KR20210035126A - Composition for increasing expression level of growth factor genes containing core-shell structured microparticles as effective component - Google Patents

Abstract

The present invention relates to a composition for increasing the expression of growth factor genes containing core-shell structured microparticles as effective components. The composition for increasing the expression of growth factor genes of the present invention can increase, when administered in vivo with genes, an expression amount of the genes by 30% or more. Specifically, when the composition is administered together with a hepatocyte growth factor (HGF) gene suitable to the present invention, at least one gene selected from an isoform gene of HGH and a variant gene thereof or an insulin like growth factor-1 (IGF-1) gene, and at least one gene selected from an isoform gene of the IGE-1 and a variant gene thereof, the expression amount of the gene can be increased at least by 30%. The composition, when administered together with a gene therapeutic agent, can be useful to acquire treatment effects even with a relatively small amount of genes.

Description

Composition for increasing expression level of growth factor genes containing core-shell structured microparticles as effective component}

The present invention relates to a composition for increasing the expression of a growth factor gene comprising microparticles having a core-shell structure as an active ingredient.

Human Hepatocyte Growth Factor (HGF) is secreted from cells of mesoderm origin and acts on various cells and performs various functions depending on the target cell and environment (Stella, MC and Comoglio, PM, The International Journal of Biochemistry. & Cell Biology, 31: 1357-1362 (1999)). To summarize the functions, first, it promotes cell division of epithelial cells, promotes cell motility, and enhances matrix penetration. These functions in turn lead to the formation of tubular structures of epithelial cells. Second, it promotes angiogenesis by endothelial cells both in vitro and in vivo. Third, as it has anti-apoptosis activity, it is associated with regeneration of liver and kidney. Fourth, it is involved in organ formation in the kidney, ovary, and testis in the development process. Fifth, by regulating the function of osteoclasts and osteoblasts, the process of bone formation is regulated. Sixth, it promotes the growth and differentiation of erythropoietic progenitor cells. Seventh, it is involved in the axon sprouting of the nerve. Based on these various functions, hepatocyte growth factor can be developed as a therapeutic agent for various diseases, such as ischemic disease, neurological disease, kidney disease, and liver disease.

In addition, human type 1 insulin-like growth factor-1 (IGF1) is a polypeptide hormone consisting of 70 amino acids having insulin-like activity and mitogenic biological growth activity. These hormones enhance cell growth in various tissues such as the musculoskeletal system, liver, kidney, intestine, nervous system tissue, heart and lung.

As is well known to those of skill in the art, the known potential uses of IGF1 are diverse and numerous. For example, many studies have been reported on the use of IGF1 as a potential therapeutic agent for treating neurodegenerative symptoms. For example, Kanje et al ., Brain Res., 486:396-398 (1989); Hantai et al ., J. Neurol. Sci., 129:122-126 (1995); Contreras et al., Pharmac. Exp. Therap., 274:1443-1499 (1995); Di Giulio et al. , Society for Neuroscience, 22:1960 (1996); Di Giulio et al ., Society for Neuroscience, 23:894 (1997); Hsu et al ., Biochem. Mol. Med., 60(2):142-148(1997); See Gorio et al ., Neuroscience, 82:1029-1037 (1998). IGF1 therapy is prescribed for a number of neurological conditions, including ALS, stroke, epilepsy, Parkinson's disease, Alzheimer's disease, acute traumatic injuries and other disorders related to trauma, aging, disease or injury. For example, US Patent Nos. 5,093,137, 5,652,214 and 5,703,045; See International Publication Nos. 1990-001483 and 1993-002695.

The use of IGF1 therapy for a variety of other conditions is mentioned in a number of publications. For example, Schalch et al., "Short-term metabolic effects of recombinant human insulin-like growth factor I (rhIGF-I) in type II diabetes mellitus". Modern Concepts of Insulin-Like Growth Factors, Spencer, ed., New York: Elsevier Science Publ. Co. pp. 705-714 (1991); Clemmons and Underwood, J. Clin. Endocrinol. Metab., 79(1):4-6(1994); And Langford et al ., Eur. J. Clin. Invest., 23(9):503-516(1993) (for example insulin-resistant conditions and diabetes are mentioned); O'shea et al ., Am. See J. Physiol., 264:F917-F922 (1993) (for example, decreased renal function is mentioned). In addition, U.S. Patent No. 7,258,864 (for example, a low height is mentioned); U.S. Patent Nos. 5,110,604 and 5,427,778 (for example wound healing is mentioned); U.S. Patent No. 5,126,324 (for example, heart disorders and growth retardation are mentioned); US Patent No. 5,368,858 (for example, cartilage defects or injuries are mentioned); US Patent Nos. 5,543,441 and 5,550,188 (referred to as tissue augmentation for example); U.S. Patent No. 5,686,425 (for example, scar tissue, local muscle insufficiency and urinary incontinence are mentioned); And U.S. Patent No. 5,656,598 (for example, bone growth is mentioned). In addition, International Publication No. 1991-012018 (for example, intestinal disorders are mentioned); International Publication No. 1992-009301 and International Publication No. 1992-014480 (for example, wound healing is mentioned); International Publication No. 1993-008828 (for example, ischemia, hypoxia or nerve damage associated with neurodegeneration is mentioned); International Publication No. 1994-016722 (for example, insulin resistance is mentioned); International Publication No. 1996-002565 (for example, IGF/IGFBP complex for promoting bone formation and regulating bone remodeling is mentioned); US Patent Publication No. 2003-0100505 (for example, osteoporosis is mentioned); And US Patent Publication No. 2005-0043240 (for example, obesity is mentioned).

The inventors of the present invention were researching to develop gene therapy products that can obtain therapeutic effects even with a small amount of genes, and the core is a halogenated hydrocarbon and/or halogenated sulfur, and the outer shell has a core-shell structure consisting of a lipid component. The present invention was completed by confirming in detail that when microparticles were administered in vivo together with genes such as HGF or IGF1, the expression level of the growth factor gene was significantly increased.

Korean Patent Registration No. 10-0562824

The first problem to be solved by the present invention is to provide a composition for increasing growth factor gene expression comprising microparticles having a core-shell structure as an active ingredient.

A second problem to be solved by the present invention is to provide a pharmaceutical composition for the prevention or treatment of ischemic diseases, neurological diseases, kidney diseases, or liver diseases comprising the composition.

A third problem to be solved by the present invention is to provide a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by IGF1 receptor binding, including the composition.

In order to achieve the above object, the present invention is a composition for increasing growth factor gene expression comprising microparticles of a core-shell structure as an active ingredient,

The core is a biocompatible gas, a halogenated hydrocarbon, a sulfur halide, or a mixture thereof, and the shell is composed of a lipid or a derivative thereof,

The growth factor gene may include at least one gene selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof; Or at least one gene selected from the human type 1 insulin-like growth factor-1 (IGF1) gene, the heterologous gene of the human type 1 insulin-like growth factor, and a mutant gene thereof; It provides a composition for increasing gene expression.

In one embodiment of the present invention, the biocompatible gas is sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, Chlorotrifluoromethane, chloropentafluoroethane, dichlorotetrafluoroethane and mixtures thereof.

In one embodiment of the present invention, the halogenated hydrocarbon may be a perfluorinated hydrocarbon.

In one embodiment of the present invention, the perfluorinated hydrocarbon is perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, Perfluoropropene, perfluorobutene, perfluorobutadiene, perfluorobut-2-yne, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclo Butane, perfluorocyclopentane, perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or mixtures thereof.

In one embodiment of the present invention, the lipid may be at least one selected from the group consisting of simple lipids, phospholipids, glycero glycolipids, sphingo glycolipids, cholesterol and cationic lipids.

In one embodiment of the present invention, the phospholipids are phosphatidylcholine derivatives, phosphatidylethanolamine derivatives, phosphatidylserine derivatives, diacetylated phospholipids, L-α-dioleyl phosphatidylethanolamine, diolane, phosphatidic acid, phosphatidyl glycerol, It may be selected from the group consisting of phosphatidylinositol, lysophosphatidylcholine, sphingomyelin, polyethylene glycolated phospholipids, egg yolk lecithin, soybean lecithin, and hydrogenated phospholipids.

In an embodiment of the present invention, the glycerol glycolipid is a group consisting of sulfoxy ribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride, and glycosyl diglyceride. It may be selected from.

In one embodiment of the present invention, the sphingo glycolipid may be galactosyl cerebroside, lactosyl cerebroside, or ganglioside.

In one embodiment of the present invention, the cationic lipid is 1,2-dioleoyl-3-trimethylammonio propane (DOTAP), N-(2,3-dioleyyloxy propan-1-yl)-N, N,N-trimethyl ammonium chloride (DOTMA), 2,3-dioleyyloxy-N-[2-(sperminecarboxyamide) ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetic acid ( DOSPA), 1,2-dimyristyloxy propyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE), 1,2-dioleoyloxy propyl-3-diethyl hydroxyethyl ammonium bromide (DORIE) and 3β- It may be one selected from the group consisting of [N-(N'N'-dimethylaminoethyl) carbamoyl] cholesterol (DC-Chol).

In an embodiment of the present invention, the mutant gene of the human hepatocyte growth factor may be made of any one selected from the nucleotide sequences of SEQ ID NOs: 3 to 6.

In one embodiment of the present invention, the composition may increase the expression level of the growth factor gene by 30% or more.

In addition, the present invention is the composition; And at least one gene selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof; including ischemic disease, neurological disease, kidney disease, or liver disease prevention Or it provides a pharmaceutical composition for treatment.

In the pharmaceutical composition for preventing or treating ischemic disease, neurological disease, kidney disease or liver disease, the human hepatocyte growth factor gene is composed of the nucleotide sequence of SEQ ID NO: 2, the mutant gene of the human hepatocyte growth factor is SEQ ID NO: 3 It may be made of any one selected from the base sequence of 6 to.

In addition, the present invention is the composition; And one or more genes selected from the human type 1 insulin-like growth factor-1 (IGF1) gene, the heterologous gene of the human type 1 insulin-like growth factor, and the mutant gene thereof. It provides a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by.

In the pharmaceutical composition for preventing or treating symptoms or diseases mediated by the binding of the IGF1 receptor, the human type 1 insulin-like growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 7.

In one embodiment of the present invention, the symptoms or diseases are short stature, obesity, weight loss, cachexia, anorexia, neurodegenerative disorders, fibrosis-related symptoms, cartilage disorders, bone diseases, inflammatory disorders, intestinal disorders, insulin resistance , Diabetes, diabetic ketoacidosis, Robson-Mendenhall syndrome, retinopathy, acromegaly, fibromuscular hyperplasia, and heart disorders.

In one embodiment of the present invention, the individual requiring treatment for short stature is a human pediatric individual with insulin-like growth factor-1 deficiency (IGFD), and the composition is effective for the treatment of IGFD in a human pediatric individual. I can.

The composition for increasing the expression of a growth factor gene of the present invention can increase the expression level of a growth factor gene by at least 30% or more when administered to a living body together with a gene (eg, a polynucleotide encoding a gene or a vector containing the same). have.

In particular, the composition comprises at least one gene selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof suitable for the present invention; Or at least one gene selected from a human type 1 insulin-like growth factor-1 (IGF1) gene, a heterologous gene of a human type 1 insulin-like growth factor, and a mutant gene thereof; when administered together, the above It is possible to increase the expression level of the growth factor gene by at least 30% or more.

When the composition is administered together with a gene therapy, it is useful because it can obtain a therapeutic effect even with a small amount of gene.

1 shows a cleavage map of a pGP vector according to an embodiment of the present invention.
Figure 2 shows HGF protein expression according to administration of pGP-HGF (gene only), a pharmaceutical composition (HGF-JetPEI) and a pharmaceutical composition according to Example 1 (HGF-MP1, HGF-MP2 and HGF-MP3) in mice It is a graph which compares and shows the amount.
3 is a comparison of HGF protein expression levels according to administration of pGP-HGFX7 (gene only), a control pharmaceutical composition (HGFX7-JetPEI) and a pharmaceutical composition according to Example 2 (HGFX7-MP1 and HGFX7-MP2) in mice. It is a graph showing.
FIG. 4 is an IGF1 protein expression according to administration of pGP-IGF1 (gene only), a pharmaceutical composition (IGF1-JetPEI) and a pharmaceutical composition according to Example 3 (IGF1-MP1, IGF1-MP2 and IGF1-MP3) in mice. It is a graph which compares and shows the amount.
5 is a comparison of the VEGF protein expression levels according to administration of pGP-VEGF (gene only), a pharmaceutical composition (VEGF-JetPEI) and a pharmaceutical composition according to Comparative Example 1 (VEGF-MP1 and VEGF-MP2) in mice. It is a graph showing.
6 is a graph showing the comparison of the FGF1 protein expression levels according to administration of pGP-FGF1 (gene only) and pharmaceutical compositions (FGF1-MP1 and FGF1-MP2) according to Comparative Example 2 in mice.
7 is a graph showing the comparison of the FGF4 protein expression levels according to administration of pGP-FGF4 (gene only) and pharmaceutical compositions (FGF4-MP1 and FGF4-MP2) according to Comparative Example 3 in mice.
8 is a graph showing a comparison of the expression levels of PDGF-B proteins according to administration of pGP-PDGF-B (gene only) and pharmaceutical compositions (PDGF-B-MP1 and PDGF-B-MP2) according to Comparative Example 4 in mice to be.
FIG. 9 is a graph showing a marked increase in PWT values after 2 weeks of administration of the composition of Example 2 (HGFX7-MP2) of the present invention to a rat peripheral neuropathy model induced by diabetes.
FIG. 10 is a graph showing a marked increase in PWT values 2 weeks after administration of the composition of Example 1 (HGF-MP2) in a rat neuropathy model induced by chronic constriction injury surgery.

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention is a composition for increasing growth factor gene expression comprising microparticles of a core-shell structure as an active ingredient,

The core is a biocompatible gas, a halogenated hydrocarbon, a sulfur halide, or a mixture thereof,

The shell is composed of a lipid or a derivative thereof,

The growth factor gene may include at least one gene selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof; Or at least one gene selected from the human type 1 insulin-like growth factor-1 (IGF1) gene, the heterologous gene of the human type 1 insulin-like growth factor, and a mutant gene thereof; It provides a composition for increasing gene expression.

core

In the specification of the present invention, the "core" may be formed of a halogenated hydrocarbon, a halogenated sulfur, or a mixture thereof as a biocompatible gas.

The biocompatible gas is sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoro. Loethane, dichlorotetrafluoroethane, or mixtures thereof.

The halogenated hydrocarbon is preferably a perfluorinated hydrocarbon.

As the perfluorinated hydrocarbon, perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, purple Luorobutene, perfluorobutadiene, perfluorobut-2-yne, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane , Perfluoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, or mixtures thereof.

As the biocompatible gas of the present invention, sulfur hexafluoride or perfluorobutane is preferable.

Shell

In the specification of the present invention, the "shell" may be composed of a component including a lipid or a derivative thereof.

The lipid may be one or more selected from the group consisting of simple lipids, phospholipids, glycero glycolipids, sphingo glycolipids, cholesterol, and cationic lipids, particularly preferably phospholipids.

As the phospholipids, phosphatidylcholine derivatives, phosphatidylethanolamine derivatives, phosphatidylserine derivatives, diacetylated phospholipids, L-α-dioleyl phosphatidylethanolamine, diolane, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, su Phingomyelin, polyethylene glycolated phospholipids, egg yolk lecithin, soybean lecithin, hydrogenated phospholipids, and the like.

Examples of the glycero glycolipid include sulfoxy ribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride, and glycosyl diglyceride.

Examples of the sphingo glycolipid include galactosyl cerebroside, lactosyl cerebroside, and ganglioside.

In addition, as the cationic lipid, 1,2-dioleoyl-3-trimethylammonio propane (DOTAP), N-(2,3-dioleyyloxy propan-1-yl)-N,N,N-trimethyl Ammonium chloride (DOTMA), 2,3-dioleyyloxy-N-[2-(sperminecarboxyamide) ethyl]-N,N-dimethyl-1-propanaminiumtrifluoroacetic acid (DOSPA), 1, 2-dimyristyloxy propyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE), 1,2-dioleoyloxy propyl-3-diethyl hydroxyethyl ammonium bromide (DORIE), 3β-[N-(N 'N'-dimethylaminoethyl) carbamoyl] cholesterol (DC-Chol), and the like.

Micro particles

The microparticles of the present invention are stabilized by the shell surrounding the gas, which is the core, to retard the diffusion of the gas into the surrounding liquid and prevent fusion between the microparticles.

When the microparticles are introduced into a living body, they maintain their shape until they reach the target cells or tissues, and are destroyed near the target cells or tissues, thereby injecting gas. At this time, the injected gas causes a change in the cell membrane of the target cell, and may play a role of facilitating the entry of the growth factor gene into the cytoplasmic environment of the target cell by the injection force of the gas.

It is preferable that the microparticles have an average diameter of 1 to 10 µm, preferably 2 to 8 µm, and more preferably 2 to 4 µm.

Composition for increasing gene expression

Recently, various studies have been made in relation to core-shell microparticles having a gas as a core. In previous studies, the effect of increasing gene expression did not appear unless ultrasonic waves were irradiated with microparticles.

Specifically, Sang-Chol Lee et al ., Korean Circulation J 2006;36:32-38; In "Study on Enhancement of Gene Delivery to Muscle Tissues by Destruction of Microbubbles Using Low-Frequency Ultrasound", it is disclosed that the effect of increasing gene expression does not appear when only the luciferase gene-microparticle mixture is injected without ultrasonic irradiation.

ZP Shen et al. , Gene Therapy (2008) 15, 1147-1155; "Ultrasound with microbubbles enhances gene expression of plasmid DNA in the liver via intraportal delivery" discloses that injecting only the luciferase gene-microparticle mixture without ultrasound irradiation does not show the effect of increasing gene expression.

In addition, Xingsheng Li et al. , J Ultrasound Med 2008; 27:453-460; "Experimental Research on Therapeutic Angiogenesis Induced by Hepatocyte Growth Factor Directed by Ultrasound-Targeted Microbubble Destruction in Rats" discloses that the effect of increasing gene expression does not appear when the HGF gene-liposome microparticle mixture is injected without ultrasound irradiation.

However, the inventors of the present invention confirmed that when the microparticles according to the present invention were injected together with HGF or IGF1 gene while studying the use of microparticles, the present invention confirmed that the expression level of the gene significantly increased even without irradiation of ultrasound. Was completed. On the other hand, as specifically shown in the following experimental examples, in other genes of the growth factor family other than HGF and IGF1, the effect of increasing the amount of gene expression due to the microparticles was not observed.

The composition for increasing the expression of a growth factor gene according to the present invention can increase the expression level of a growth factor gene by at least 30% or more when administered to a living body together with the gene.

In particular, one or more genes selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof suitable for the present invention, or a human type 1 insulin-like growth factor (Insulin like When administered together with at least one gene selected from Growth Factor-1; IGF1) gene, a heterologous gene of human type 1 insulin-like growth factor, and a mutant gene thereof, the expression level of the gene is at least 30% or more, preferably May increase by 40% or more, more preferably 50% or more, and most preferably 100% or more.

In the following examples, it was confirmed that the composition for increasing gene expression of the present invention significantly increased the expression level of the HGF, HGFX7 or IGF1 gene when administered to a mouse together with the HGF, HGFX7 or IGF1 gene. More specifically, it was confirmed that the expression levels of HGF increased by 45% or more, HGFX7 by 120% or more, and IGF1 by 35% or more. On the other hand, in the case of VEGF, FGF1, FGF4 or PDGF-B, it was confirmed that the gene expression increase rate did not increase significantly even when administered to mice with the composition for increasing gene expression of the present invention. Specifically, the expression level of VEGF increased by up to 16%, FGF4 by up to 14%, and PDGF-B by up to 4%. In the case of FGF1, the expression level decreased by more than 40%.

That is, the composition for increasing gene expression of the present invention includes one or more genes selected from human hepatocyte growth factor (HGF), a variant thereof, and a variant thereof, among growth factor genes; Or human type 1 insulin-like growth factor (IGF1), at least one gene selected from a variant thereof and a variant thereof; it is judged to have the effect of specifically increasing the expression level of the gene only when administered together.

The composition may additionally contain pharmaceutical adjuvants such as stabilizers, buffers, salts for controlling osmotic pressure, excipients, preservatives, or other therapeutically useful substances, and may be formulated in various oral or parenteral forms according to conventional methods. However, it is preferably in a parenteral form. Representative formulations for parenteral administration are injection formulations, preferably isotonic aqueous solutions or suspensions. Alternatively, the composition may be powdered and suspended with a solvent immediately before administration.

In the composition for increasing gene expression of the present invention, the content of the microparticles is not particularly limited, but may be contained in an amount of 0.5 to 2,000 µl/ml, preferably 1 to 1,000 µl/ml. Alternatively, it may be contained in an amount of 5 to 2,000 μg/ml, preferably 10 to 1,000 μg/ml.

When the content of the microparticles is out of the above range, the expected effect cannot be obtained.

In addition, the composition is preferably administered in the form of a mixture mixed with the gene from the viewpoint of effect.

gene

When the composition for increasing gene expression according to the present invention is administered together with the following genes, it is possible to further increase the expression efficiency of the gene and thus the effect.

Human hepatocyte growth factor (HGF) gene

The human hepatocyte growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 2. The human hepatocyte growth factor gene may be developed in the form of gene therapy or protein therapy.

Isoform of human hepatocyte growth factor

In the present specification, the "isoform of human hepatocyte growth factor" refers to an amino acid sequence that is at least 80% identical to the HGF amino acid sequence naturally occurring in animals, including all allelic variants. It means having HGF polypeptide. For example, the HGF isoform is meant to encompass all of the normal form or wild type of HGF, and various variants of HGF (eg, splicing variants and deletion variants).

Variant of human hepatocyte growth factor

In the present specification, the "variant of human hepatocyte growth factor" may be a hybrid HGF gene capable of expressing both isoforms of HGF (HGF and dHGF) (refer to Korean Patent No. 10-0562824). Specifically, the "hybrid HGF gene" is a human HGF gene intron 4 or its fragment sequence is inserted between exon 4 and exon 5 of HGF cDNA, the gene expression efficiency is high, and two of HGF and dHGF (deleted varient of HGF) It refers to a hybrid HGF gene (SEQ ID NOs: 3 to 5) that simultaneously expresses eggplant isoforms.

According to the gene therapy strategy of the present invention, it is preferable in terms of therapeutic effect to use one or more nucleotide sequences encoding two or more types of isoforms of HGF. Two or more types of HGF isoform-encoding nucleotide sequences may be provided as one polynucleotide or may be provided as separate polynucleotides.

In addition, in the present specification, the "variant of human hepatocyte growth factor" may be HGFX6 (SEQ ID NO: 3) (refer to Korean Patent Registration No. 10-0562824).

In addition, in the present specification, the "variant of human hepatocyte growth factor" may be HGFX7 (SEQ ID NO: 4) (refer to Korean Patent Registration No. 10-0562824).

In addition, in the present specification, the "variant of human hepatocyte growth factor" may be HGFX8 (SEQ ID NO: 5) (refer to Korean Patent Registration No. 10-0562824).

In addition, in the present specification, "a variant of human hepatocyte growth factor" may be a deleted variant of HGF (dHGF) (SEQ ID NO: 6) (refer to Korean Patent Registration No. 10-0562824). As used herein, the term "dHGF" is a defective variant of the HGF protein produced by selective splicing of the HGF gene in an animal, preferably a mammal, more preferably an alpha from the full-length HGF sequence (728 amino acids). It refers to human HGF consisting of 723 amino acids with a deletion of 5 amino acids (F, L, P, S and S) in the first Kringle domain of the chain.

Human type 1 insulin-like growth factor (IGF1) gene

The human insulin-like growth factor gene, particularly the human type 1 insulin-like growth factor (IGF1) gene, may be composed of the nucleotide sequence of SEQ ID NO: 7. The human insulin-like growth factor gene may be developed as a therapeutic agent in the form of a protein or may be developed in the form of a gene therapy.

IGF1 is primarily secreted by the liver as a result of stimulation by human growth hormone (hGH). Almost all cells in the human body, especially those in muscle, cartilage, bone, liver, kidney, nerve, skin and lungs, are affected by IGF1. The IGF1 has an insulin-like effect as well as a cell growth regulation effect.

Isoform of human type 1 insulin-like growth factor

The term "IGF1 isoform" as used herein refers to IGF1 having an amino acid sequence that is at least 80% identical to an IGF1 amino acid sequence that is naturally occurring in animals, including all allelic variants. It means a polypeptide. For example, the IGF1 isoform is meant to encompass both the normal form or wild type of IGF1, and various variants of IGF1 (eg, splicing variants, deletion variants, and substitution variants).

Specific examples of IGF1 isoforms include IGF1 Ea, IGF1 Eb, and IGF1 Ec.

Variant of human type 1 insulin-like growth factor

In the present specification, the "IGF1 variant" may be a deleted variant of IGF1 (dIGF1) or a variant IGF1 in which an amino acid at a specific position is substituted. The term “dIGF1” as used herein refers to a deleted variant of the IGF1 protein produced by selective splicing of the IGF1 gene in an animal, preferably a mammal. In addition, as a specific example of the substituted variant IGF1, the "IGF1 variant" may be a polypeptide in which the amino acid glycine at position 42 is substituted by serine. Alternatively, as another specific example, the "IGF1 variant" may be a polypeptide having a mutation in amino acids G1, P2, E3, R36, R37, K68, S69 and/or A70 of the IGF1 protein.

Plasmid

When the composition for increasing gene expression according to the present invention is administered together with plasmids containing a single-stranded polynucleotide encoding the gene, the expression efficiency of the gene and thus the efficacy can be further increased.

In the present specification, the term "plasmid" generally refers to a circular DNA molecule formed by operatively linking to a vector so that a foreign gene can be expressed in a host cell. However, the plasmid can be used as a vector for introducing a new gene and digested by a specific restriction enzyme by genetic recombination to contain the desired gene. Therefore, in the present application, plasmids and vectors are used interchangeably, and those of ordinary skill in the field of genetic engineering will fully understand their meaning even if they do not distinguish between their names.

In the present specification, the term "vector" refers to a DNA molecule as a carrier capable of stably transporting foreign genes into a host cell. In order to be a useful vector, it must be able to be replicated, must be equipped with a way to enter the host cell, and must have a means to detect its existence.

Manifestation

Expression vector

When the composition for increasing gene expression according to the present invention is administered together with expression vectors including single-stranded polynucleotides encoding the gene, it is possible to further increase the expression efficiency of the gene and thus the efficacy.

As used herein, the term "expression" refers to the generation of the gene in a cell.

As used herein, the term "expression vector" refers to a vector capable of expressing the gene in a suitable host, and refers to a gene construct comprising essential regulatory elements operably linked to express a gene insert.

As used herein, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a polynucleotide encoding the gene to perform a general function. For example, a promoter and a polynucleotide encoding the gene may be operably linked to affect the expression of the polynucleotide. The operative linkage with the recombinant vector can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage use enzymes generally known in the art.

The expression vector of the present invention is constructed using a plasmid, vector or viral vector, but is not limited thereto. Suitable expression vectors may include expression control elements such as promoters, operators, initiation codons, stop codons, polyadenylation signals and enhancers, etc., and may be variously prepared according to the purpose, and the promoter of the vector may be constitutive or inducible. I can. Since plasmids are currently the most commonly used form of vectors, "plasmid" and "vector" are sometimes used interchangeably in the specification of the present invention. For the purposes of the present invention, it is preferred to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) an initiation point for efficient replication to contain several to hundreds of plasmid vectors per host cell, and (b) restrictions on which foreign DNA fragments can be inserted. It has a structure that includes an enzyme cleavage site. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated by using a synthetic oligonucleotide adapter or linker according to a conventional method.

As the vector used for overexpression of the gene according to the present invention, an expression vector known in the art may be used. The skeleton vector that can be used in the present invention is not particularly limited, but the group consisting of pCDNA3.1, pGP, pEF, pVAX, pUDK, pCK, pQE40, pT7, pET/Rb, pET28a, pET-22b(+) and pGEX A variety of vectors selected from can be used, and it is preferable in terms of effect to be prepared using one vector selected from the group consisting of pGP, pCK, pUDK, and pVAX.

In a preferred embodiment, the expression vector of the present invention may be an expression vector comprising a pGP vector having a cleavage map of FIG. 1.

Pharmaceutical composition

In addition, the present invention is a composition for increasing the gene expression of the above; And at least one gene selected from the human hepatocyte growth factor (HGF) gene, the heterologous gene of the human hepatocyte growth factor, and the mutant gene thereof; ischemic disease, neurological disease, kidney It provides a pharmaceutical composition for preventing or treating diseases or liver diseases.

The pharmaceutical composition for the prevention or treatment of ischemic disease, neurological disease, kidney disease or liver disease is also a small amount of human hepatocyte growth factor (HGF) gene, a heterologous gene of human hepatocyte growth factor, or a mutant gene thereof. As the expression of the gene is increased in the body, it exhibits an excellent therapeutic effect, so it can be usefully used in the prevention or treatment of ischemic diseases, neurological diseases, kidney diseases, or liver diseases.

The human hepatocyte growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 2, and the variant of the human hepatocyte growth factor gene may be composed of any one selected from the nucleotide sequences of SEQ ID NO: 3 to 6.

The "ischemic disease" is ischemic cerebrovascular disease, ischemic heart disease, ischemic myocardial infarction, diabetic vascular heart disease, ischemic heart failure, ischemic vascular disease, obstructive arteriosclerosis, myocardial hypertrophy, ischemic retinopathy, ischemic lower limb disease, ischemic colitis, It may be selected from the group consisting of ischemic acute renal failure, ischemic lung disease, ischemic stroke, ischemic necrosis, brain trauma, Alzheimer's disease, Parkinson's disease, neonatal hypoxia, glaucoma and diabetic neuropathy.

The "nerve disease" is a central nervous disease selected from the group consisting of amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, Huntington's chorea, spinal cerebellar degeneration, spinal cord injury, cerebral infarction, cerebral ischemia and multiple sclerosis. Can be

The "kidney disease" may be acute renal failure or chronic renal failure.

The "liver disease" may be hepatic ischemia, fatty liver, hepatitis, liver cancer, liver fibrosis or cirrhosis.

In addition, the present invention is a composition for increasing the gene expression of the above; And at least one gene selected from a human type 1 insulin-like growth factor-1 (IGF1) gene, a heterologous gene of the human type 1 insulin-like growth factor gene, and a mutant gene thereof; containing, IGF1 receptor It provides a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by binding.

The pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by binding to the IGF1 receptor exhibits excellent therapeutic effects due to the increase in expression of the gene in the body even with a small amount of human type 1 insulin-like growth factor gene. It can be usefully used in the prevention or treatment of symptoms or diseases mediated by receptor binding.

The human type 1 insulin-like growth factor gene may be composed of the nucleotide sequence of SEQ ID NO: 7.

In the pharmaceutical composition of the present invention, the composition for increasing gene expression: the growth factor gene may be included in a volume ratio (w/v) of 1:0.5 to 30.

On the other hand, the symptoms or diseases are short stature, obesity, weight loss, cachexia, loss of appetite, neurodegenerative disorders, fibrosis-related symptoms, cartilage disorders, bone diseases, inflammatory disorders, intestinal disorders, insulin resistance, diabetes, diabetic ketoacidosis , Robson-Mendenhall syndrome, retinopathy, acromegaly, fibromuscular hyperplasia, and heart disorders.

In particular, the individual requiring treatment for short stature is a human pediatric individual with insulin-like growth factor-1 deficiency (IGFD), and the pharmaceutical composition of the present invention is very effective in the treatment of IGFD in a human pediatric individual.

The pharmaceutical composition of the present invention may be for gene therapy.

Formulation

The pharmaceutical compositions described in the present invention can be formulated as therapeutic pharmaceutical preparations.

Such pharmaceutical carriers and excipients as well as suitable pharmaceutical formulations are known in the art (eg, "Pharmaceutical Formulation Development of Peptides and Proteins", Frokjaer et al. , Taylor & Francis (2000) or "Handbook of Pharmaceutical Excipients"" , 3rd edition, Kibbe et al. , Pharmaceutical Press (2000)). In particular, the pharmaceutical composition of the present invention may be formulated in a lyophilized form or a stable liquid form. The composition of the present invention can be lyophilized through various procedures known in the art. The lyophilized formulation is reconstituted prior to use with the addition of one or more pharmaceutically acceptable diluents such as sterile water for injection or sterile physiological saline.

The formulation of the composition is delivered to the subject by any pharmaceutically suitable means of administration. A variety of delivery systems are known and can be used to administer the composition by any convenient route. Primarily, the composition of the present invention is administered systemically. For systemic administration, the composition of the present invention is delivered parenterally (e.g., intravenous, subcutaneous, intramuscular, intraperitoneal, intracranial, intrapulmonary, intranasal or transdermal) delivery or intestinal (e.g., oral, vaginal or transdermal) delivery according to a conventional method. Rectal) formulated for delivery. The most preferred route of administration is intravenous and intramuscular administration. These formulations can be administered continuously by infusion or bolus injection. Some formulations include sustained release systems.

The composition of the present invention is administered to a patient in a therapeutically effective amount meaning a dose sufficient to produce the desired effect while preventing or reducing the severity or spread of the condition or symptom to be treated without reaching a dose that causes unacceptable side effects. The exact dosage depends on various factors, such as indications, formulation, and mode of administration, and should be determined through preclinical and clinical trials for each indication.

The pharmaceutical composition of the present invention may be administered alone or may be administered in combination with other therapeutic agents. These agents can be included as part of the same medicament.

Treatment method

In addition, the present invention relates to a method of treating an individual suffering from ischemic disease, neurological disease, kidney disease or liver disease, or suffering from a condition or disease mediated by IGF1 receptor binding. The treatment method may include administering an effective amount of the pharmaceutical composition of the present invention to an individual.

According to an embodiment of the present invention, genes such as HGF or IGF1 of the present invention may be administered at a dose of 10 ng to 100 mg. When the administration of HGF or IGF1, or a polynucleotide encoding it, is repeated more than once, the dosage may be the same or different each time.

Hereinafter, the present invention will be described in more detail with reference to preferred examples. However, these examples are intended to illustrate the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited thereto.

[Example]

Preparation of ingredients

gene

Human Hepatocyte Growth Factor (HGF)

The gene of human hepatocyte growth factor (HGF) represented by SEQ ID NO: 2 (refer to NCBI base sequence NM_000601.6) was produced by requesting Genscript (USA).

Human hepatocyte growth factor variant (HGFX6)

A mutant gene of human hepatocyte growth factor represented by SEQ ID NO: 3, HGFX6 (refer to Korean Patent Registration No. 10-0562824), was produced by requesting Genscript (USA).

Human hepatocyte growth factor variant (HGFX7)

A mutant gene of human hepatocyte growth factor represented by SEQ ID NO: 4, HGFX7 (refer to Korean Patent No. 10-0562824), was produced by requesting Genscript (USA).

Human hepatocyte growth factor variant (HGFX8)

A mutant gene of human hepatocyte growth factor represented by SEQ ID NO: 5, HGFX8 (refer to Korean Patent No. 10-0562824), was produced by requesting Genscript (USA).

Human hepatocyte growth factor variant (dHGF)

A mutant gene of human hepatocyte growth factor represented by SEQ ID NO: 6, dHGF (refer to Korean Patent No. 10-0562824), was produced by requesting Genscript (USA).

Human type 1 insulin-like growth factor-1 (IGF1)

The human type 1 insulin-like growth factor gene represented by SEQ ID NO: 7, IGF1 (refer to NCBI nucleotide sequence NM_001111283.2) was produced by requesting Bionics (Korea).

Human Vascular Endothelial Growth Factor (VEGF)

The human vascular endothelial growth factor gene represented by SEQ ID NO: 8, VEGF (see GenBank nucleotide sequence AB021221.1; VEGF ₁₆₅ ) was produced by requesting Bionics (Korea).

Human Type 1 Fibroblast Growth Factor-1 (FGF1)

The human type 1 fibroblast growth factor gene represented by SEQ ID NO: 9, FGF1 (refer to GenBank nucleotide sequence X65778.1) was produced by requesting Bionics (Korea).

Human Type 4 Fibroblast Growth Factor-4 (FGF4)

A human type 4 fibroblast growth factor gene represented by SEQ ID NO: 10, FGF4 (refer to GenBank nucleotide sequence M17446.1), was produced by requesting Bionics (Korea).

Human Platelet-derived Growth Factor (PDGF-B)

The human B platelet-derived growth factor gene represented by SEQ ID NO: 11, PDGF-B (refer to GenBank nucleotide sequence X02811.1), was produced by requesting Bionics (Korea).

Plasmid (pGP)

Lee Y, et al ., Improved expression of vascular endothelial growth factor by naked DNA in mouse skeletal muscles: implication for gene therapy of ischemic diseases. Biochem. Biophys. Res. Commun. 2000;272(1):230- After synthesizing the pCK plasmid with reference to the paper of 235), PCR was performed in the same manner as described above using primers 1 and 2 in Table 1 to obtain a fragment, and then reacted with EcoRI enzyme at 37°C for 1 hour. DNA was purified using Expin Gel SV (GeneAll, Korea) kit. Then, after ligation for 30 minutes using T4 ligase, it was incubated overnight in E. coli. The next day, the colony was cultured, and then mini-prep was performed to isolate the DNA to prepare a pGP plasmid represented by SEQ ID NO: 1. 1 shows a cleavage map of a pGP vector according to an embodiment of the present invention.

Primer number primer
persons order
number Base sequence One pGP(F) 12 GACGAATTCACGCGTCTCGAGGCGGCCGCTCTAGAGGGCCCGTTTAAA 2 pGP(R) 13 GACGAATTCGTCGACGGATCCGCTAGCAAGCTTCGTGTCAAGGACGGT

Manufacturing example

Preparation of plasmid DNA containing gene

Each of the genes and the pGP plasmid prepared above were digested for 1 hour with NheI and NotI enzymes, respectively, and the fragments were separated by electrophoresis on an agarose gel. The separated sections were ligation with T4 ligase for 30 minutes and incubated overnight in E. Coli. The next day, colony was cultured, mini-prep and DNA was isolated and confirmed with NheI and NotI. The cloned DNA is E. Coli supernatant, confirmed as a restriction enzyme, in two 4 L flasks, together with kanamycin, and incubated overnight. Endofree Giga prep. Plasmid DNA was produced using kit (Qiagen, USA) and used in animal experiments. Each of the prepared plasmid DNAs is summarized in Table 2 below and shown.

gene Sequence number Plasmid DNA Human hepatocyte growth factor (HGF) SEQ ID NO: 2 pGP-HGF Human hepatocyte growth factor variant (HGFX6) SEQ ID NO: 3 pGP-HGFX6 Human hepatocyte growth factor variant (HGFX7) SEQ ID NO: 4 pGP-HGFX7 Human hepatocyte growth factor variant (HGFX8) SEQ ID NO: 5 pGP-HGFX8 Human hepatocyte growth factor variant (dHGF) SEQ ID NO: 6 pGP-dHGF Human type 1 insulin-like growth factor (IGF1) SEQ ID NO: 7 pGP-IGF1 Human Vascular Endothelial Cell Growth Factor (VEGF) SEQ ID NO: 8 pGP-VEGF Human type 1 fibroblast growth factor (FGF1) SEQ ID NO: 9 pGP-FGF1 Human type 4 fibroblast growth factor (FGF4) SEQ ID NO: 10 pGP-FGF4 Human type B platelet-derived growth factor (PDGF-B) SEQ ID NO: 11 pGP-PDGF-B

Example

Example 1: Preparation of a composition for increasing gene expression and a pharmaceutical composition containing HGF (HGF-MP1, HGF-MP2 and HGF-MP3)

Composition for increasing gene expression

The average diameter was about 2.5 ㎛, the core was composed of sulfur hexafluoride, the shell was composed of lipids, and the core-shell structured microparticles represented by the standard code 621400210 were purchased from Braco Imaging Korea (MP1). In addition, the average diameter is about 2.4 to 3.6 ㎛, the core is composed of perfluorobutane, the shell is composed of lipids and surfactants. It was purchased from (MP2). In addition, the average diameter was about 1.1 to 3.3 ㎛, the core was composed of perfluoropropane, the shell was composed of lipids and surfactants, and microparticles having a core-shell structure represented by the standard code 662900020 were purchased from Bukyung SM ( MP3).

The microparticle MP1 was prepared as a suspension (composition for increasing gene expression) by mixing 225 μg with 2 ml of physiological saline according to the manufacturer's manual, and MP2 was mixed with 2 ml of water for injection according to the manufacturer's manual. It was prepared as a suspension (composition for increasing gene expression). In addition, the microparticle solution MP3 (150 µl/ml) mixed with physiological saline was shaken vigorously for 45 seconds according to the manufacturer's manual to prepare a suspension (composition for increasing gene expression).

Preparation of a composition for increasing gene expression and a pharmaceutical composition containing HGF

Each of the composition for increasing gene expression (MP1, MP2 and MP3) 15 µl and the prepared pGP-HGF 70 µg/35 µl were mixed to prepare respective pharmaceutical compositions HGF-MP1, HGF-MP2 and HGF-MP3. .

Example 2: Preparation of a composition for increasing gene expression and a pharmaceutical composition containing HGFX7 (HGFX7-MP1 and HGFX7-MP2)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising HGFX7

Each of the composition for increasing gene expression (MP1 and MP2) 15 μl and 70 μg/35 μl of pGP-HGFX7 were mixed to prepare respective pharmaceutical compositions HGFX7-MP1 and HGFX7-MP2.

Example 3: Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising IGF1 (IGF1-MP1, IGF1-MP2 and IGF1-MP3)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising IGF1

Each of the composition for increasing gene expression (MP1, MP2 and MP3) 15 µl and 70 µg/35 µl of pGP-IGF1 were mixed to prepare respective pharmaceutical compositions IGF1-MP1, IGF1-MP2 and IGF1-MP3. .

Comparative Example 1: Preparation of a composition for increasing gene expression and a pharmaceutical composition containing VEGF (VEGF-MP1 and VEGF-MP2)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising VEGF

Each of the composition for increasing gene expression (MP1 and MP2) 15 µl and 70 µg/35 µl of pGP-VEGF were mixed to prepare respective pharmaceutical compositions VEGF-MP1 and VEGF-MP2.

Comparative Example 2: Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising FGF1 (FGF1-MP1 and FGF1-MP2)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising FGF1

15 µl of each of the compositions for increasing gene expression (MP1 and MP2) and 70 µg/35 µl of pGP-FGF1 were mixed to prepare respective pharmaceutical compositions FGF1-MP1 and FGF1-MP2.

Comparative Example 3: Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising FGF4 (FGF4-MP1 and FGF4-MP2)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising FGF4

15 µl of each of the compositions for increasing gene expression (MP1 and MP2) and 70 µg/35 µl of pGP-FGF4 were mixed to prepare respective pharmaceutical compositions FGF4-MP1 and FGF4-MP2.

Comparative Example 4: Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising PDGF-B (PDGF-B-MP1 and PDGF-B-MP2)

Composition for increasing gene expression

A composition for increasing gene expression was prepared in the same manner as in Example 1.

Preparation of a composition for increasing gene expression and a pharmaceutical composition comprising PDGF-B

Each pharmaceutical composition PDGF-B-MP1 and PDGF-B-MP2 were prepared by mixing 15 µl of each of the compositions for increasing gene expression (MP1 and MP2) and 70 µg/35 µl of pGP-PDGF-B prepared above. .

Control

Composition for increasing gene expression

A suspension (corresponding to a composition for increasing gene expression) was prepared by mixing 128 µl of JetPEI with 2 ml 5% glucose according to the manufacturer's manual of in vivo JetPEI (Polyplus, USA).

Preparation of a composition for increasing gene expression and a pharmaceutical composition containing each gene

Each of the pharmaceutical compositions HGF-JetPEI, HGFX7-JetPEI, IGF1-JetPEI, and VEGF-JetPEI were prepared by mixing 15 µl of the composition for increasing gene expression and 70 µg/35 µl of each DNA.

Experimental example

Experimental Example 1: Protein expression level in mice

Each of the pharmaceutical compositions according to the control, Examples and Comparative Examples was injected into the calf muscles of the lower limbs of Balb/c mice (Samtacobio) at 75 µg/50 µl/leg.

On the 7th day after administration, the mice were slaughtered and the muscle of the injection site was excised. Then, each of the cut-out muscles was pulverized using liquid nitrogen and a protein extraction kit (Cellbiolabs, USA), and then total protein was separated. The separated total protein mass was measured using a DC protein analysis kit (Bio-Rad laboratories, USA).

In order to measure HGF protein, the expression level of each gene was measured through an ELISA kit (R&D systems, USA) using the same amount of protein, and are shown in FIGS. 2 and 3.

In order to measure the IGF1 protein, the same amount of protein was used and the expression level of each gene was measured using an IGF1 ELISA kit (R&D systems, USA), and the expression level was shown in FIG. 4.

2 to 4, it can be seen that when the pharmaceutical composition according to the present invention (Examples 1 to 3) was administered, the HGF or IGF1 gene expression level was statistically significantly higher than that of the control group. .

In order to measure the VEGF protein, the same amount of protein was used and the expression level of each gene was measured using a VEGF ELISA kit (R&D systems, USA), and the expression level was shown in FIG. 5.

In order to measure the FGF1 protein, the expression level of each gene was measured through the FGF1 ELISA kit (Abcam, USA) using the same amount of protein and shown in FIG. 6.

In order to measure the FGF4 protein, the same amount of protein was used, and the expression level of each gene was measured through the FGF4 ELISA kit (Abcam, USA), and is shown in FIG. 7.

In order to measure the PDGF-B protein, the same amount of protein was used, and the expression level of each gene was measured through a PDGF-B ELISA kit (R&D systems, USA), and is shown in FIG.

5 to 8, it can be seen that when the compositions of Comparative Examples 1 to 4 were administered, the amount of expression did not increase significantly compared to the compositions of the control groups.

Through the above results, it was confirmed that the compositions of Examples 1 to 3 according to the present invention can significantly increase the expression level of HGF or IGF1 gene.

Experimental Example 2: Evaluation of the efficacy of the pharmaceutical composition of the present invention in a rat peripheral neuropathy model induced by diabetes

The cause of diabetic peripheral neuropathy (DPN) is an ischemic disease in which blood sugar rises due to diabetes induction, and damage to the microvascular through it, causes peripheral nerve damage, and clinically causes symptoms such as pain and other symptoms. It is a complex disease of neurological diseases. The streptozotocin induced diabetic peripheral neuropathy used in this study is a representative animal model.

Type 1 diabetes was induced by intravenous injection of 70 mg/kg of streptozotocin (STZ) into 6-week-old male Sprague-Dawley rats purchased from Samtaco Bio. One week after STZ injection, individuals with non-fasting blood sugar of 300 mg/dL or more were selected, and paw withdrawal threshold (PWT) was measured through a manual Von Frey test to measure the degree of pain induction for each individual. Induced individuals (PWT value of 4.0 or less) were selected and separated into 2 groups of 5 animals for each group.

Then, as a control group, 400 µg of pGP-HGFX7 DNA was administered to both calf muscles at 200 µg/200 µl, respectively, and HGFX7-MP2 of Example 2 was administered to both calf muscles in the same amount (400 µg) as the control.

As a result of measuring PWT, which is a measure of pain, 2 weeks after administration, it was confirmed that the PWT value was statistically significantly increased in the group to which HGFX7-MP2 of Example 2 was administered compared to the control group (see FIG. 9).

Experimental Example 3: Evaluation of the efficacy of the pharmaceutical composition of the present invention in a rat neuropathy model induced by chronic constriction injury surgery

Neuropathic pain is known as a chronic neurological disease caused by an abnormality in the nervous system, and clinically, the sensitivity of pain increases, leading to abnormal pain and the like. The chronic constriction injury caused by ligation of the sciatic nerve used in this study is a representative animal model for such chronic nerve pain.

A 5-week-old male Sprague-Dawley rat purchased from Orient Bio was anesthetized (isoflurane, mixed with nitrogen dioxide and oxygen) and an incision was made in the middle of the left thigh to expose the sciatic nerve. The exposed sciatic nerve was loosely ligated and sutured with 3 strands at 1.0 to 1.5 mm intervals using a 4-0 catgut suture. At the first week of surgery, the paw withdrawal threshold (PWT) was measured through the manual Von Frey test, and subjects with pain (PWT value of 4.0 or less) were selected and separated into 2 groups of 5 animals for each group.

Thereafter, as a control group, 1 mg of pGP-HGF DNA was administered to the left femoral muscle at 250 µg/250 µl at 4 sites, and HGF-MP2 of Example 1 was applied at the same site as the control group at 250 µg/250 µl at 4 sites ( A total of 1 mg).

As a result of measuring PWT, which is a measure of pain, 2 weeks after administration, the PWT value was statistically significantly increased in the group administered with HGF-MP2 of Example 1 compared to the control group, resulting in a significant increase in the magnitude of the force to feel pain. It was confirmed (see Fig. 10).

Through the above results, it was proved that the composition of the present invention significantly increases the amount of gene expression, thereby improving gene efficacy in various disease models.

Specifically, in Experimental Example 2, as a result of measuring the PWT value on the second week after administration to the rat model induced diabetic neuropathy together with the composition for increasing gene expression of the present invention and HGFX7, 80% compared to the control group. It was confirmed that the PWT value slightly increased.

In addition, in Experimental Example 3, as a result of measuring the PWT value on the second week after administering the composition for increasing gene expression of the present invention together with HGF to a rat model in which neurotic pain was induced, a PWT value of 40% or more compared to the control group It was confirmed that this rose.

In the above, the increase in the PWT value means that the magnitude of the force to feel pain is significantly increased, that is, the pain is relieved. As described above, the effect of reducing pain in an animal model in which diabetic neuropathy or neurogenic pain is induced appears to be due to the increased expression of HGF or HGFX7 in the body due to the composition for increasing gene expression of the present invention.

That is, through the above experimental examples, the composition for increasing gene expression of the present invention and a pharmaceutical composition comprising at least one gene selected from human hepatocyte growth factor (HGF), a variant thereof, and a variant thereof are used in an animal model of neurological pain and diabetes. All animal models of sexual neuropathy were found to have the effect of alleviating pain. Therefore, when using the composition for increasing gene expression of the present invention and a pharmaceutical composition containing as an active ingredient at least one gene selected from human hepatocyte growth factor (HGF), a variant thereof, and a variant thereof, diabetic neuropathy or neuropathic pain It is believed that it can prevent, alleviate, or treat various neurological diseases such as.

Although the present invention has been described as a preferred embodiment mentioned above, it is possible to make various modifications or variations without departing from the gist and scope of the invention. In addition, the appended claims include such modifications or variations that fall within the gist of the present invention.

<110> GNPBIOSCIENCE <120> Composition for increasing expression level of growth factor genes containing core-shell structured microparticles as effective component <130> HPC-9887 <150> KR 2018/0017075 <151> 2018-02-12 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 3725 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of pGP <400> 1 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtccgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttac gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtgatgc ggttttggca gtacaccaat gggcgtggat 420 agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt 480 tttggcacca aaatcaacgg gactttccaa aatgtcgtaa taaccccgcc ccgttgacgc 540 aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcgt ttagtgaacc 600 gtcagatcgc ctggagacgc catccacgct gttttgacct ccatagaaga caccgggacc 660 gatccagcct ccgcggccgg gaacggtgca ttggaacgcg gattccccgt gccaagagtg 720 acgtaagtac cgcctataga ctctataggc acaccccttt ggctcttatg catgctatac 780 tgtttttggc ttggggccta tacacccccg cttccttatg ctataggtga tggtatagct 840 tagcctatag gtgtgggtta ttgaccatta ttgaccactc ccctattggt gacgatactt 900 tccattacta atccataaca tggctctttg ccacaactat ctctattggc tatatgccaa 960 tactctgtcc ttcagagact gacacggact ctgtattttt acaggatggg gtcccattta 1020 ttatttacaa attcacatat acaacaacgc cgtcccccgt gcccgcagtt tttattaaac 1080 atagcgtggg atctccacgc gaatctcggg tacgtgttcc ggacatgggc tcttctccgg 1140 tagcggcgga gcttccacat ccgagccctg gtcccatgcc tccagcggct catggtcgct 1200 cggcagctcc ttgctcctaa cagtggaggc cagacttagg cacagcacaa tgcccaccac 1260 caccagtgtg ccgcacaagg ccgtggcggt agggtatgtg tctgaaaatg agctcggaga 1320 ttgggctcgc accgctgacg cagatggaag acttaaggca gcggcagaag aagatgcagg 1380 cagctgagtt gttgtattct gataagagtc agaggtaact cccgttgcgg tgctgttaac 1440 ggtggagggc agtgtagtct gagcagtact cgttgctgcc gcgcgcgcca ccagacataa 1500 tagctgacag actaacagac tgttcctttc catgggtctt ttctgcagtc accgtccttg 1560 acacgaagct tgctagcgga tccgtcgacg aattcacgcg tctcgaggcg gccgctctag 1620 agggcccgtt taaacccgct gatcagcctc gactgtgcct tctagttgcc agccatctgt 1680 tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca ctgtcctttc 1740 ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg 1800 tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc atgctgggga 1860 gtcgaaattc agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga 1920 gcggcgatac cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag ctcttcagca 1980 atatcacggg tagccaacgc tatgtcctga tagcggtccg ccacacccag ccggccacag 2040 tcgatgaatc cagaaaagcg gccattttcc accatgatat tcggcaagca ggcatcgcca 2100 tgggtcacga cgagatcctc gccgtcgggc atgctcgcct tgagcctggc gaacagttcg 2160 gctggcgcga gcccctgatg ctcttcgtcc agatcatcct gatcgacaag accggcttcc 2220 atccgagtac gtgctcgctc gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc 2280 ggatcaagcg tatgcagccg ccgcattgca tcagccatga tggatacttt ctcggcagga 2340 gcaaggtgag atgacaggag atcctgcccc ggcacttcgc ccaatagcag ccagtccctt 2400 cccgcttcag tgacaacgtc gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac 2460 gatagccgcg ctgcctcgtc ttgcagttca ttcagggcac cggacaggtc ggtcttgaca 2520 aaaagaaccg ggcgcccctg cgctgacagc cggaacacgg cggcatcaga gcagccgatt 2580 gtctgttgtg cccagtcata gccgaatagc ctctccaccc aagcggccgg agaacctgcg 2640 tgcaatccat cttgttcaat catgcgaaac gatcctcatc ctgtctcttg atcagatctt 2700 gatcccctgc gccatcagat ccttggcggc gagaaagcca tccagtttac tttgcagggc 2760 ttcccaactt accagagggc gccccagctg gcaattccgg ttcgcttgct gtccataaaa 2820 ccgcccagtc tagctatcgc catgtaagcc cactgcaagc tacctgcttt ctctttgcgc 2880 ttgcgttttc ccttgtccag atagcccagt agctgacatt catccggggt cagcaccgtt 2940 tctgcggact ggctttctac gtgaaaagga tctaggtgaa gatccttttt gataatctca 3000 tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc gtagaaaaga 3060 tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa 3120 aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact ctttttccga 3180 aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg tagccgtagt 3240 taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg ctaatcctgt 3300 taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac tcaagacgat 3360 agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca cagcccagct 3420 tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga gaaagcgcca 3480 cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc ggaacaggag 3540 agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct gtcgggtttc 3600 gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg agcctatgga 3660 aaaacgccag caacgcggcc tttttacggt tcctgggctt ttgctggcct tttgctcaca 3720 tgcgc 3725 <210> 2 <211> 2187 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of HGF <400> 2 atgtgggtga ccaaactcct gccagccctg ctgctgcagc atgtcctcct gcatctcctc 60 ctgctcccca tcgccatccc ctatgcagag ggacaaagga aaagaagaaa tacaattcat 120 gaattcaaaa aatcagcaaa gactacccta atcaaaatag atccagcact gaagataaaa 180 accaaaaaag tgaatactgc agaccaatgt gctaatagat gtactaggaa taaaggactt 240 ccattcactt gcaaggcttt tgtttttgat aaagcaagaa aacaatgcct ctggttcccc 300 ttcaatagca tgtcaagtgg agtgaaaaaa gaatttggcc atgaatttga cctctatgaa 360 aacaaagact acattagaaa ctgcatcatt ggtaaaggac gcagctacaa gggaacagta 420 tctatcacta agagtggcat caaatgtcag ccctggagtt ccatgatacc acacgaacac 480 agctttttgc cttcgagcta tcggggtaaa gacctacagg aaaactactg tcgaaatcct 540 cgaggggaag aagggggacc ctggtgtttc acaagcaatc cagaggtacg ctacgaagtc 600 tgtgacattc ctcagtgttc agaagttgaa tgcatgacct gcaatgggga gagttatcga 660 ggtctcatgg atcatacaga atcaggcaag atttgtcagc gctgggatca tcagacacca 720 caccggcaca aattcttgcc tgaaagatat cccgacaagg gctttgatga taattattgc 780 cgcaatcccg atggccagcc gaggccatgg tgctatactc ttgaccctca cacccgctgg 840 gagtactgtg caattaaaac atgcgctgac aatactatga atgacactga tgttcctttg 900 gaaacaactg aatgcatcca aggtcaagga gaaggctaca ggggcactgt caataccatt 960 tggaatggaa ttccatgtca gcgttgggat tctcagtatc ctcacgagca tgacatgact 1020 cctgaaaatt tcaagtgcaa ggacctacga gaaaattact gccgaaatcc agatgggtct 1080 gaatcaccct ggtgttttac cactgatcca aacatccgag ttggctactg ctcccaaatt 1140 ccaaactgtg atatgtcaca tggacaagat tgttatcgtg ggaatggcaa aaattatatg 1200 ggcaacttat cccaaacaag atctggacta acatgttcaa tgtgggacaa gaacatggaa 1260 gacttacatc gtcatatctt ctgggaacca gatgcaagta agctgaatga gaattactgc 1320 cgaaatccag atgatgatgc tcatggaccc tggtgctaca cgggaaatcc actcattcct 1380 tgggattatt gccctatttc tcgttgtgaa ggtgatacca cacctacaat agtcaattta 1440 gaccatcccg taatatcttg tgccaaaacg aaacaattgc gagttgtaaa tgggattcca 1500 acacgaacaa acataggatg gatggttagt ttgagataca gaaataaaca tatctgcgga 1560 ggatcattga taaaggagag ttgggttctt actgcacgac agtgtttccc ttctcgagac 1620 ttgaaagatt atgaagcttg gcttggaatt catgatgtcc acggaagagg agatgagaaa 1680 tgcaaacagg ttctcaatgt ttcccagctg gtatatggcc ctgaaggatc agatctggtt 1740 ttaatgaagc ttgccaggcc tgctgtcctg gatgattttg ttagtacgat tgatttacct 1800 aattatggat gcacaattcc tgaaaagacc agttgcagtg tttatggctg gggctacact 1860 ggattgatca actatgatgg cctattacga gtggcacatc tctatataat gggaaatgag 1920 aaatgcagcc agcatcatcg agggaaggtg actctgaatg agtctgaaat atgtgctggg 1980 gctgaaaaga ttggatcagg accatgtgag ggggattatg gtggcccact tgtttgtgag 2040 caacataaaa tgagaatggt tcttggtgtc attgttcctg gtcgtggatg tgccattcca 2100 aatcgtcctg gtatttttgt ccgagtagca tattatgcaa aatggataca caaaattatt 2160 ttaacatata aggtaccaca gtcatag 2187 <210> 3 <211> 4679 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of HGFX6 <400> 3 atgtgggtga ccaaactcct gccagccctg ctgctgcagc atgtcctcct gcatctcctc 60 ctgctcccca tcgccatccc ctatgcagag ggacaaagga aaagaagaaa tacaattcat 120 gaattcaaaa aatcagcaaa gactacccta atcaaaatag atccagcact gaagataaaa 180 accaaaaaag tgaatactgc agaccaatgt gctaatagat gtactaggaa taaaggactt 240 ccattcactt gcaaggcttt tgtttttgat aaagcaagaa aacaatgcct ctggttcccc 300 ttcaatagca tgtcaagtgg agtgaaaaaa gaatttggcc atgaatttga cctctatgaa 360 aacaaagact acattagaaa ctgcatcatc ggtaaaggac gcagctacaa gggaacagta 420 tctatcacta agagtggcat caaatgtcag ccctggagtt ccatgatacc acacgaacac 480 aggtaagaac agtatgaaga aaagagatga agcctctgtc ttttttacat gttaacagtc 540 tcatattagt ccttcagaat aattctacaa tcctaaaata acttagccaa cttgctgaat 600 tgtattacgg caaggtttat atgaattcat gactgatatt tagcaaatga ttaattaata 660 tgttaataaa atgtagccaa aacaatatct taccttaatg cctcaatttg tagatctcgg 720 tatttgtgga tcccttcctt tctacctgta tttgtcctaa taaattgttg acttattaat 780 tcactacttc ctcacagctt ttttttggct ttacaaatcc actggaaagg tatatgggtg 840 tatcactttg tgtatttcgg tgtgcatgtg tagaggggac aaaaatcctc tctcaaacta 900 taaatattga gtatttgtgt attgaacatt tgctataact actaggtttc ttaaataatc 960 ttaatatata aaatgatata gaaaaaggga aattatagtt cgtattattc atctaagtga 1020 agagattaaa acccagggag taaataaatt gtctaaggac taaggttgta tactatttag 1080 gtgatagata tggggcaacc gtatgggttt tatgattaac aaataaactt ctcaccactc 1140 taccatatca acttttccat aaaagagagc tatagtattc tttgcttaaa taaatttgat 1200 tagtgcatga cttcttgaaa acatataaag caaaagtcac atttgattct atcagaaaag 1260 tgagtaagcc atggcccaaa caaaagatgc attaaaatat tctggaatga tggagctaaa 1320 agtaagaaaa atgacttttt aaaaaagttt actgttagga attgtgaaat tatgctgaat 1380 tttagttgca ttataatttt tgtcagtcat acggtctgac aacctgtctt atttctattt 1440 ccccatatga ggaatgctag ttaagtatgg atattaacta ttactactta gatgcattga 1500 agttgcataa tatggataat acttcactgg ttccctgaaa atgtttagtt agtaataagt 1560 ctcttacact atttgttttg tccaataatt tatattttct gaagacttaa ctctagaata 1620 cactcatgtc aaaatgaaag aatttcattg caaaatattg cttggtacat gacgcatacc 1680 tgtatttgtt ttgtgtcaca acatgaaaaa tgatggttta ttagaagttt cattgggtag 1740 gaaacacatt tgaatggtat ttactaagat actaaaatcc ttggacttca ctctaatttt 1800 agtgccattt agaactcaag gtctcagtaa aagtagaaat aaagcctgtt aacaaaacac 1860 aagctgaata ttaaaaatgt aactggattt tcaaagaaat gtttactggt attacctgta 1920 gatgtatatt ctttattatg atcttttgtg taaagtctgg cagacaaatg caatatctaa 1980 ttgttgagtc caatatcaca agcagtacaa aagtataaaa aagacttggc cttttctaat 2040 gtgttaaaat actttatgct ggtaataaca ctaagagtag ggcactagaa attttaagtg 2100 aagataatgt gttgcagtta ctgcactcaa tggcttacta ttataaacca aaactgggat 2160 cactaagctc cagtcagtca aaatgatcaa aattattgaa gagaataagc aattctgttc 2220 tttattagga cacagtagat acagactaca aagtggagtg tgcttaataa gaggtagcat 2280 ttgttaagtg tcaattactc tattatccct tggagcttct caaaataacc atataaggtg 2340 taagatgtta aaggttatgg ttacactcag tgcacaggta agctaatagg ctgagagaag 2400 ctaaattact tactggggtc tcacagtaag aaagtgagct gaagtttcag cccagattta 2460 actggattct gggctcttta ttcatgttac ttcatgaatc tgtttctcaa ttgtgcagaa 2520 aaaagggggc tatttataag aaaagcaata aacaaacaag taatgatctc aaataagtaa 2580 tgcaagaaat agtgagattt caaaatcagt ggcagcgatt tctcagttct gtcctaagtg 2640 gccttgctca atcacctgct atcttttagt ggagctttga aattatgttt cagacaactt 2700 cgattcagtt ctagaatgtt tgactcagca aattcacagg ctcatctttc taacttgatg 2760 gtgaatatgg aaattcagct aaatggatgt taataaaatt caaacgtttt aaggacagat 2820 gaaaatgaca gaattttaag gtaaaatata tgaaggaata taagataaag gatttttcta 2880 ccttcagcaa aaacataccc actaattagt aaaattaata ggcaaaaaaa agttgcatgc 2940 tcttatactg taatgattat cattttaaaa ctagcttttt gccttcgagc tatcggggta 3000 aagacctaca ggaaaactac tgtcgaaatc ctcgagggga agaaggggga ccctggtgtt 3060 tcacaagcaa tccagaggta cgctacgaag tctgtgacat tcctcagtgt tcagaagttg 3120 aatgcatgac ctgcaatggg gagagttatc gaggtctcat ggatcataca gaatcaggca 3180 agatttgtca gcgctgggat catcagacac cacaccggca caaattcttg cctgaaagat 3240 atcccgacaa gggctttgat gataattatt gccgcaatcc cgatggccag ccgaggccat 3300 ggtgctatac tcttgaccct cacacccgct gggagtactg tgcaattaaa acatgcgctg 3360 acaatactat gaatgacact gatgttcctt tggaaacaac tgaatgcatc caaggtcaag 3420 gagaaggcta caggggcact gtcaatacca tttggaatgg aattccatgt cagcgttggg 3480 attctcagta tcctcacgag catgacatga ctcctgaaaa tttcaagtgc aaggacctac 3540 gagaaaatta ctgccgaaat ccagatgggt ctgaatcacc ctggtgtttt accactgatc 3600 caaacatccg agttggctac tgctcccaaa ttccaaactg tgatatgtca catggacaag 3660 attgttatcg tgggaatggc aaaaattata tgggcaactt atcccaaaca agatctggac 3720 taacatgttc aatgtgggac aagaacatgg aagacttaca tcgtcatatc ttctgggaac 3780 cagatgcaag taagctgaat gagaattact gccgaaatcc agatgatgat gctcatggac 3840 cctggtgcta cacgggaaat ccactcattc cttgggatta ttgccctatt tctcgttgtg 3900 aaggtgatac cacacctaca atagtcaatt tagaccatcc cgtaatatct tgtgccaaaa 3960 cgaaacaatt gcgagttgta aatgggattc caacacgaac aaacatagga tggatggtta 4020 gtttgagata cagaaataaa catatctgcg gaggatcatt gataaaggag agttgggttc 4080 ttactgcacg acagtgtttc ccttctcgag acttgaaaga ttatgaagct tggcttggaa 4140 ttcatgatgt ccacggaaga ggagatgaga aatgcaaaca ggttctcaat gtttcccagc 4200 tggtatatgg ccctgaagga tcagatctgg ttttaatgaa gcttgccagg cctgctgtcc 4260 tggatgattt tgttagtacg attgatttac ctaattatgg atgcacaatt cctgaaaaga 4320 ccagttgcag tgtttatggc tggggctaca ctggattgat caactatgat ggcctattac 4380 gagtggcaca tctctatata atgggaaatg agaaatgcag ccagcatcat cgagggaagg 4440 tgactctgaa tgagtctgaa atatgtgctg gggctgaaaa gattggatca ggaccatgtg 4500 agggggatta tggtggccca cttgtttgtg agcaacataa aatgagaatg gttcttggtg 4560 tcattgttcc tggtcgtgga tgtgccattc caaatcgtcc tggtattttt gtccgagtag 4620 catattatgc aaaatggata cacaaaatta ttttaacata taaggtacca cagtcatag 4679 <210> 4 <211> 3679 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of HGFX7 <400> 4 atgtgggtga ccaaactcct gccagccctg ctgctgcagc atgtcctcct gcatctcctc 60 ctgctcccca tcgccatccc ctatgcagag ggacaaagga aaagaagaaa tacaattcat 120 gaattcaaaa aatcagcaaa gactacccta atcaaaatag atccagcact gaagataaaa 180 accaaaaaag tgaatactgc agaccaatgt gctaatagat gtactaggaa taaaggactt 240 ccattcactt gcaaggcttt tgtttttgat aaagcaagaa aacaatgcct ctggttcccc 300 ttcaatagca tgtcaagtgg agtgaaaaaa gaatttggcc atgaatttga cctctatgaa 360 aacaaagact acattagaaa ctgcatcatc ggtaaaggac gcagctacaa gggaacagta 420 tctatcacta agagtggcat caaatgtcag ccctggagtt ccatgatacc acacgaacac 480 aggtaagaac agtatgaaga aaagagatga agcctctgtc ttttttacat gttaacagtc 540 tcatattagt ccttcagaat aattctacaa tcctaaaata acttagccaa cttgctgaat 600 tgtattacgg caaggtttat atgaattcat gactgatatt tagcaaatga ttaattaata 660 tgttaataaa atgtagccaa aacaatatct taccttaatg cctcaatttg tagatctcgg 720 tatttgtgga tcctgggtag gaaacacatt tgaatggtat ttactaagat actaaaatcc 780 ttggacttca ctctaatttt agtgccattt agaactcaag gtctcagtaa aagtagaaat 840 aaagcctgtt aacaaaacac aagctgaata ttaaaaatgt aactggattt tcaaagaaat 900 gtttactggt attacctgta gatgtatatt ctttattatg atcttttgtg taaagtctgg 960 cagacaaatg caatatctaa ttgttgagtc caatatcaca agcagtacaa aagtataaaa 1020 aagacttggc cttttctaat gtgttaaaat actttatgct ggtaataaca ctaagagtag 1080 ggcactagaa attttaagtg aagataatgt gttgcagtta ctgcactcaa tggcttacta 1140 ttataaacca aaactgggat cactaagctc cagtcagtca aaatgatcaa aattattgaa 1200 gagaataagc aattctgttc tttattagga cacagtagat acagactaca aagtggagtg 1260 tgcttaataa gaggtagcat ttgttaagtg tcaattactc tattatccct tggagcttct 1320 caaaataacc atataaggtg taagatgtta aaggttatgg ttacactcag tgcacaggta 1380 agctaatagg ctgagagaag ctaaattact tactggggtc tcacagtaag aaagtgagct 1440 gaagtttcag cccagattta actggattct gggctcttta ttcatgttac ttcatgaatc 1500 tgtttctcaa ttgtgcagaa aaaagggggc tatttataag aaaagcaata aacaaacaag 1560 taatgatctc aaataagtaa tgcaagaaat agtgagattt caaaatcagt ggcagcgatt 1620 tctcagttct gtcctaagtg gccttgctca atcacctgct atcttttagt ggagctttga 1680 aattatgttt cagacaactt cgattcagtt ctagaatgtt tgactcagca aattcacagg 1740 ctcatctttc taacttgatg gtgaatatgg aaattcagct aaatggatgt taataaaatt 1800 caaacgtttt aaggacagat gaaaatgaca gaattttaag gtaaaatata tgaaggaata 1860 taagataaag gatttttcta ccttcagcaa aaacataccc actaattagt aaaattaata 1920 ggcaaaaaaa agttgcatgc tcttatactg taatgattat cattttaaaa ctagcttttt 1980 gccttcgagc tatcggggta aagacctaca ggaaaactac tgtcgaaatc ctcgagggga 2040 agaaggggga ccctggtgtt tcacaagcaa tccagaggta cgctacgaag tctgtgacat 2100 tcctcagtgt tcagaagttg aatgcatgac ctgcaatggg gagagttatc gaggtctcat 2160 ggatcataca gaatcaggca agatttgtca gcgctgggat catcagacac cacaccggca 2220 caaattcttg cctgaaagat atcccgacaa gggctttgat gataattatt gccgcaatcc 2280 cgatggccag ccgaggccat ggtgctatac tcttgaccct cacacccgct gggagtactg 2340 tgcaattaaa acatgcgctg acaatactat gaatgacact gatgttcctt tggaaacaac 2400 tgaatgcatc caaggtcaag gagaaggcta caggggcact gtcaatacca tttggaatgg 2460 aattccatgt cagcgttggg attctcagta tcctcacgag catgacatga ctcctgaaaa 2520 tttcaagtgc aaggacctac gagaaaatta ctgccgaaat ccagatgggt ctgaatcacc 2580 ctggtgtttt accactgatc caaacatccg agttggctac tgctcccaaa ttccaaactg 2640 tgatatgtca catggacaag attgttatcg tgggaatggc aaaaattata tgggcaactt 2700 atcccaaaca agatctggac taacatgttc aatgtgggac aagaacatgg aagacttaca 2760 tcgtcatatc ttctgggaac cagatgcaag taagctgaat gagaattact gccgaaatcc 2820 agatgatgat gctcatggac cctggtgcta cacgggaaat ccactcattc cttgggatta 2880 ttgccctatt tctcgttgtg aaggtgatac cacacctaca atagtcaatt tagaccatcc 2940 cgtaatatct tgtgccaaaa cgaaacaatt gcgagttgta aatgggattc caacacgaac 3000 aaacatagga tggatggtta gtttgagata cagaaataaa catatctgcg gaggatcatt 3060 gataaaggag agttgggttc ttactgcacg acagtgtttc ccttctcgag acttgaaaga 3120 ttatgaagct tggcttggaa ttcatgatgt ccacggaaga ggagatgaga aatgcaaaca 3180 ggttctcaat gtttcccagc tggtatatgg ccctgaagga tcagatctgg ttttaatgaa 3240 gcttgccagg cctgctgtcc tggatgattt tgttagtacg attgatttac ctaattatgg 3300 atgcacaatt cctgaaaaga ccagttgcag tgtttatggc tggggctaca ctggattgat 3360 caactatgat ggcctattac gagtggcaca tctctatata atgggaaatg agaaatgcag 3420 ccagcatcat cgagggaagg tgactctgaa tgagtctgaa atatgtgctg gggctgaaaa 3480 gattggatca ggaccatgtg agggggatta tggtggccca cttgtttgtg agcaacataa 3540 aatgagaatg gttcttggtg tcattgttcc tggtcgtgga tgtgccattc caaatcgtcc 3600 tggtattttt gtccgagtag catattatgc aaaatggata cacaaaatta ttttaacata 3660 taaggtacca cagtcatag 3679 <210> 5 <211> 2729 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of HGFX8 <400> 5 atgtgggtga ccaaactcct gccagccctg ctgctgcagc atgtcctcct gcatctcctc 60 ctgctcccca tcgccatccc ctatgcagag ggacaaagga aaagaagaaa tacaattcat 120 gaattcaaaa aatcagcaaa gactacccta atcaaaatag atccagcact gaagataaaa 180 accaaaaaag tgaatactgc agaccaatgt gctaatagat gtactaggaa taaaggactt 240 ccattcactt gcaaggcttt tgtttttgat aaagcaagaa aacaatgcct ctggttcccc 300 ttcaatagca tgtcaagtgg agtgaaaaaa gaatttggcc atgaatttga cctctatgaa 360 aacaaagact acattagaaa ctgcatcatc ggtaaaggac gcagctacaa gggaacagta 420 tctatcacta agagtggcat caaatgtcag ccctggagtt ccatgatacc acacgaacac 480 aggtaagaac agtatgaaga aaagagatga agcctctgtc ttttttacat gttaacagtc 540 tcatattagt ccttcagaat aattctacaa tcctaaaata acttagccaa cttgctgaat 600 tgtattacgg caaggtttat atgaattcat gactgatatt tagcaaatga ttaattaata 660 tgttaataaa atgtagccaa aacaatatct taccttaatg cctcaatttg tagatctcgg 720 tatttgtgga tccttatgtt tcagacaact tcgattcagt tctagaatgt ttgactcagc 780 aaattcacag gctcatcttt ctaacttgat ggtgaatatg gaaattcagc taaatggatg 840 ttaataaaat tcaaacgttt taaggacaga tgaaaatgac agaattttaa ggtaaaatat 900 atgaaggaat ataagataaa ggatttttct accttcagca aaaacatacc cactaattag 960 taaaattaat aggcaaaaaa aagttgcatg ctcttatact gtaatgatta tcattttaaa 1020 actagctttt tgccttcgag ctatcggggt aaagacctac aggaaaacta ctgtcgaaat 1080 cctcgagggg aagaaggggg accctggtgt ttcacaagca atccagaggt acgctacgaa 1140 gtctgtgaca ttcctcagtg ttcagaagtt gaatgcatga cctgcaatgg ggagagttat 1200 cgaggtctca tggatcatac agaatcaggc aagatttgtc agcgctggga tcatcagaca 1260 ccacaccggc acaaattctt gcctgaaaga tatcccgaca agggctttga tgataattat 1320 tgccgcaatc ccgatggcca gccgaggcca tggtgctata ctcttgaccc tcacacccgc 1380 tgggagtact gtgcaattaa aacatgcgct gacaatacta tgaatgacac tgatgttcct 1440 ttggaaacaa ctgaatgcat ccaaggtcaa ggagaaggct acaggggcac tgtcaatacc 1500 atttggaatg gaattccatg tcagcgttgg gattctcagt atcctcacga gcatgacatg 1560 actcctgaaa atttcaagtg caaggaccta cgagaaaatt actgccgaaa tccagatggt 1620 ctgaatcacc ctggtgtttt accactgatc caaacatccg agttggctac tgctcccaaa 1680 ttccaaactg tgatatgtca catggacaag attgttatcg tgggaatggc aaaaattata 1740 tgggcaactt atcccaaaca agatctggac taacatgttc aatgtgggac aagaacatgg 1800 aagacttaca tcgtcatatc ttctgggaac cagatgcaag taagctgaat gagaattact 1860 gccgaaatcc agatgatgat gctcatggac cctggtgcta cacgggaaat ccactcattc 1920 cttgggatta ttgccctatt tctcgttgtg aaggtgatac cacacctaca atagtcaatt 1980 tagaccatcc cgtaatatct tgtgccaaaa cgaaacaatt gcgagttgta aatgggattc 2040 caacacgaac aaacatagga tggatggtta gtttgagata cagaaataaa catatctgcg 2100 gaggatcatt gataaaggag agttgggttc ttactgcacg acagtgtttc ccttctcgag 2160 acttgaaaga ttatgaagct tggcttggaa ttcatgatgt ccacggaaga ggagatgaga 2220 aatgcaaaca ggttctcaat gtttcccagc tggtatatgg ccctgaagga tcagatctgg 2280 ttttaatgaa gcttgccagg cctgctgtcc tggatgattt tgttagtacg attgatttac 2340 ctaattatgg atgcacaatt cctgaaaaga ccagttgcag tgtttatggc tggggctaca 2400 ctggattgat caactatgat ggcctattac gagtggcaca tctctatata atgggaaatg 2460 agaaatgcag ccagcatcat cgagggaagg tgactctgaa tgagtctgaa atatgtgctg 2520 gggctgaaaa gattggatca ggaccatgtg agggggatta tggtggccca cttgtttgtg 2580 agcaacataa aatgagaatg gttcttggtg tcattgttcc tggtcgtgga tgtgccattc 2640 caaatcgtcc tggtattttt gtccgagtag catattatgc aaaatggata cacaaaatta 2700 ttttaacata taaggtacca cagtcatag 2729 <210> 6 <211> 2172 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of dHGF (deleted varient of HGF) <400> 6 atgtgggtga ccaaactcct gccagccctg ctgctgcagc atgtcctcct gcatctcctc 60 ctgctcccca tcgccatccc ctatgcagag ggacaaagga aaagaagaaa tacaattcat 120 gaattcaaaa aatcagcaaa gactacccta atcaaaatag atccagcact gaagataaaa 180 accaaaaaag tgaatactgc agaccaatgt gctaatagat gtactaggaa taaaggactt 240 ccattcactt gcaaggcttt tgtttttgat aaagcaagaa aacaatgcct ctggttcccc 300 ttcaatagca tgtcaagtgg agtgaaaaaa gaatttggcc atgaatttga cctctatgaa 360 aacaaagact acattagaaa ctgcatcatc ggtaaaggac gcagctacaa gggaacagta 420 tctatcacta agagtggcat caaatgtcag ccctggagtt ccatgatacc acacgaacac 480 agctatcggg gtaaagacct acaggaaaac tactgtcgaa atcctcgagg ggaagaaggg 540 ggaccctggt gtttcacaag caatccagag gtacgctacg aagtctgtga cattcctcag 600 tgttcagaag ttgaatgcat gacctgcaat ggggagagtt atcgaggtct catggatcat 660 acagaatcag gcaagatttg tcagcgctgg gatcatcaga caccacaccg gcacaaattc 720 ttgcctgaaa gatatcccga caagggcttt gatgataatt attgccgcaa tcccgatggc 780 cagccgaggc catggtgcta tactcttgac cctcacaccc gctgggagta ctgtgcaatt 840 aaaacatgcg ctgacaatac tatgaatgac actgatgttc ctttggaaac aactgaatgc 900 atccaaggtc aaggagaagg ctacaggggc actgtcaata ccatttggaa tggaattcca 960 tgtcagcgtt gggattctca gtatcctcac gagcatgaca tgactcctga aaatttcaag 1020 tgcaaggacc tacgagaaaa ttactgccga aatccagatg ggtctgaatc accctggtgt 1080 tttaccactg atccaaacat ccgagttggc tactgctccc aaattccaaa ctgtgatatg 1140 tcacatggac aagattgtta tcgtgggaat ggcaaaaatt atatgggcaa cttatcccaa 1200 acaagatctg gactaacatg ttcaatgtgg gacaagaaca tggaagactt acatcgtcat 1260 atcttctggg aaccagatgc aagtaagctg aatgagaatt actgccgaaa tccagatgat 1320 gatgctcatg gaccctggtg ctacacggga aatccactca ttccttggga ttattgccct 1380 atttctcgtt gtgaaggtga taccacacct acaatagtca atttagacca tcccgtaata 1440 tcttgtgcca aaacgaaaca attgcgagtt gtaaatggga ttccaacacg aacaaacata 1500 ggatggatgg ttagtttgag atacagaaat aaacatatct gcggaggatc attgataaag 1560 gagagttggg ttcttactgc acgacagtgt ttcccttctc gagacttgaa agattatgaa 1620 gcttggcttg gaattcatga tgtccacgga agaggagatg agaaatgcaa acaggttctc 1680 aatgtttccc agctggtata tggccctgaa ggatcagatc tggttttaat gaagcttgcc 1740 aggcctgctg tcctggatga ttttgttagt acgattgatt tacctaatta tggatgcaca 1800 attcctgaaa agaccagttg cagtgtttat ggctggggct acactggatt gatcaactat 1860 gatggcctat tacgagtggc acatctctat ataatgggaa atgagaaatg cagccagcat 1920 catcgaggga aggtgactct gaatgagtct gaaatatgtg ctggggctga aaagattgga 1980 tcaggaccat gtgaggggga ttatggtggc ccacttgttt gtgagcaaca taaaatgaga 2040 atggttcttg gtgtcattgt tcctggtcgt ggatgtgcca ttccaaatcg tcctggtatt 2100 tttgtccgag tagcatatta tgcaaaatgg atacacaaaa ttattttaac atataaggta 2160 ccacagtcat ag 2172 <210> 7 <211> 477 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of IGF1 <400> 7 atgggaaaaa tcagcagtct tccaacccaa ttatttaagt gctgcttttg tgatttcttg 60 aaggtgaaga tgcacaccat gtcctcctcg catctcttct acctggcgct gtgcctgctc 120 accttcacca gctctgccac ggctggaccg gagacgctct gcggggctga gctggtggat 180 gctcttcagt tcgtgtgtgg agacaggggc ttttatttca acaagcccac agggtatggc 240 tccagcagtc ggagggcgcc tcagacaggc atcgtggatg agtgctgctt ccggagctgt 300 gatctaagga ggctggagat gtattgcgca cccctcaagc ctgccaagtc agctcgctct 360 gtccgtgccc agcgccacac cgacatgccc aagacccaga agtatcagcc cccatctacc 420 aacaagaaca cgaagtctca gagaaggaaa ggaagtacat ttgaagaacg caagtag 477 <210> 8 <211> 576 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of VEGF <400> 8 atgaactttc tgctgtcttg ggtgcattgg agccttgcct tgctgctcta cctccaccat 60 gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120 gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180 atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240 atgcgatgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300 aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg 360 agcttcctac agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420 aatccctgtg ggccttgctc agagcggaga aagcatttgt ttgtacaaga tccgcagacg 480 tgtaaatgtt cctgcaaaaa cacagactcg cgttgcaagg cgaggcagct tgagttaaac 540 gaacgtactt gcagatgtga caagccgagg cggtga 576 <210> 9 <211> 468 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of FGF1 <400> 9 atggctgaag gagaaatcac caccttcaca gccctgacag aaaagtttaa cctgcctcca 60 gggaactaca agaagcccaa actcctctac tgtagcaatg gaggccactt cctgaggatc 120 cttcctgatg gcactgtgga tgggaccagg gacaggtctg accagcacat tcagctgcag 180 ctcagtgctg aatcagtggg agaggtgtac attaagagta cagagactgg ccagtacttg 240 gccatggaca ctgatggact tctgtatggc tcacagacac caaatgagga atgcttgttc 300 ctggaaaggc tggaggagaa ccattacaac acctatatct ccaagaagca tgcagagaag 360 aattggtttg ttggcctcaa gaagaatggg agctgcaaaa gaggtcctag aactcactat 420 ggccagaaag ccatcttgtt tctccccctg ccagtctctt ctgactaa 468 <210> 10 <211> 621 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of FGF4 <400> 10 atgtcggggc ccgggacggc cgcggtagcg ctgctcccgg cggtcctgct ggccttgctg 60 gcgccctggg cgggccgagg gggcgccgcc gcacccactg cacccaacgg cacgctggag 120 gccgagctgg agcgccgctg ggagagcctg gtggcgctct cgttggcgcg cctgccggtg 180 gcagcgcagc ccaaggaggc ggccgtccag agcggcgccg gcgactacct gctgggcatc 240 aagcggctgc ggcggctcta ctgcaacgtg ggcatcggct tccacctcca ggcgctcccc 300 gacggccgca tcggcggcgc gcacgcggac acccgcgaca gcctgctgga gctctcgccc 360 gtggagcggg gcgtggtgag catcttcggc gtggccagcc ggttcttcgt ggccatgagc 420 agcaagggca agctctatgg ctcgcccttc ttcaccgatg agtgcacgtt caaggagatt 480 ctccttccca acaactacaa cgcctacgag tcctacaagt accccggcat gttcatcgcc 540 ctgagcaaga atgggaagac caagaagggg aaccgagtgt cgcccaccat gaaggtcacc 600 cacttcctcc ccaggctgtg a 621 <210> 11 <211> 726 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PDGF B <400> 11 atgaatcgct gctgggcgct cttcctgtct ctctgctgct acctgcgtct ggtcagcgcc 60 gagggggacc ccattcccga ggagctttat gagatgctga gtgaccactc gatccgctcc 120 tttgatgatc tccaacgcct gctgcacgga gaccccggag aggaagatgg ggccgagttg 180 gacctgaaca tgacccgctc ccactctgga ggcgagctgg agagcttggc tcgtggaaga 240 aggagcctgg gttccctgac cattgctgag ccggccatga tcgccgagtg caagacgcgc 300 accgaggtgt tcgagatctc ccggcgcctc atagaccgca ccaacgccaa cttcctggtg 360 tggccgccct gtgtggaggt gcagcgctgc tccggctgct gcaacaaccg caacgtgcag 420 tgccgcccca cccaggtgca gctgcgacct gtccaggtga gaaagatcga gattgtgcgg 480 aagaagccaa tctttaagaa ggccacggtg acgctggaag accacctggc atgcaagtgt 540 gagacagtgg cagctgcacg gcctgtgacc cgaagcccgg ggggttccca ggagcagcga 600 gccaaaacgc cccaaactcg ggtgaccatt cggacggtgc gagtccgccg gccccccaag 660 ggcaagcacc ggaaattcaa gcacacgcat gacaagacgg cactgaagga gacccttgga 720 gcctag 726 <210> 12 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of pGP(F) <400> 12 gacgaattca cgcgtctcga ggcggccgct ctagagggcc cgtttaaa 48 <210> 13 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of pGP(R) <400> 13 gacgaattcg tcgacggatc cgctagcaag cttcgtgtca aggacggt 48

Claims (22)

A composition for increasing the expression of a growth factor gene comprising a core-shell structured microparticle as an active ingredient,
The core is a biocompatible gas, a halogenated hydrocarbon, a sulfur halide, or a mixture thereof, and the shell is composed of a lipid or a derivative thereof,
The growth factor gene may include at least one gene selected from a human hepatocyte growth factor (HGF) gene, a heterologous gene of a human hepatocyte growth factor, and a mutant gene thereof; Or at least one gene selected from the human type 1 insulin-like growth factor-1 (IGF1) gene, the heterologous gene of the human type 1 insulin-like growth factor, and a mutant gene thereof; Composition for increasing gene expression. The method of claim 1,
The biocompatible gas is sulfur hexafluoride, octafluoropropane, bromochlorodifluoromethane, chlorodifluoromethane, dichlorodifluoromethane, bromotrifluoromethane, chlorotrifluoromethane, chloropentafluoro. A composition for increasing growth factor gene expression, characterized in that selected from loethane, dichlorotetrafluoroethane, and mixtures thereof. The method of claim 1,
The halogenated hydrocarbon is a composition for increasing growth factor gene expression, characterized in that the perfluorinated hydrocarbon. The method of claim 3,
The perfluorinated hydrocarbon is perfluoromethane, perfluoroethane, perfluoropropane, perfluorobutane, perfluoropentane, perfluorohexane, perfluoroheptane, perfluoropropene, perfluoro Butene, perfluorobutadiene, perfluorobut-2-yne, perfluorocyclobutane, perfluoromethylcyclobutane, perfluorodimethylcyclobutane, perfluorotrimethylcyclobutane, perfluorocyclopentane, purple Luoromethylcyclopentane, perfluorodimethylcyclopentane, perfluoromethylcyclohexane, perfluoromethylcyclohexane, perfluoromethylcyclohexane or a composition for increasing growth factor gene expression, characterized in that the mixture thereof. The method of claim 1,
The lipid is a composition for increasing growth factor gene expression, characterized in that at least one selected from the group consisting of simple lipids, phospholipids, glycero glycolipids, sphingo glycolipids, cholesterol and cationic lipids. The method of claim 5,
The phospholipids are phosphatidylcholine derivatives, phosphatidylethanolamine derivatives, phosphatidylserine derivatives, diacetylated phospholipids, L-α-dioleyl phosphatidylethanolamine, diolane, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, lysophosphatidylcholine, sphingomyelin , Polyethylene glycolated phospholipid, yolk lecithin, soybean lecithin and hydrogenated phospholipid composition for increasing growth factor gene expression, characterized in that selected from the group consisting of. The method of claim 5,
The glycerol glycolipid is a growth factor, characterized in that selected from the group consisting of sulfoxy ribosyl glyceride, diglycosyl diglyceride, digalactosyl diglyceride, galactosyl diglyceride and glycosyl diglyceride Composition for increasing gene expression. The method of claim 5,
The sphingo glycolipid is a composition for increasing growth factor gene expression, characterized in that galactosyl cerebroside, lactosyl cerebroside, or ganglioside. The method of claim 5,
The cationic lipids are 1,2-dioleoyl-3-trimethylammonio propane (DOTAP), N-(2,3-dioleyyloxy propan-1-yl)-N,N,N-trimethyl ammonium chloride (DOTMA ), 2,3-dioleyyloxy-N-[2-(sperminecarboxyamide) ethyl]-N,N-dimethyl-1-propanaminiumtrifluoroacetic acid (DOSPA), 1,2-dimirri Stilloxy propyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE), 1,2-dioleoyloxy propyl-3-diethyl hydroxyethyl ammonium bromide (DORIE) and 3β-[N-(N'N'-) A composition for increasing growth factor gene expression, characterized in that selected from the group consisting of dimethylaminoethyl) carbamoyl] cholesterol (DC-Chol). The method of claim 1,
The composition is a composition for increasing growth factor gene expression, characterized in that administered together with the expression vector containing the growth factor gene The method of claim 1,
The composition is a composition for increasing growth factor gene expression, characterized in that delivered into the muscle. The method of claim 1,
The composition is a composition for increasing growth factor gene expression, characterized in that for intramuscular administration. The method of claim 1,
The composition is a composition for increasing growth factor gene expression, characterized in that to increase the expression level of the growth factor gene by 30% or more. The composition of claim 1; And at least one gene selected from the human hepatocyte growth factor (HGF) gene, the heterologous gene of the human hepatocyte growth factor, and the mutant gene thereof; containing ischemic disease, neurological disease, kidney disease, or liver disease prevention Or a pharmaceutical composition for treatment. The method of claim 14,
The human hepatocyte growth factor gene, the human hepatocyte growth factor heterologous gene, or a mutant gene thereof is contained in an expression vector for intramuscular delivery, for preventing or treating ischemic diseases, neurological diseases, kidney diseases, or liver diseases. Pharmaceutical composition for use. The method of claim 14,
The human hepatocyte growth factor gene is a pharmaceutical composition for the prevention or treatment of ischemic disease, neurological disease, kidney disease or liver disease, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 2. The method of claim 14,
The mutant gene of the human hepatocyte growth factor is a pharmaceutical composition for the prevention or treatment of ischemic disease, neurological disease, kidney disease or liver disease, characterized in that consisting of any one selected from the nucleotide sequence of SEQ ID NO: 3 to 6. The composition of claim 1; And one or more genes selected from the human type 1 insulin-like growth factor-1 (IGF1) gene, the heterologous gene of the human type 1 insulin-like growth factor, and the mutant gene thereof; containing, IGF1 receptor binding A pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by. The method of claim 18,
Symptoms mediated by IGF1 receptor binding, characterized in that the human type 1 insulin-like growth factor gene, the human type 1 insulin-like growth factor heterologous gene, and a mutant gene thereof are contained in an expression vector for intramuscular delivery, or Pharmaceutical composition for the prevention or treatment of diseases. The method of claim 18,
The human type 1 insulin-like growth factor gene is a pharmaceutical composition for the prevention or treatment of symptoms or diseases mediated by IGF1 receptor binding, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 7. The method of claim 18,
The symptoms or diseases are short stature, obesity, weight loss, cachexia, loss of appetite, neurodegenerative disorder, fibrosis-related symptoms, cartilage disorder, bone disease, inflammatory disorder, intestinal disorder, insulin resistance, diabetes, diabetic ketoacidosis, Robson -Mendenhal syndrome (Rabson-Mendenhall syndrome), retinopathy, acromegaly (acromegaly), fibromuscular hyperplasia (fibromuscular hyperplasia) and a pharmaceutical composition, characterized in that one selected from the group consisting of heart disorders. The method of claim 21,
The individual requiring treatment for short stature is a human pediatric individual with insulin-like growth factor-1 deficiency (IGFD),
The composition is a pharmaceutical composition, characterized in that effective for the treatment of IGFD in a human pediatric individual.

Images