KR20210036676A - Biomarkers for prognosis prediction of ovarian cancer and uses thereof - Google Patents

Abstract

The present invention relates to a biomarker for predicting a prognosis of ovarian cancer, and a use thereof. A composition for predicting a prognosis of ovarian cancer using the biomarker comprises an agent which measures the expression level of a protein or mRNA of hypoxia-inducible factor-1 beta (HIF-1ß) and von Hippel-Lindau (VHL). According to the present invention, after primary treatment in patients with high-grade serous cystadenocarcinoma, which is the most common histologic type of ovarian cancer, especially epithelial ovarian cancer, the expression of specific biomarkers is analyzed, and information enabling prediction of a prognosis is provided. Thus, ovarian cancer patients are enabled to receive appropriate prognostic measures.

Description

Biomarkers for predicting the prognosis of ovarian cancer and their uses {BIOMARKERS FOR PROGNOSIS PREDICTION OF OVARIAN CANCER AND USES THEREOF}

The present invention relates to a biomarker for predicting the prognosis of ovarian cancer and a use thereof, and specifically, to a composition or kit for predicting the prognosis of ovarian cancer using the biomarker, and a method of providing information for predicting the prognosis of ovarian cancer.

It is known that the expression of hypoxia-related genes can affect carcinogenesis and progression, but in the case of epithelial ovarian cancer, HIF-1α (hypoxia-inducible factor-1 alpha) and VEGF (vascular endothelial growth). factor) is evaluated.

However, even in epithelial ovarian cancer, high-grade serous cystadenocarcinoma, low-grade serous cystadenocarcinoma, endometrioid adenocarcinoma, clear cell carcinoma ovarian cancer There are various histological types such as, and evaluation of the role of hypoxia-related genes for predicting prognosis according to each histological type is insufficient.

In particular, studies on specific hypoxia genes for predicting prognosis in high-grade serous ovarian cancer, which account for 70% to 80% of all epithelial ovarian cancers, are insufficient.

It is an object of the present invention to target ovarian cancer, especially tissue after primary treatment in patients with high-grade serous cystadenocarcinoma, the most common histological type of epithelial ovarian cancer. To provide a composition for predicting the prognosis of ovarian cancer that can enable ovarian cancer patients to receive appropriate prognostic measures by providing information that can predict the prognosis by analyzing the expression of biomarkers.

Another object of the present invention is to provide a kit for predicting the prognosis of ovarian cancer comprising the composition for predicting the prognosis of ovarian cancer.

Another object of the present invention relates to a method for providing information for predicting the prognosis of ovarian cancer using the biomarker.

According to an embodiment of the present invention, a composition for predicting prognosis of ovarian cancer comprising an agent measuring the expression level of mRNA or protein of HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau) Provides.

The ovarian cancer may be high-grade serous cystadenocarcinoma ovarian cancer.

As the ovarian cancer progresses, the expression of HIF-1ß increases, and the expression of VHL may decrease.

The agent for measuring the expression level of the mRNA may be a primer pair, a probe, or an antisense nucleotide that specifically binds to the mRNA.

The primer sequence of HIF-1ß may be the following SEQ ID NO: 1 or 2.

SEQ ID NO: 1: 5'-AGGAACAGATGCAGGAATGG-3' (Forward)

SEQ ID NO: 2: 5'-GGCTGGTAGCCAACAGTAGC-3' (Reverse)

The primer sequence of the VHL may be the following SEQ ID NO: 3 or 4.

SEQ ID NO: 3: 5'-CCCAAATGTGCAGAAAGACC-3' (Forward)

SEQ ID NO: 4: 5'-AGGCAGACAAGTCACCAACC-3' (Reverse)

The agent for measuring the expression level of the protein may be an antibody that specifically binds to the protein or protein fragment.

According to another embodiment of the present invention, there is provided a kit for predicting the prognosis of ovarian cancer comprising the composition for predicting the prognosis of ovarian cancer.

According to another embodiment of the present invention, measuring the expression level of mRNA or protein of HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau) in a biological sample isolated from an individual And, it provides a method of providing information for predicting the prognosis of ovarian cancer comprising the step of comparing the measured expression level with the expression level of the control.

The present invention targets patients with high-grade serous cystadenocarcinoma, the most common histological type of ovarian cancer, particularly epithelial ovarian cancer. By analyzing the expression of ovarian cancer and providing information that can predict the prognosis, it may be possible for ovarian cancer patients to receive appropriate prognostic measures.

1 is a graph comparing the basal expression of HIF-1ß and VHL in normal ovary and high-grade serous ovarian carcinoma (HGSO).
Figure 2 is a graph showing the increase in the OV90 cell viability (increased anticancer drug resistance) according to the high-grade serous ovarian carcinoma cell line (A) in OV90 after IC ₅₀ determination of the cisplatin and (b) the administration of IC ₅₀ cisplatin hypoxia severe.
FIG. 3 shows (a) CBP, (b) P300, (c) HIF-1α, (D) HIF-1ß, (E) FIH, ( F) A graph showing changes in VHL gene expression. As hypoxia intensifies, HIF-1ß mRNA expression increases and VHL mRNA expression decreases.
4 is a graph showing an increase in HIF-1ß protein expression and a decrease in VHL protein expression according to intensification of hypoxia after cisplatin administration in OV90, a high-grade serous ovarian cancer cell line.
5 is a graph for determining the concentration range of NAC (N-acetylcysteine) that does not affect cell proliferation using a proliferation assay for OV90, a high-grade serous ovarian cancer cell. As a result, 1 mM to 10 mM were confirmed as a range of concentrations that did not affect the proliferation of cells.
6 is a graph showing the reduction of active oxygen in OV90 according to the gradual increase in NAC and (b) inhibition of active oxygen reduction by the addition of cisplatin to NAC for OV90, a high-grade serous ovarian cancer cell.
7 is a graph showing an increase in HIF-1ß protein expression and a decrease in VHL protein expression according to an increase in NAC after cisplatin administration in OV90, a high-grade serous ovarian cancer cell line.
Figure 8 is a comparative evaluation result of progression-free survival according to hypoxia gene expression in high-grade serous ovarian cancer patients ((a) CBP; (b) P300; (c) HIF-1α; (D) HIF-1ß; (E)) FIH; (bar) VHL). Among them, it was confirmed that the lower the expression of HIF-1ß and the higher the expression of VHL, the significantly higher the progression-free survival rate.

Hereinafter, the present invention will be described in more detail.

The present invention is a technology using HIF-1ß and VHL as biomarkers capable of predicting the prognosis after primary treatment for patients with high-grade serous ovarian cancer, the most common histological type of epithelial ovarian cancer.

Specifically, in high-grade serous ovarian cancer, the increase in HIF-1ß expression and decrease in VHL expression in tissues means intensification of hypoxia, which induces an increase in anticancer drug resistance, which can predict a decrease in survival rate and poor prognosis. .

That is, when high-grade serous ovarian cancer progresses, hypoxia intensifies, and as hypoxia intensifies, the expression of HIF-1ß increases and the expression of VHL decreases. Therefore, in high-grade serous ovarian cancer, the basal expression of HIF-1ß is low compared to that of normal ovarian tissue with sufficient oxygen delivery, and the basal expression of VHL is conversely high compared to that of normal ovarian tissue.

In addition, as hypoxia is intensified in human-derived immortalized ovarian cancer cell lines, anticancer drug resistance is increased in high-grade serous ovarian cancer. As a result, an increase in HIF-1ß expression and a decrease in VHL expression in high-grade serous ovarian cancer tissue lead to a decrease in survival rate, and a poor prognosis can be predicted.

The composition for predicting the prognosis of ovarian cancer according to an embodiment of the present invention includes an agent for measuring the expression level of mRNA or protein of HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau). .

As used herein, the term “diagnosis” refers to ascertaining the presence or characteristics of a pathophysiology. The diagnosis in one aspect is to confirm the presence and/or degree of ovarian cancer, that is, the progression state, and includes the prognosis after treatment or surgery, that is, the possibility of recurrence.

As used herein, the term "marker" is a substance capable of distinguishing and diagnosing a normal group individual from an individual with ovarian cancer, and is a polypeptide, protein or a protein that shows an increase or decrease in the individual having ovarian cancer of the present invention. It includes all organic biomolecules such as nucleic acids, genetic lipids, glycolipids, glycoproteins or sugars. In particular, in the present specification, it may be a protein or gene that is changed in a tissue isolated from an individual having ovarian cancer of the present invention.

The term "agent for measuring the expression level of mRNA or protein" as used herein refers to the detection of the marker and/or by checking the expression level of the mRNA or protein of HIF-1ß and VHL, which are markers that increase or decrease in ovarian cancer patients. It refers to a molecule that can be used for quantification. Specifically, the agent for measuring the expression level of the mRNA of the gene may be, for example, a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene. At this time, since the nucleic acid information of the genes is known in Genebank, etc., those skilled in the art can design primers or probes that specifically amplify specific regions of these genes based on the sequence.

The term "primer pair" as used herein includes all combinations of primer pairs consisting of forward and reverse primers recognizing a target gene sequence, and specifically, an analysis result having specificity and sensitivity. It is a primer pair provided. Since the nucleic acid sequence of the primer is a sequence that is inconsistent with the non-target sequence present in the sample, a primer that amplifies only the target gene sequence containing the complementary primer binding site and does not induce non-specific amplification can impart high specificity. .

For example, the primer sequence of HIF-1ß may be the following SEQ ID NO: 1 or 2, and the primer sequence of the VHL may be the following SEQ ID NO: 3 or 4.

SEQ ID NO: 1: 5'-AGGAACAGATGCAGGAATGG-3' (Forward)

SEQ ID NO: 2: 5'-GGCTGGTAGCCAACAGTAGC-3' (Reverse)

SEQ ID NO: 3: 5'-CCCAAATGTGCAGAAAGACC-3' (Forward)

SEQ ID NO: 4: 5'-AGGCAGACAAGTCACCAACC-3' (Reverse)

The term "probe" as used herein refers to a substance capable of specifically binding to a target substance to be detected in a sample, and refers to a substance capable of specifically confirming the presence of a target substance in a sample through the binding. do. The type of probe molecule is a material commonly used in the art and is not limited, but preferably may be a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a peptide, a polypeptide, a protein, RNA, or DNA. More specifically, the probe is a biomaterial that includes an organism-derived or similar thing or a thing produced in vitro, for example, enzymes, proteins, antibodies, microorganisms, animal and plant cells and organs, neurons, DNA and RNA. DNA includes cDNA, genomic DNA, and oligonucleotide, RNA includes genomic RNA, mRNA, and oligonucleotide, and examples of proteins may include antibodies, antigens, enzymes, peptides, and the like.

As used herein, the term "antisense oligonucleotide" is a DNA or RNA containing a nucleic acid sequence complementary to a specific mRNA sequence, or a derivative thereof, which binds to a complementary sequence in the mRNA and inhibits translation of the mRNA into a protein. It works. The antisense oligonucleotide sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the genes and is capable of binding to the mRNA. This can inhibit the translation of the gene mRNA, translocation into the cytoplasm, maturation or any other essential activity for overall biological function. The length of the antisense oligonucleotide may be 6 to 100 bases, preferably 8 to 60 bases, and more preferably 10 to 40 bases. The antisense oligonucleotide may be synthesized in vitro by a conventional method and administered in vivo, or the antisense oligonucleotide may be synthesized in vivo. One example of synthesizing antisense oligonucleotides in vitro is the use of RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow antisense RNA to be transcribed using a vector whose origin is in the opposite direction of the multicloning site (MCS). It is preferable that the antisense RNA has a translation stop codon in the sequence so that it is not translated into a peptide sequence.

In addition, the agent for measuring the protein expression level of the marker may be, for example, an antibody that specifically binds to a protein or protein fragment encoded by the marker gene, and the antibody is a polyclonal antibody or a monoclonal antibody. I can.

The term "antibody" as used herein may mean a specific protein molecule directed against an antigenic site.

For the purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein, and includes all of polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. Producing antibodies can be readily prepared using techniques well known in the art. In addition, the antibody of the present specification includes a complete form having two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules. A functional fragment of an antibody molecule refers to a fragment that has at least an antigen-binding function, and includes Fab, F(ab'), F(ab') 2 and Fv.

A kit for predicting the prognosis of ovarian cancer according to another embodiment of the present invention includes a composition for predicting the prognosis of ovarian cancer. Details of the composition are as described above. Specifically, the kit can diagnose ovarian cancer by measuring the protein expression levels of HIF-1ß and VHL, which are ovarian cancer diagnostic markers, and the mRNA of the gene or the expression level of the protein.

The kit may include an agent for measuring the expression level of the mRNA of the ovarian cancer diagnostic marker gene, for example, a primer pair, a probe or antisense nucleotide that specifically binds to the gene, and for measuring the expression level of the protein. It may include an agent, for example, an antibody that specifically binds to the marker protein or an immune-binding fragment of the antibody.

For example, the kit is a reverse transcription polymerase chain reaction (RT-PCR) kit, a DNA chip kit, an ELISA (Enzyme-linked immunosorbent assay) kit, a protein chip kit, a rapid kit, or a multiple reaction monitoring (MRM) kit. I can.

In addition, the kit may be configured to further include one or more other component compositions, solutions, or devices suitable for the analysis method. For example, the kit may be a diagnostic kit including essential elements necessary to perform a reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit includes each primer pair specific for a marker gene. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of each gene, and is about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length. In addition, a primer specific to the nucleic acid sequence of the control gene may be included. In addition, reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations may vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNAse. , RNAse inhibitor DEPC-water, sterile water, and the like.

In addition, for example, the DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, agents, enzymes, etc. for producing a fluorescently labeled probe. In addition, the substrate may include a cDNA or oligonucleotide corresponding to a control gene or a fragment thereof. In addition, for example, the kit may be a diagnostic kit including essential elements necessary for performing LISA.

The ELISA kit contains an antibody specific for the protein. Antibodies are antibodies that have high specificity and affinity for each marker protein and have little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the ELISA kit may contain an antibody specific for a control protein. Other ELISA kits include reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes (e.g., conjugated with antibodies) and their substrates or antibodies capable of binding. Other materials may be included.

In addition, for example, the kit may be a rapid kit including essential elements necessary to perform a rapid test in which an analysis result can be known. The rapid kit contains antibodies specific for the protein. Antibodies are antibodies that have high specificity and affinity for each marker protein and have little cross-reactivity with other proteins, and are monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the rapid kit may include an antibody specific for a control protein. Other rapid kits include reagents that can detect bound antibodies, for example, nitrocellulose membranes in which specific antibodies and secondary antibodies are immobilized, membranes bound to beads bound to antibodies, absorption pads and sample pads, etc. It may contain substances and the like.

In addition, for example, the kit may be a multiple reaction monitoring (MRM) kit, which is an MS/MS mode including essential elements required to perform mass spectrometry. While SIM (Selected Ion Monitoring) is a method of using ions generated by colliding once at the source part of a mass spectrometer, MRM is a method of selecting a specific ion from the once broken ions and selecting the source of another MS that is connected in succession. This is a method of using the ions obtained from among them after passing through one more time to collide. Through the MRM (Multiple reaction monitoring) analysis methods, it is possible to compare the protein expression level of a normal control or the same individual with the protein expression level of an individual with ovarian cancer, and also, a significant protein from the ovarian cancer marker gene By determining whether the expression level is increased or decreased, the onset of ovarian cancer can be diagnosed.

The method of providing information for predicting the prognosis of ovarian cancer according to another embodiment of the present invention is that in a biological sample isolated from an individual, HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau) measuring the expression level of the mRNA or protein, and comparing the measured expression level with the expression level of a control.

The information providing method includes measuring the expression level of HIF-1ß and VHL mRNA or protein in a biological sample isolated from an individual. Specifically, the expression level of the mRNA or protein can be determined by measuring the mRNA expression level of the marker gene or the expression level of the protein encoded by the gene.

Isolation of mRNA or protein from a sample of an individual can be appropriately performed by a person skilled in the art according to methods known in the art. For example, an individual's ovarian cancer tissue may be homogenized with a protein extraction buffer or a nucleic acid extraction buffer, and then centrifuged, and the obtained supernatant may be used as a sample of the individual.

The individual means a subject for diagnosing ovarian cancer or predicting the prognosis after ovarian cancer treatment, that is, recurrence. The individual may include a vertebrate, a mammal, or a human (Homo sapiens). In addition, the biological sample may be tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The measurement of the mRNA expression level can be, for example, reverse transcriptase polymerization (RT-PCR), competitive reverse transcriptase polymerase reaction (competitive RT-PCR), real time reverse transcriptase polymerase reaction (real time quantitative RT-PCR), Quantitative polymerase reaction (quantitative RTPCR), RNase protection method (RNase protection method), Northern blotting (Nothern blotting) or DNA chip method (DNA chip technology) can be used.

In addition, the measurement of the protein expression level is, for example, Western blotting, immunohistochemical staining, immunoprecipitation assay, complement fixation assay (complenent Fixation Assay) or immunofluorescence method. (immunofluorescence) can be used.

The information providing method includes the step of comparing the measured expression level with the expression level of a normal control group.

Specifically, by measuring the expression level of the mRNA or protein of a marker gene in a sample of an ovarian cancer patient, and measuring and comparing the expression level of the mRNA or protein of the same marker gene of the normal control, the mRNA or protein of the marker gene in the patient sample According to the degree of further increasing or decreasing of the expression level of ovarian cancer and its degree, the presence of ovarian cancer and its degree can be measured, and if the ovarian cancer patient is a patient after treatment or surgery, the recurrence can be predicted.

Hereinafter, in high-grade serous ovarian cancer, the expression of HIF-1ß increases and the expression of VHL decreases with the intensification of hypoxia due to tumor progression, and the change in expression of HIF-1ß and VHL is a prognostic factor. , It was confirmed through phased efficacy evaluation of tissue and clinical.

(1) Low basal expression of HIF-1ß and high basal expression of VHL in high grade serous ovarian cancer using fresh frozen tissue

After obtaining 5 freshly frozen tissues of normal ovary and high-grade serous ovarian cancer, RNA was extracted from each tissue and cDNA (complementary DNA) was synthesized. Since then, 6 hypoxia genes known to be related to cancer formation and cancer progression, cAMP-response element-binding protein-binding protein (CBP), adenovirus early region 1A-binding protein P300 (P300), factor-inhibiting hypoxia (FIH). -inducible factor), VHL (von Hippel-Lindau), HIF-1α, HIF-1ß targeting forward (forward) and reverse (reverse) primers were prepared as shown in Table 1 below.

Gene Strand 5'→3' RT size qRT size CBP Forward AGGACCTGACGTACCTGTGC 363 114 Reverse AATGACTCTGGGTCCTGTCG P300 Forward ATATGCCACCATGGAGAAGC 481 147 Reverse ATGGACCAGAGACTGGATGC FIH Forward CCCATACCCTGTTCATCACC 469 121 Reverse GTGCAGCGTGCAATACTAGC VHL Forward CCCAAATGTGCAGAAAGACC 486 109 Reverse AGGCAGACAAGTCACCAACC HIF-1α Forward TCAGCTATTTGCGTGTGAGG 475 178 Reverse AGCACCAAGCAGGTCATAGG HIF-1ß Forward AGGAACAGATGCAGGAATGG 308 177 Reverse GGCTGGTAGCCAACAGTAGC

RT-PCR (quantitative reverse transcription polymerase chain reaction) was performed using primers of hypoxia-related genes to compare and evaluate the basal expression of mRNA in freshly frozen tissues of normal ovary and high-grade serous ovarian cancer, and the results are shown in FIG. Indicated.

As a result, as shown in FIG. 1, HIF-1ß significantly decreased mRNA expression compared to normal ovarian tissue, and VHL significantly increased mRNA expression compared to normal ovarian tissue.

(2) Increased resistance to anticancer drugs in high-grade serous ovarian cancer due to intensifying hypoxia

_{The IC 50} (inhibitory concentration 50) of cisplatin, a representative anticancer drug, was measured using OV90, a high-grade serous ovarian cancer cell line, and it was confirmed that it was 50 umol/L. In addition, the culture conditions of OV90 _{were divided in stages into normal and hypoxia (O 2} 5%, 3%, 1%) to compare and evaluate the cell viability at the _{IC 50 concentration of cisplatin, and the results are shown in FIG.}

As a result, it was confirmed that the survival rate of OV90 cells decreased rapidly after cisplatin administration under normal conditions, but the survival rate of OV90 cells increased as hypoxia increased, and as a result of the intensification of hypoxia, anticancer drug resistance was obtained.

(3) Increased expression of HIF-1ß and decreased VHL expression in high-grade serous ovarian cancer following intensification of hypoxia

After cisplatin was administered in steps of normal and hypoxia (O ₂ 5 %, 3 %, 1 %), RNA was extracted from the OV90 cell line, cDNA was synthesized, and quantitative RT-PCR was performed. The mRNA expression of related genes was compared and evaluated, and the results are shown in FIG. 3. In FIG. 3, (A) is for CBP, (B) is for P300, (C) is for HIF-1α, (D) is for HIF-1ß, (E) is for FIH, and (B) is for VHL.

As a result, it was confirmed that CBP, P300, FIH, and VHL decreased, and the expression of HIF-1α and HIF-1ß increased as hypoxia increased.

In addition, the results of performing Western blot are shown in FIG. 4. As a result, it was confirmed that HIF-1ß protein expression increased and VHL protein expression decreased in OV90 cell line as hypoxia increased after cisplatin administration.

In addition, it was evaluated whether an increase in active oxygen known to be related to anticancer drug resistance can confirm similar results in hypoxia induction by the application of NAC, an active oxygen inhibitor, and the results are shown in FIG. 6.

Prior to that, as shown in FIG. 5, it was confirmed using a proliferation assay that the concentration of NAC that does not affect the proliferation of OV90, a high-grade serous ovarian cancer cell, is 1 mM to 10 mM.

Thereafter, it was confirmed that active oxygen gradually decreased as the concentration of NAC gradually increased using a DCF (2',7'-dichlorodihydrofluorescein diacetate) fluorescent dye. In addition, when NAC and cisplatin were treated at the same time, a significant decrease in active oxygen was not observed, and thus the reduction of free radicals due to intensification of hypoxia was inhibited by cisplatin, which could induce anticancer drug resistance.

In addition, the results of performing Western blot are shown in FIG. 7. As a result, it was confirmed that when cisplatin was administered while increasing the concentration of NAC for the reduction of active oxygen, the protein expression of HIF-1ß in the OV90 cell line increased and the protein expression of VHL decreased with the increase of NAC. The same results were confirmed with the deepening of hypoxia.

(4) Increased HIF-1ß expression in high grade serous ovarian cancer tissue and decreased survival rate due to decreased VHL expression

In 149 patients with high grade serous ovarian cancer, the expression of clinical pathological factors and hypoxia-related genes in tissues was evaluated, and the results are shown in Table 2.

Specifically, immunochemical biopsy was performed on tissues of patients with high-grade serous ovarian cancer, and staining intensity (intensity; 1, weak; 2, medium; 3, strong) and staining distribution (percentage; 1, <25) %; 2, 25% to 50%; 3, 51% to 75%; 4, >75%) If the score by multiplication is 6 or more, it is defined as high-expression, and if it is less than 6, it is defined as high-expression ( low-expression).

Clinical pathological factors High grade serous ovarian cancer (n=149, %) P300 41 (27.5) Low expression 108 (72.5) Age (mean, range) 54 (28, 80) High expression FIGO weapon HIF-1α 1st 5 (3.4) Low expression 61 (40.9) 2nd 6 (4) High expression 88 (59.1) Stage 3 112 (75.1) HIF-1 ß 4th 26 (17.5) Low expression 88 (59.1) Optimal tumor reduction surgery
(Residual tumor size ≤1 cm) High expression 61 (40.9) FIH success 82 (55) Low expression 40 (26.8) failure 67 (45) High expression 109 (73.2) CBP VHL Low expression 37 (24.8) Low expression 128 (85.9) High expression 112 (75.2) High expression 21 (14.1)

In addition, in patients with high grade serous ovarian cancer, the difference in progression-free survival rate according to the expression level of hypoxia gene was compared and analyzed, and the results are shown in FIG. 8. In FIG. 8, (A) is for CBP, (B) is for P300, (C) is for HIF-1α, (D) is for HIF-1ß, (E) is for FIH, and (B) is for VHL.

Referring to FIG. 8, when HIF-1 ß shows low expression, when VHL shows high expression, progression-free survival rate is improved.

In addition, a multivariate Cox analysis was performed to find prognostic factors that influence the progression-free survival rate of patients with high-grade serous ovarian cancer, and the results are shown in Table 3.

Clinical pathological factors Adjusted HR 95% Confidence interval P value FIGO Weapons I-II 0.273 0.085-0.878 0.029 Optimal tumor reduction surgery 0.593 0.397-0.884 0.010 HIF-1ß low expression 0.657 0.443-0.975 0.037 VHL high expression 0.381 0.165-0.878 0.023

Referring to Table 3, when HIF-1 ß is underexpressed, the hazard ratio (HR) = 0.657 reduces the risk of 34.3%, and when VHL is highly expressed, the risk of HR = 0.381 decreases by 62.9%. Confirmed.

therefore, HIF-1ß and VHL, prognostic factors for high-grade serous ovarian cancer, which are the most common histological types of epithelial ovarian cancer, can be used as biomarkers to predict prognosis, and clinically, HIF- for high-grade serous ovarian cancer. It is possible to predict the prognosis by confirming the tissue expression of 1ß and VHL, and to establish a treatment plan and consult (counseling) for this.

Although the preferred embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and improvements by those skilled in the art using the basic concept of the present invention defined in the following claims are also present. It belongs to the scope of rights of

Claims (9)

HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau) a composition for predicting the prognosis of ovarian cancer, comprising an agent for measuring the expression level of mRNA or protein. The method of claim 1,
The ovarian cancer is a high-grade serous (high-grade serous cystadenocarcinoma) ovarian cancer, a composition for predicting the prognosis of ovarian cancer. The method of claim 1,
As the ovarian cancer progresses, the expression of HIF-1ß increases, and the expression of VHL decreases. The composition for predicting the prognosis of ovarian cancer. The method of claim 1,
The agent for measuring the expression level of the mRNA is a primer pair, a probe or antisense nucleotide that specifically binds to the mRNA, a composition for predicting the prognosis of ovarian cancer. The method of claim 4,
The primer sequence of the HIF-1ß is the following SEQ ID NO: 1 or 2 is a composition for predicting the prognosis of ovarian cancer.
SEQ ID NO: 1: 5'-AGGAACAGATGCAGGAATGG-3' (Forward)
SEQ ID NO: 2: 5'-GGCTGGTAGCCAACAGTAGC-3' (Reverse) The method of claim 4,
The primer sequence of the VHL is the following SEQ ID NO: 3 or 4 is a composition for predicting the prognosis of ovarian cancer.
SEQ ID NO: 3: 5'-CCCAAATGTGCAGAAAGACC-3' (Forward)
SEQ ID NO: 4: 5'-AGGCAGACAAGTCACCAACC-3' (Reverse) The method of claim 1,
The agent for measuring the expression level of the protein is an antibody that specifically binds to the protein or protein fragment, a composition for predicting the prognosis of ovarian cancer. A kit for predicting the prognosis of ovarian cancer, comprising the composition according to any one of claims 1 to 7. In a biological sample isolated from the individual, measuring the expression level of the mRNA or protein of HIF-1ß (Hypoxia-inducible factor-1 beta) and VHL (von Hippel-Lindau), and
Comparing the measured expression level with the expression level of the control
Information providing method for predicting the prognosis of ovarian cancer comprising a.

Images