene sequence so that the activity of the enzyme is further weakened, or a weaker activity is achieved. It can be carried out by replacing with a gene sequence that has been improved to have or a gene sequence that has been improved so that there is no activity.

According to one embodiment, the aromatic amino acid may be L-tyrosine, L-tryptophan, and L-phenylalanine.

According to one embodiment, the mutant strain may be formed by insertion, substitution, or deletion of all or part of the sequence of any one or all of the pdxK gene and the pdxY gene.

According to one embodiment, the mutant strain may be a strain of Escherichia genus.

According to one embodiment, the strain of the genus Escherichia may be Escherichia coli, for example, KFCC11660P and KCCM10016 deposited strains.

According to another aspect, there is provided a method for producing an aromatic amino acid comprising culturing the mutant strain in a medium, and recovering the aromatic amino acid from the cultured strain and the culture medium.

The strain used in the present invention may be cultured through a culture method known in the art. As a medium, natural or synthetic medium may be used. As the carbon source of the medium, for example, glucose, sucrose, dextrin, glycerol, starch, etc. may be used, and as the nitrogen source, peptone, meat extract, yeast extract, dried yeast, soybean cake, urea, thiourea, ammonium salt, nitrate And other organic or inorganic nitrogen-containing compounds may be used, but are not limited to these components.

Inorganic salts contained in the medium may include phosphates such as magnesium, manganese, potassium, calcium, iron, etc., nitrates, carbonates, chlorides, etc., but are not limited thereto. In addition to the components of the carbon source, nitrogen source and inorganic salt, amino acids, vitamins, nucleic acids and related compounds may be added to the medium.

The temperature of the culture may be 27 to 40 ℃ more preferably 30 to 37 ℃, but is not limited thereto. The cultivation period may be continued until the desired production amount of the useful substance is obtained, and preferably may be 10 to 100 hours, but is not limited thereto.

In the step of recovering the aromatic amino acid, the desired amino acid can be recovered from the culture medium using a suitable method known in the art according to the method of culturing the microorganism of the present invention, for example, a batch, continuous, or fed-batch culture method. , The recovery step may include a purification process.

According to one embodiment, the medium may be a medium to which pyridoxal 5'-phosphate is added.

According to one embodiment, the aromatic amino acid may be L-tryptophan and L-phenylalanine.

According to one embodiment, the production of aromatic amino acids of the strain may be increased by weakening or inactivating the pdxK and/or pdxY genes of the strain.

Hereinafter, one or more specific examples will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1-2: Preparation of a mutant strain in which the pdxK gene was deleted

One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci USA. 2000 Jun 6 to parent strains (accession numbers: KFCC11660P and KCCM10016); 97(12):6640-5) was used to construct a mutant strain in which the pdxK gene was inactivated.

KFCC11660P strain and KCCM10016 strain are Escherichia coli strains, and pKD46 (GenBank accession number AY048746), a red recombinase plasmid, is introduced for homologous recombination of the fourth fragment, and pKD46 is removed prior to introduction of pCP20.

The pdxK gene was deleted by homologous recombination of the DNA fragment containing the pdxK gene and the antibiotic gene, and the pdxK gene was inactivated by undergoing a process of removing the antibiotic resistance gene from the recombined DNA fragment. The specific process is as follows.

(1) Production of the first short

PCR reaction using pdxK_PF, pdxK_PR primer pair and pKD13 plasmid (Genbank accession number AY048744) having a partial sequence of the pdxK gene and a partial sequence of the pKD13 plasmid in Table 1 (total volume 50 μl, 95° C. 5 minutes after 1 cycle, 95 C for 30 seconds, 58° C. for 30 seconds, 72° C. for 2 minutes, after a total of 30 cycles, 72° C. for 5 minutes and 12° C. for 10 minutes), an amplified first fragment of about 1.4 kb was obtained. The first fragment contains a kanamycin resistance gene derived from the pKD13 plasmid.

primer Sequence number Base sequence (5’-3’) pdxK One

pdxK_HF1 2 GTTACGGGTATTGCCGAGCT pdxK_HR1 3 TTAATTTTTTCTCCTTGCCG pdxK_PF 4 CGGCAAGGAGAAAAAATTAAgtgtaggctggagctgcttc pdxK_PR 5 CGCCCATCGGCGCCATTTTTctgtcaaacatgagaattaa pdxK_HF2 6 AAAAATGGCGCCGATGGGCG pdxK_HR2 7 GGCGTTGAACTGTTCGTCCA pdxK_CF 8 GCTCTTACCGGGGATCTTCA pdxK_CR 9 GCTATCAAACCAACGGGTAA

(2) Production of the second short

To obtain the front fragment of the pdxK gene, use the genomic DNA of E. coli MG1655 as a template, and PCR using the primers pdxK_HF1 and pdxK_HR1 in Table 1 (total volume 50 μl, 95° C. 5 minutes 1 cycle, 95° C. 30 Second, 58°C for 30 seconds, 72°C for 30 seconds, after a total of 30 cycles, 72°C for 5 minutes and 12°C for 10 minutes) to obtain a second fragment amplified by about 0.3 kb.

(3) Production of the 3rd short film

In addition, in order to obtain the rear fragment of the pdxK gene, PCR reaction using the primers pdxK_HF2 and pdxK_HR2 in Table 1 using the genomic DNA of E. coli MG1655 as a template (total volume 50 µl, 95°C for 5 minutes 1 cycle, 95°C for 30 seconds. , 58°C for 30 seconds, 72°C for 30 seconds, 72°C for a total of 30 cycles, and 12°C for 10 minutes) to obtain an amplified third fragment of about 0.3 kb.

(4) Production of the 4th short film

Each of the first fragment, the second fragment, and the third fragment amplified in the above experiment may be linked into one fragment due to the complementary sequence of the primer during amplification. These fragments were subjected to a total volume of 50 µl excluding primers, 95°C for 5 minutes, 1 cycle, 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 2 minutes and 30 seconds, and a total of 30 cycles at 72°C for 5 minutes and 12 PCR was performed under conditions of 10 minutes at °C to obtain one amplified fourth fragment having a size of about 2 kb. The fourth fragment includes a part of the pdxK gene and a kanamycin antibiotic resistance gene. Specifically, it is composed of a part of the pdxK gene in the 5'direction, a kanamycin antibiotic resistance gene, and a part of the pdxK gene in the 3'direction.

(5) injection of the fourth fragment and deletion of pdxK

The fourth fragment obtained from each of the Escherichia coli strains KFCC11660P and KCCM10016 strains containing the red recombinase plasmid pKD46 (GenBank accession number AY048746) was injected by electroporation. The fourth fragment is replaced by a homologous recombination with pdxK by Lambda Red recombination, whereby pdxK is deleted.

Subsequently, a PCR reaction was performed on a cell line exhibiting kanamycin resistance to confirm the deletion of the pdxK gene. The reaction was performed using the pdxK_CF and pdxK_CR primers in Table 1 in a total volume of 20 µl, 95°C for 5 minutes and 1 cycle, 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 3 minutes, and a total of 30 cycles at 72°C. PCR was performed under conditions of 5 minutes and 10 minutes at 12°C. Compared with the original pdxK gene, about 1.6 kb (before deletion), when the fragment is inserted into the chromosome, about 2.2 kb (including the antibiotic gene) is generated.

(6) Antibiotic resistance gene removal and selection

In order to remove the antibiotic resistance marker gene from the strain in which the pdxK gene was deleted, the pCP20 plasmid was introduced to induce FLP recombination. After that, it was confirmed that the antibiotic resistance marker gene was removed by culturing the pdxK deletion strain in LB plate medium with or without antibiotics.

Example 1-2: Evaluation of the production of aromatic amino acids in strains in which the pdxK gene was deleted

E. coli KFCC11660PΔpdxK and KFCC11660P prepared by the method of Example 1-1 were cultured in the tryptophan production medium shown in Table 2 below.

In addition, E. coli KCCM10016ΔpdxK and KCCM10016 prepared by the method of Example 1-1 were cultured in the medium for phenylalanine production of Table 2 below.

The culture was performed by inoculating 1% of each of the KFCC11660PΔpdxK, KFCC11660P KCCM10016ΔpdxK, and KCCM10016 strains in a flask containing 10 mL of tryptophan production medium or phenylalanine production medium each having the composition shown in Table 2 below and inoculate 200 at 37°C. Shaking culture was performed at rpm for 70 hours, and the concentrations of L-amino acids obtained therefrom were compared.

As a result of the experiment, when the pdxK gene was inactivated, the incubation time was lengthened, but it was confirmed that the production of tryptophan and phenylalanine increased as shown in Table 3 below. According to Table 3 below, it was confirmed that the KFCC11660P strain improved the production of L-tryptophan by more than 4% when the pdxK gene was inactivated, and the KCCM10016 strain showed that when the pdxK gene was inactivated, the production of L-phenylalanine was improved by more than 5% (below. See Table 3 A).

In addition, as a result of culturing by adding Pyridoxal 5′-phosphate to the medium, it was confirmed that the cultivation time decreased and the amount of aromatic amino acid production increased (see Table 3 B).

Example 2-1: Manufacture of mutant strain in which the pdxY gene is deleted

A mutant strain in which the pdxY gene was deleted was prepared in the same manner as in Example 1-1, except that pdxY was inactivated instead of pdxK.

The pdxY gene and the DNA fragment containing the antibiotic gene were homologously recombined to delete the pdxY gene, and the antibiotic resistance gene was removed from the recombined DNA fragment, thereby inactivating the pdxY gene.

In the preparation of the pdxY deletion strain, the primers shown in Table 4 were used.

primer Sequence number Base sequence (5’-3’) pdxY 10

pdxY_HF1 11 GTACCGATGGTTGAGATGGA pdxY_HR1 12 GTTCCCTGTATAAAAACCAGGGGG pdxY_PF 13 CTGGTTTTTATACAGGGAACgtgtaggctggagctgcttc pdxY_PR 14 GTGGGCCGAAATGAGATATTctgtcaaacatgagaattaa pdxY_HF2 15 AATATCTCATTTCGGCCCACAACG pdxY_HR2 16 GGAAGAGTACAAACCGACAG pdxY_CF 17 CAGGTGACTCGTCTGGTTCA pdxY_CR 18 ATGCAGTATCTTGCCGACAG

Example 2-2: Evaluation of the amount of aromatic amino acid production of the strain in which the pdxY gene was deleted

The method of Example 1-2, culture medium and culture conditions were the same, and the production of aromatic amino acids was evaluated.

As a result of the experiment, when the pdxY gene was inactivated, the incubation time was lengthened, but it was confirmed that the production of tryptophan and phenylalanine increased as shown in Table 5 below. According to Table 5 below, it was confirmed that the KFCC11660P strain improved the production of L-tryptophan by about 10% when the pdxY gene was inactivated, and the KCCM10016 strain was confirmed that the production of L-phenylalanine was improved by about 10% when the pdxY gene was inactivated. See Table 5 A).

In addition, as a result of culturing by adding Pyridoxal 5′-phosphate to the medium, it was confirmed that the cultivation time decreased and the amount of aromatic amino acid production increased (see Table 5 B).

Example 3-1: Preparation of strains in which pdxK and pdxY genes are deleted at the same time

In the same manner as in Examples 1-1 and 2-1, the pdxK gene was inactivated, and then the pdxY gene was inactivated to prepare a mutant strain in which both pdxK and pdxY were deleted.

The pdxK and pdxY genes were sequentially homologously recombined with the DNA fragment containing the antibiotic gene to delete the pdxK and pdxY genes, and the antibiotic resistance gene was removed from the recombined DNA fragment, thereby inactivating the pdxK and pdxY genes. .

The primers used to prepare pdxK and pdxY deletion strains were the same as those used in Examples 1-1 and 2-1.

Example 3-2: Evaluation of the production of aromatic amino acids in strains in which the pdxK and pdxY genes were simultaneously deleted

The methods of Examples 1-2 and 2-2, the medium and culture conditions were cultured in the same manner, and the production of aromatic amino acids was evaluated.

As a result of the experiment, it was confirmed that the incubation time was delayed when the pdxK and pdxY genes were inactivated, but the production of tryptophan and phenylalanine increased as shown in Table 6 below. According to Table 6 below, when the pdxK and pdxY genes are inactivated at the same time, the production of L-tryptophan is improved by about 13% in the KFCC11660P strain, and when the pdxK and pdxY genes are simultaneously inactivated, the KCCM10016 strain produces about 12% of L-phenylalanine It was confirmed that it is improved (see A in Table 6 below).

In addition, as a result of culturing by adding Pyridoxal 5′-phosphate to the medium, it was confirmed that the cultivation time decreased and the production of aromatic amino acids further increased (see Table 6 B).

<110> Daesang Corporation <120> Strain with Improved Aromatic Amino Acid Production Capacity by Pyridoxal Kinase Gene Inactivation <130> PN190274 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 852 <212> DNA <213> Artificial Sequence <220> <223> pdxK "PDXK-MONOMER" (complement(2536386..2537237)) Escherichia coli K-12 substr. MG1655 <400> 1 atgagtagtt tgttgttgtt taacgataag agtagggcac tgcaggcgga tatcgtcgcc 60 gtgcagtcgc aggtggttta cggcagcgtg ggcaacagca ttgccgtgcc tgctatcaaa 120 cagaacggcc tgaatgtctt tgccgtgccg acggtattgc tgagcaatac gccgcattat 180 gacactttct acggtggtgc gattccggac gaatggttta gcggctattt gcgtgcgctt 240 caggagcgtg atgcgctgcg ccaacttcgt gctgtaacca cgggctatat gggaacggca 300 tcgcaaatca aaatccttgc cgagtggctg actgcgctac gcaaagacca tcctgaccta 360 ttgatcatgg tcgatccggt gattggcgat attgatagcg gaatttatgt caaacctgac 420 cttcccgaag cgtatcgaca atatttactg ccgctggcgc agggaattac ccccaatatc 480 tttgagttgg aaatcctgac cggtaaaaat tgccgcgatc tcgacagtgc cattgctgcc 540 gcaaaaagtc tgctttcaga cacattaaaa tgggtggtgg ttaccagcgc ctccggtaat 600 gaagaaaatc aggagatgca ggttgtggtg gtcactgccg acagcgtgaa tgtcatttcc 660 cattcacggg taaaaaccga cctgaaaggg actggcgacc tgttttgtgc tcagctcatc 720 agtggcttgc tgaaagggaa ggcgttaacc gatgcagtgc accgagcggg gttgcgcgta 780 ctggaagtga tgcgctacac ccagcagcat gagagcgatg aattgatttt gccgccgctg 840 gcggaagcat aa 852 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_HF1 <400> 2 gttacgggta ttgccgagct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_HR1 <400> 3 ttaatttttt ctccttgccg 20 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pdxK_PF <400> 4 cggcaaggag aaaaaattaa gtgtaggctg gagctgcttc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pdxK_PR <400> 5 cgcccatcgg cgccattttt ctgtcaaaca tgagaattaa 40 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_HF2 <400> 6 aaaaatggcg ccgatgggcg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_HR2 <400> 7 ggcgttgaac tgttcgtcca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_CF <400> 8 gctcttaccg gggatcttca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxK_CR <400> 9 gctatcaaac caacgggtaa 20 <210> 10 <211> 864 <212> DNA <213> Artificial Sequence <220> <223> pdxY "PDXY-MONOMER" (complement(1715026..1715889)) Escherichia coli K-12 substr. MG1655 <400> 10 atgatgaaaa atattctcgc tatccagtct cacgttgttt atggtcatgc gggtaacagt 60 gcggcagagt ttccgatgcg ccgcctgggc gcgaacgtct ggccgctgaa caccgttcaa 120 ttttctaatc acacccaata cggcaaatgg actggctgcg tgatgccgcc cagccattta 180 accgaaattg tgcaaggcat tgccgccatt gataaattac acacctgtga tgccgtatta 240 agtggctatc tgggatcggc ggagcagggt gaacatatcc tcggtatcgt ccgtcaggtg 300 aaagccgcga atccgcaggc gaaatatttt tgcgatccgg taatgggtca tccggaaaaa 360 ggctgtatcg ttgcaccggg tgtcgcagag tttcatgtgc ggcacggttt gcctgccagc 420 gatatcattg cgccaaatct ggttgagctg gaaatactct gtgagcatgc ggtaaataac 480 gtcgaagaag cggttctggc agcgcgcgaa ctcattgcgc aagggccaca aattgtgttg 540 gttaaacacc tggcgcgagc tggctacagc cgtgaccgtt ttgaaatgct gctggtcacc 600 gccgatgaag cctggcatat cagccgtccg ctggtggatt ttggtatgcg ccagccggta 660 ggtgttggtg atgtgacgag cggtttactg ctggtgaaac tgcttcaggg ggcaacgctg 720 caggaggcgc tggaacatgt gaccgctgca gtctacgaaa tcatggtgac caccaaagca 780 atgcaggaat atgagctgca agtggtggct gctcaggatc gtattgccaa accagaacat 840 tacttcagcg caacaaagct ctga 864 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxY_HF1 <400> 11 gtaccgatgg ttgagatgga 20 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pdxY_HR1 <400> 12 gttccctgta taaaaaccag gggg 24 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pdxY_PF <400> 13 ctggttttta tacagggaac gtgtaggctg gagctgcttc 40 <210> 14 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pdxY_PR <400> 14 gtgggccgaa atgagatatt ctgtcaaaca tgagaattaa 40 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> pdxY_HF2 <400> 15 aatatctcat ttcggcccac aacg 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxY_HR2 <400> 16 ggaagagtac aaaccgacag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxY_CF <400> 17 caggtgactc gtctggttca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pdxY_CR <400> 18 atgcagtatc ttgccgacag 20

Claims (10)

A mutant strain with improved aromatic amino acid production ability by weakening or inactivating the activity of pyridoxal kinase expressed by pdxK (pyridoxal kinase K) or pdxY (pyridoxal kinase Y) gene. The method of claim 1,
The pdxK gene is composed of the nucleotide sequence of SEQ ID NO: 1,
The pdxY gene is composed of the nucleotide sequence of SEQ ID NO: 10,
Mutant strain. The method of claim 1,
The mutant strain is that all of the activities of the pyridoxal kinase expressed by the pdxK and pdxY genes are weakened or inactivated,
Mutant strain. The method of claim 1,
The aromatic amino acids are L-tryptophan and L-phenylalanine,
Mutant strain. The method of claim 1,
The activity of the pyridoxal kinase is that all or part of the sequence of one or both of the pdxK gene and the pdxY gene is inserted, substituted, or deleted.
Mutant strain. The method of claim 1,
The mutant strain is a strain of the genus Escherichia,
Mutant strain. The method of claim 6,
The Escherichia strain is Escherichia coli,
Mutant strain. Culturing the mutant strain of claim 1 in a medium; And
Comprising the step of recovering the aromatic amino acid from the cultured mutant strain and the culture medium,
A method for producing aromatic amino acids. The method of claim 8,
The medium is a medium to which pyridoxal 5'-phosphate is added,
A method for producing aromatic amino acids. The method of claim 8,
The aromatic amino acids are L-tryptophan and L-phenylalanine,
A method for producing aromatic amino acids.