KR20210035030A - Novel peptide derivatives having melanin production inhibitory activity, pharmaceutically acceptable salts thereof, and composition for inhibiting melanin production comprising the same - Google Patents

Abstract

The present invention relates to a novel peptide derivative having a melanin production inhibitory activity by combining coumaric acid or caffeic acid to a peptide. In addition, provided is a composition for inhibiting melanin production, comprising the peptide derivative and a pharmaceutically acceptable salt thereof as an active ingredient. The peptide derivative or the pharmaceutically acceptable salt thereof is represented by chemical formula 1.

Description

Novel peptide derivatives having melanin production inhibitory activity, pharmaceutically acceptable salts thereof, and composition for inhibiting melanin production comprising the same}

The present invention relates to a novel peptide derivative having melanogenesis inhibitory activity, a pharmaceutically acceptable salt thereof, and a composition for inhibiting melanogenesis comprising the same as an active ingredient.

When the skin is damaged by external ultraviolet rays, the vascular growth factors in the dermis react actively and interact with the melanocytes of the skin epidermis to produce melanin pigment. Such melanin plays a role in protecting the human body, but can promote skin aging such as bleaching of the face, freckles, and hyperpigmentation when over-produced, and may be involved in skin cancer induction. For this reason, various studies have been conducted to inhibit the overproduction of melanin.

Currently, at the Korean Ministry of Food and Drug Safety, Japanese oak extract, arbutin, ethyl ascorbyl ether, oil-soluble licorice extract, ascorbyl glucoside, magnesium ascorbyl phosphate, niacinamide Nine types of niacinamide), alpha-bisabolol, and ascorbyl tetraisopalmitate are designated as whitening notices, and other substances for whitening are being developed. However, the use of such ingredients is limited because they can decompose in cosmetic formulations or cause coloration and odor.

In the process of melanogenesis in the body, melanogenesis stimulating hormone (α-MSH) is secreted by external stimulation, and the secreted melanogenesis stimulating hormone binds to the MC1 receptor (protein kinase A). ) After activation, phosphorylation of CREB (cAMP responsive element binding protein) to increase MITF (microphthalmia transcription factor) expression, forming tyrosinase. The active site of the tyrosinase formed in this way contains a space where two copper metal atoms and tyrosine can be located, and tyrosine is continuously oxidized in melanosomes in melanocytes. Produces eggplant melanin (eumelanin, pheomelanin).

Methods for inhibiting melanin formation can be divided into inhibition of tyrosinase function and inhibition of tyrosinase production, and currently widely used tyrosinase inhibitors include ascorbic acid and its derivatives, kojic acid. , Arbutin and the like are known. Recently, as substances that inhibit the production of tyrosinase, substances that act as antagonists to the MC1 receptor or target CREB and MITF have been developed.

As substances that act as antagonists to the MC1 receptor, peptides that mimic α-MSH (Melanostatin ^TM 5, Dermostatyl ^TM ) and agouti signaling protein (ASP) are known. Lys-Val-Ala-Arg from 131 agouti signaling peptides -Pro (KVARP) sequence is known to have a whitening improvement effect.

The inventors of the present invention link a peptide substance that exhibits efficacy by binding to tyrosinase function inhibitory substances coumarin acid or caffeic acid and MC1R with linkers (mini-PEG and Gly-Gly-Gly), Synthesis and efficacy evaluation of the new whitening compound was conducted. Such a compound can predict two target inhibitory effects of inhibiting the production and function of tyrosinase, and the use of a linker exhibiting hydrophilic properties improves the overall physical properties of the compound. In addition, as a result of comparing the activity with the arbutin compound, the present invention was completed by showing low toxicity and very excellent melanin inhibitory ability.

Korean Patent Registration No. 10-1343752

The present invention provides a novel peptide derivative having low toxicity and melanin production inhibitory activity at a low concentration by binding tyrosinase function inhibitory substance coumarin acid or caffeic acid to a peptide that inhibits the production and function of tyrosinase. The purpose.

In addition, it is an object of the present invention to provide a composition for inhibiting melanogenesis comprising the peptide derivative and a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a peptide derivative having melanin production inhibitory activity or a pharmaceutically acceptable salt thereof represented by the following formula (1).

[Formula 1]

{In Formula 1,

X ₁ and X ₂ are each independently H or OH,

Y is a linking group represented by the following formula A or formula B,

<Formula A> <Formula B>

,

,

Z is glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), histidine (His), lysine (Lys), arginine (Arg), serine (Ser), cysteine (Cys), alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), valine (Val), threonine (Thr), methionine (Met), proline (Pro), phenylalanine (Phe), tyrosine (Tyr) ) And tryptophan (Trp) is a peptide consisting of 1 to 10 amino acids selected from the group consisting of.}

The present invention provides a compound in Formula 1 wherein X ₁ is H or OH, and X ₂ is OH.

인 화합물을 제공한다.In addition, in the present invention, Y in Formula 1 is

Phosphorus compounds are provided.

인 화합물을 제공한다.In another embodiment, in the formula 1, Y is

Phosphorus compounds are provided.

In addition, the present invention preferably provides that in Formula 1, Z is composed of at least 2 to 7 amino acids, most preferably 2 to 5 amino acids.

In addition, the present invention provides a compound represented by any one of Formula 1 below Formula 2 to Formula 4.

[Formula 2]

[Formula 3]

[Formula 4]

{In Formulas 2 to 4, Z is the same as defined in Formula 1.}

The present invention provides a compound comprising the Ala-Arg-Pro sequence in Formula 4 where Z is.

In addition, in another aspect, the present invention provides a composition for inhibiting melanogenesis, comprising the peptide derivative represented by Formula 1 and a pharmaceutically acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a composition for skin whitening by inhibiting melanin production.

The peptide derivative to which coumarin acid or caffeic acid is bound according to the present invention is not toxic to skin irritation, and can be very useful in industrial fields such as pharmaceutical and cosmetic compositions as it improves the whitening improvement effect at a low concentration. .

1 shows the LC-Mass analysis result of the I-1 compound according to an embodiment of the present invention.
2 shows the results of HPLC analysis of the I-1 compound according to an embodiment of the present invention.
3 shows the results of cytotoxicity analysis of compounds I-1 to I-9 according to an embodiment of the present invention.
Figure 4 shows the analysis results for the melanin production inhibitory effect of the compounds I-2, I-6, I-8 and I-9 according to an embodiment of the present invention.
Figure 5 shows the analysis results of the tyrosinase activity inhibitory effect of the compounds I-2, I-6, I-8 and I-9 according to an embodiment of the present invention.
6 shows the results of analysis of TYR, MITF, TYRP1 and TYRP2 expressions of compounds I-2, I-6, I-8, and I-9 according to an embodiment of the present invention.

Hereinafter, it will be described in detail with reference to an embodiment of the present invention. In describing the present invention, if it is determined that a detailed description of a related known configuration or function may obscure the subject matter of the present invention, a detailed description thereof will be omitted. However, the following examples are for illustrative purposes only, and the present invention is not limited by the following examples.

The present invention provides a peptide derivative having melanin production inhibitory activity represented by the following formula (1) and a pharmaceutically acceptable salt thereof.

[Formula 1]

{In Formula 1,

X ₁ and X ₂ are each independently H or OH,

Y is a linking group represented by the following formula A or formula B,

<Formula A> <Formula B>

,

,

Z is glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), histidine (His), lysine (Lys), arginine (Arg), serine (Ser), cysteine (Cys), alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), valine (Val), threonine (Thr), methionine (Met), proline (Pro), phenylalanine (Phe), tyrosine (Tyr) ) And tryptophan (Trp) is a peptide consisting of 1 to 10 amino acids selected from the group consisting of.}

In Formula 1, X ₁ is H or OH, and X ₂ is preferably OH. At this time, the _{peptide derivative in which X 1} is H and X ₂ is OH is a compound obtained by conjugating coumarin acid to the peptide, and the _{peptide derivatives in which X 1 and X 2} are OH add caffeic acid to the peptide. It is a combined compound.

Coumaric acid is a natural ingredient widely distributed in the plant world, and has the effect of inhibiting melanin production in human melanocytes and reducing the cytotoxicity of ultraviolet rays. In addition, coumaric acid has a tyrosinase inhibitory effect that is about 100 times stronger than that of arbutin or kojic acid, which are known whitening substances, and is structurally very similar to tyrosine, a substrate of tyrosinase, effectively blocking access to the substrate.

Caffeic acid is reported as a whitening active ingredient in plants, and has excellent antioxidant and anti-inflammatory effects.

On the other hand, coumaric acid and caffeic acid have tyrosinase inhibitory activity, but these phytochemicals are less stable in solution, and over time, they are browned due to oxidation by light and heat, and the temperature increases or oxygen saturation is high. The speed of browning the ground increases. As such, the efficacy can be increased by stabilizing coumaric acid and caffeic acid, which are natural biomaterials with low solubility, unstable and toxic in aqueous solution, using peptides with excellent physiological activity, and coumaric acid and caffeic acid are naturally derived substances. Accordingly, the biocompatibility is high, the stability of the peptide can be improved in vivo, and the peptide can be decomposed and exhibited activity, thereby providing an effect continuously.

또는

인 것이 바람직하며, 쿠마린산 또는 카페익산을 펩타이드와 연결시켜주는 링커 역할을 한다. 링커는 Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) 또는 Fmoc-glycyl-glycyl-glycine (Fmoc-GGG)를 사용하는 것이 바람직하며, 링커로 쿠마린산 또는 카페익산을 펩타이드와 결합시킴으로써 안정성 향상 및 화합물의 전체적인 물성을 개선시킬 수 있다.Y is

or

It is preferred to be, and serves as a linker connecting coumarin acid or caffeic acid to the peptide. It is preferable to use Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) or Fmoc-glycyl-glycyl-glycine (Fmoc-GGG) as a linker, and coumarin acid or caffeic acid as a linker is used as a peptide. By combining with, it is possible to improve stability and improve the overall physical properties of the compound.

In Formula 1, Z is preferably composed of at least 2 to 7 amino acids, and most preferably 2 to 5 amino acids.

Formula 1 may be represented by any one of Formulas 2 to 4 below.

[Formula 2]

[Formula 3]

[Formula 4]

{In Formulas 2 to 4, Z is the same as defined in Formula 1.}

In Formula 4, Z preferably includes an Ala-Arg-Pro sequence.

In addition, in another aspect, the present invention provides a composition for inhibiting melanogenesis, comprising the peptide derivative represented by Formula 1 and a pharmaceutically acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a composition for skin whitening by inhibiting melanin production.

Hereinafter, synthesis examples of the compound represented by Formula 1 of the present invention and examples thereof will be described in detail, but the present invention is not limited to the following examples.

[Synthesis Example]

In the examples according to the present invention, the peptide was synthesized using solid phase peptide synthesis (SPPS). After combining Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) or Fmoc-glycyl-glycyl-glycine (Fmoc-GGG) that acts as a linker to the synthesized peptide, coumarin acid or caffeic acid and The compound represented by Chemical Formula 1 was prepared by carrying out the coupling reaction of.

Scheme 1 below shows the reaction route of the peptide derivative I-1 compound to which coumarin acid is bound according to the synthesis example of the present invention.

<Reaction Scheme 1>

I-1 synthesis example

1) Synthesis example of I-1-1 (peptide)

The preparation of the peptide was carried out in 4 steps of loading of amino acids into the resin-removal of the Fmoc protecting group-coupling reaction of amino acids-the kaiser test.

First, 2-Chlorotrityl chloride resin (1.1 mmol/g, Novabiochem®) 454 mg (500 μmol) was swelled with Dichloromethane (DCE), followed by amino acid (3 equivalents) and N,N-Diisopropylethylamine (DIPEA, 6). Equivalent) was added and reacted for 4 hours. After that, in order to remove 9-Fluorenylmethoxycarbonyl (Fmoc) of the amino acid N-term, DMF diluted with 20% piperidine was added and the process of stirring for 5 minutes was repeated twice. Then, 1-hydroxybenzotriazole (HOBt, 3 equivalents), N,N,N′,N′ -Tetramethyl- O- (1 H -benzotriazol-1-yl)uranium hexafluorophosphate ( HBTU, 3 equivalents), N,N -Diisopropylethylamine (DIPEA, 6 equivalents) and the coupling reaction with amino acids for 4 hours was carried out. Whether the reaction proceeds was confirmed by adding three Kaiser test solutions to the resin and then applying heat at 120° C. for 3 minutes. At this time, when the color of the resin was blue, the coupling reaction was performed again, and when there was no change in the color of the resin, the next reaction was performed. The coupling reaction was repeated to synthesize a peptide (I-1-1) having a desired sequence.

2) I-1-2 Synthesis Example

Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) was used as a linker connecting coumarin acid to the peptide. According to a known method ( Bioorg. Med. Chem. Lett. 1995 , 5(6), 573 ), Fmoc-mini-PEG activated in the reactor containing I-1-1 [Fmoc-mini-PEG ( 2 equivalents), HOBt (2 equivalents), HBTU (2 equivalents), DIPEA (6 equivalents)] were added and then reacted at room temperature for 8 hours to proceed with a coupling reaction to synthesize I-1-2. The reaction was confirmed by Kaiser test.

3) I-1-3 Synthesis Example

Benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (PyBOP) was used as a coupling reagent to bind coumarin acid.

2 equivalents of coumarin acid, 2 equivalents of PyBOP, 2 equivalents of HOBt, and 4 equivalents of DIPEA were added to the I-1-2 (mini-PEG-peptide-resin from which the Fmoc protecting group was removed), and reacted at room temperature for 16 hours. As a result, I-1-3 was synthesized. The reaction was confirmed by Kaiser test.

4) I-1 Synthesis Example

Cleavage cocktail solution was added to I-1-3 to remove resin and protecting groups, and as a result, I-1 was synthesized. Trifluoroacetic acid (TFA): Triisopropylsilane (TIS): Thioanisole: H ₂ O = 90:3:3:3 (v/v/v/v) solution was used as the cleavage cocktail solution, but this is changed according to the type of amino acid. Can be. The LC-Mass and HPLC analysis results of the synthesized I-1 compound are shown in FIGS. 1 and 2.

Peptide derivatives (I-1 to I-9) conjugated to coumarin acid or caffeic acid were prepared according to the above synthesis method, and prep. Purified using HPLC. The molecular weight and purity of I-1 to I-9 were determined by LC-Mass and anal. It was confirmed using HPLC (High Performance Liquid Chromatography), and the results are shown in Table 1 below.

No. X _One X ₂ Y Z theory
Molecular Weight Experiment
Molecular Weight I-1 H OH mini-PEG ARP 633.7 634.7 I-2 OH OH mini-PEG ARP 649.7 650.7 I-3 H OH mini-PEG FWY 805.9 806.7 I-4 OH OH mini-PEG FWY 821.9 822.7 I-5 H OH mini-PEG PS 493.5 494.4 I-6 OH OH mini-PEG PS 509.5 510.4 I-7 H OH mini-PEG VARP 732.8 733.9 I-8 H OH mini-PEG KVARP 861.1 862.2 I-9 H OH GGG ARP 659.7 660.7

Example 1. Evaluation of toxicity in human melanogenic cells

The toxicity of I-1 to I-9 in human melanogenic cells was confirmed. Human melanoma cells (SK-MEL-2) were purchased from the Korea Cell Line Bank, and the cell culture medium was 10% fetal bovine serum (FBS, Corning®, USA) in RPMI 1640 (Corning®, USA) medium, 10% penicillin (100 unit/mL) and streptomycin (100 g/mL) were added and used. Cell culture was carried out in an incubator at 37° C., 95% humidity, and 5% CO ₂ , and human melanin-producing cells of passage 12 to 16 were used in the experiment.

In order to check the cytotoxicity, the I-1 to I-9 dissolved in tertiary distilled water were treated at concentrations of 1, 10, 100 and 1000 μM, and then cultured for 72 hours. Cell viability was measured using the CCK-8 assay method, and the results are shown in Tables 2 and 3 below. As shown in Table 2 below, as it was shown to affect the growth of human melanogenic cells at a high concentration (1000 μM), an efficacy evaluation experiment for skin whitening was conducted at a concentration of 1000 uM or less.

No. Cell viability (%) 1 μM 10 μM 100 μM 1000 μM I-1 101.12 102.57 100.62 99.78 I-2 102.29 96.73 95.17 90.81 I-3 100.29 100.22 104.22 94.58 I-4 101.42 100.51 99.19 90.33 I-5 101.68 101.09 100.48 100.41 I-6 102.37 100.31 95.45 94.82 I-7 98.54 96.55 94.34 90.76 I-8 98.51 98.51 96.86 90.07 I-9 100.89 97.95 99.75 95.70

Example 2. Test of melanin inhibitory effect of human melanogenic cells

Human melanin producing cells (SK-MEL-2) were treated with I-2, I-6, I-8 and I-9 at each concentration, and then the melanin production inhibitory effect was measured. After dispensing 1 mL of SK-MEL-2 cells into a 24-well plate at a concentration of 2×10 ⁴ cells/well, they were cultured for 24 hours at _{37° C., 95% humidity, and 5% CO 2 incubator conditions.} After incubation, 100 nM α-MSH (Melanocyte stimulating hormone) and peptide derivatives (I-2, I-6, I-8, and I-9) were each treated at a concentration of 50 mg/L, followed by incubation for 72 hours. Arbutin was used as a positive control.

After culturing the cells for 72 hours, SK-MEL-2 cells were placed in a 1.5 mL tube, collected with Trypsin EDTA 0.25% solution (Corning®, USA), and washed twice with PBS. The centrifuged cells were resuspended in 500 μL of 1 N NaOH (10% DMSO) and then re-cultivated at 80° C. for 1 hour. 100 μL of the culture solution was dispensed into a 96-well plate, and the absorbance of the melanin pigment generated in the cells was measured at 405 nm, and the results are shown in Table 3 and FIG. 4 below.

Among the nine peptide derivatives in Table 1, the compounds whose melanin content decreases at 10 or 100 μM treatment concentration were I-2, I-6, I-8, and I-9 when compared with arbutin, which is a positive control group. Thus, as a result of testing the melanin inhibitory effect on the four peptide derivatives (I-2, I-6, I-8, and I-9), as shown in Table 3 below, similar to arbutin, a raw material for whitening notice As it shows the effect, it can be seen that it can be used for skin whitening.

Treatment material Treatment concentration (μM) Melanin content (%) Control - 100 α-MSH 0.1 156.3 α-MSH
+ Arbutin 10 92.7 100 75.4 I-2 10 76.2 100 69.8 I-6 10 77.6 100 66.4 I-8 10 78.1 100 71.2 I-9 10 79.6 100 63.0

Example 3. Tyrosinase (Tyrosinase) activity reduction test

Human melanin-producing cells (SK-MEL-2) were treated with peptide derivatives (I-2, I-6, I-8, and I-9) by concentration, and then the effect of inhibiting the production of tyrosinase was measured. 100 μL of SK-MEL-2 cells were dispensed into 96-well plates at a concentration of 5×10 ³ cells/well, and cultured for 24 hours at _{37° C., 95% humidity, and 5% CO 2.} The cultured cells were cultured for 72 hours after treatment with 100 nM α-MSH (Melanocyte stimulating hormone) and peptide derivatives (I-2, I-6, I-8 and I-9) at a concentration of 50 mg/L I did. Arbutin was used as a positive control. The inhibitory effect of tyrosinase production in the cultured human melanin-producing cells was measured using a Tyrosinase inhibitor screening kit (Biovision_#K575-100), and the results are shown in Table 4 and FIG. 5 below.

As a result of confirming the tyrosinase activity reducing effect for the four peptide derivatives (I-2, I-6, I-8 and I-9) showing the melanin inhibitory effect in Example 2, as shown in Table 4 below. , As a result of confirming the effect of reducing tyrosinase activity, the I-9 compound had a better tyrosinase inhibition rate than the positive control arbutin at 10 and 100 μM treatment concentrations. From the above results, it can be confirmed that the inhibitory effect of the I-9 compound on the production of melanin was greatly influenced by the decrease in tyrosinase activity in terms of the activation mechanism.

Treatment material Treatment concentration (μM) Tyrosinase inhibition rate (%) Control - 100 α-MSH 0.2 -218.7 α-MSH
+ Arbutin 10 -164.6 100 -84.0 I-2 10 -46.4 100 38.1 I-6 10 -46.2 100 0.1 I-8 10 -132.1 100 -96.5 I-9 10 43.7 100 73.2

Example 4. TYR, MITF, TYRP1 and TYRP 2 expression test

When treated with α-MSH (Melanocyte stimulating hormone) in human melanocytes, Tyrosinase, MITF (Microphthalmia-associated transcription factor), TYRP-1 (Tyrosinase-related protein 1), and TYRP-2 ( Changes in mRNA expression of TYR, MITF, TYRP1 and TYRP2, genes expressing tyrosinase-related protein 2) were measured.

In order to confirm the level of mRNA expression of TYR, MITF, TYRP1 and TYRP2 by the peptide derivative, the peptide derivative was treated with a concentration of 10 or 100 μM in human melanogenic cells (SK-MEL-2) and cultured for 48 hours. Gene expression changes were measured by qRT-PCR (quantitative real-time PCR), which continuously detects fluorescent substances after binding a fluorescent substance to a DNA product amplified in a polymerase chain reaction (PCR). To quantify the change in mRNA expression, total RNA was isolated from human melanogenic cells cultured after peptide treatment (AccuPrep® RNA Extraction Kit, Bioneer Corp., Korea), and then 1 μg of total RNA was used with oligo (dT) primer. CDNA was synthesized from RNA (RocketScript ^TM Reverse Transcriptase Kit, Bioneer Corp., Korea).

qRT-PCR was performed using ExcelTaq 2X Q-PCR Master Mix (SMOBIO, Hsinchu, Taiwan) and CFX96 ^TM Real-Time System (Biorad, USA). After denaturation), a total of 40 cycles were performed for denaturation, annealing, and polymerization at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, respectively. The fluorescence intensity was measured. The experimental results were verified with a melting curve, and after normalizing the threshold cycle (Ct) value of each gene to the Ct value of GAPDH, an internal standard, the amount of change in the Ct value was compared and analyzed. The primer sequences used in the experiment are shown in Table 5 below.

Gene　Name Forward 　 Primer Reverse 　 Primer TYR TGCCCCAGAGAAGGACAAAT GTGCTGACCTCCCATGTACT MITF TGAGCATGGAAGAGACGGAG TCCAAGGAAGTCACAGGCAT TYRP-1 ATGGCAGAGATGATCGGGAG GAGCTTCAACTCCAACCCTT TYRP-2 AGTACGACAGAGACAAGGAAAGT ACGGTCATCCTGGTTTCGTA GAPDH GAGTCAACGGATTTGGTCGT GATCTCGCTCCTGGAAGATG

Tables 6 and 6 below show the results of measuring the mRNA expression levels of the four genes (TYR, MITF, TYRP1, TYRP2) according to Example 4. Among the peptide derivatives, the I-9 compound showed a gene reduction result correlated with the melanin inhibition and tyrosinase activity test results at 10 μM treatment concentration.

Treatment material Treatment concentration (μM) TYR
Expression level MITF
Expression level TYRP1
Expression level TYRP2
Expression level Arbutin 0 1.00 1.00 1.00 1.00 10 1.69 0.26 0.29 0.33 100 0.88 0.38 0.50 0.77 Ⅰ-2 0 1.00 1.00 1.00 1.00 10 2.35 0.65 0.85 1.31 100 0.31 0.09 0.01 0.22 Ⅰ-6 0 1.00 1.00 1.00 1.00 10 0.71 0.25 0.37 0.67 100 3.90 0.52 1.57 2.18 Ⅰ-8 0 1.00 1.00 1.00 1.00 10 0.57 0.25 0.14 0.35 100 0.24 0.04 0.09 0.13 Ⅰ-9 0 1.00 1.00 1.00 1.00 10 0.36 0.01 0.12 0.21 100 1.65 0.48 1.67 3.13

Taken together, based on the results of the above example, it is determined that the I-9 compound inhibits tyrosinase activity and expression of four genes, thereby inhibiting the final melanin production, and such a peptide material helps skin whitening. Juju is expected to be used in products related to skin beauty.

As described above, the present invention has been exemplarily described, and various modifications may be made without departing from the essential characteristics of the present invention to those of ordinary skill in the art. Accordingly, the embodiments disclosed in the present specification are not intended to limit the present invention, but to explain the present invention, and the spirit and scope of the present invention are not limited by these embodiments. The scope of protection of the present invention should be interpreted by the claims below, and all technologies within the scope equivalent thereto should be construed as being included in the scope of the present invention.

Claims (11)

A peptide derivative having melanin production inhibitory activity or a pharmaceutically acceptable salt thereof, characterized by represented by the following formula (1).
[Formula 1]

{In Formula 1,
X ₁ and X ₂ are each independently H or OH,
Y is a linking group represented by the following formula A or formula B,
<Formula A><FormulaB>

,

Z is glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), histidine (His), lysine (Lys), arginine (Arg), serine (Ser), cysteine (Cys), alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), valine (Val), threonine (Thr), methionine (Met), proline (Pro), phenylalanine (Phe), tyrosine (Tyr) ) And tryptophan (Trp) is a peptide consisting of 1 to 10 amino acids selected from the group consisting of.}
The method of claim 1, wherein in Formula 1, X ₁ is H or OH, and X ₂ is OH, a peptide derivative or a pharmaceutically acceptable salt thereof.
The method of claim 2, wherein Y in Formula 1 is

Phosphorus peptide derivatives or pharmaceutically acceptable salts thereof.
The method of claim 1, wherein Y in Formula 1 is

Phosphorus peptide derivatives or pharmaceutically acceptable salts thereof.
The peptide derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein the formula (1) is represented by the following formula (2).
[Formula 2]

The peptide derivative or a pharmaceutically acceptable salt thereof according to claim 1, wherein the formula (1) is represented by the following formula (3).
[Formula 3]

The peptide derivative having melanin production inhibitory activity and a pharmaceutically acceptable salt thereof according to claim 1, wherein the formula (1) is represented by the following formula (4).
[Formula 4]

According to claim 1, wherein Z in Formula 1 is a peptide derivative or a pharmaceutically acceptable salt thereof, characterized in that consisting of 2 to 7 kinds of amino acids.
The peptide derivative or a pharmaceutically acceptable salt thereof according to claim 7, wherein Z in Chemical Formula 4 comprises an Ala-Arg-Pro sequence.
A composition comprising the peptide derivative according to claim 1 or a pharmaceutically acceptable salt thereof.
The composition of claim 10, wherein the composition is for skin whitening.

Images