KR102116944B1 - Novel peptide derivatives having melanin production inhibitory activity, pharmaceutically acceptable salts thereof, and composition for inhibiting melanin production comprising the same - Google Patents

Abstract

The present invention relates to a novel peptide derivative having a melanin production inhibitory activity by combining coumaric acid or caffeic acid to a peptide. In addition, provided is a composition for inhibiting melanin production comprising the peptide derivative and a pharmaceutically acceptable salt thereof as an active ingredient.

Description

Novel peptide derivatives having melanin production inhibitory activity, pharmaceutically acceptable salts thereof, and composition for inhibiting melanin production comprising the same}

The present invention relates to a novel peptide derivative having a melanin production inhibitory activity, a pharmaceutically acceptable salt thereof and a composition for inhibiting melanin production comprising the same as an active ingredient.

When the skin is damaged by external ultraviolet rays, vascular growth factors in the dermis actively react, and interact with melanocytes of the skin epidermis to produce melanin pigment. Such melanin serves to protect the human body, but when it is excessively produced, it may promote skin aging such as discoloration of the face, freckles, and hyperpigmentation, and may be involved in causing skin cancer. Due to this, various studies have been conducted to suppress melanin overproduction.

Currently, in the Ministry of Food and Drug Safety, mulberry extract, arbutin, ethyl ascorbyl ether, oil-soluble licorice extract, ascorbyl glucoside, magnesium ascorbyl phosphate, niacinamide ( Nine types of niacinamide, alpha-bisabolol, and ascorbyl tetraisopalmitate are designated as whitening agents, and various materials for whitening have been developed. However, the use of these components is limited because they can decompose in cosmetic formulations and cause coloring and odor.

In the process of melanin formation in the body, melanin-producing stimulating hormone (α-MSH) is secreted by external stimulation, and secreted melanin-producing stimulating hormone binds to the MC1 receptor (melanocortin 1 receptor), and protein kinase A (PKA) After activating), phosphorylation of CREB (cAMP responsive element binding protein) is increased to increase the expression of microphthalmia transcription factor (MITF), thereby forming tyrosinase. The active site of the tyrosinase thus formed contains a space in which two copper metal atoms and tyrosine can be located, and the tyrosine is continuously oxidized in melanocytes in melanocytes. Produces melanin (eumelanin, pheomelanin) of eggplant.

Methods for inhibiting melanin formation can be divided into tyrosinase function inhibition and tyrosinase production inhibition, and currently used tyrosinase inhibitors are ascorbic acid and its derivatives, kojic acid. , Arbutin and the like are known. Recently, substances that inhibit tyrosinase production and act as antagonists of the MC1 receptor or target CREB and MITF are being developed.

As a substance acting as an antagonist to the MC1 receptor, peptides (Melanostatin ^TM 5, Dermostatyl ^TM ) and agouti signaling protein (ASP) that mimic α-MSH are known, and Lys-Val-Ala-Arg in 131 agouti signaling peptides -Pro (KVARP) sequence is known to have a whitening effect.

The present inventors linked to tyrosinase function inhibitory substances coumaric acid or caffeic acid and MC1R, and linked peptide substances showing efficacy with linkers (mini-PEG and Gly-Gly-Gly), Synthesis and efficacy evaluation of new whitening compounds were conducted. These compounds can predict two target inhibitory effects that inhibit tyrosinase production and function, and improve the physical properties of the entire compound by using a linker that exhibits hydrophilic characteristics. In addition, as a result of comparing the activity with the arbutin compound, the present invention was completed by exhibiting low toxicity and very good melanin inhibition ability.

Korean Registered Patent No. 10-1343752

The present invention provides a novel peptide derivative having low toxicity and low melanin production inhibitory activity at low concentrations by binding tyrosinase function-inhibiting substance coumarin acid or caffeic acid to a peptide that inhibits the production and function of tyrosinase. The purpose.

In addition, an object of the present invention is to provide a composition for inhibiting melanin production comprising the peptide derivative and a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a peptide derivative having a melanin production inhibitory activity, represented by the following Chemical Formula 1, or a pharmaceutically acceptable salt thereof.

[Formula 1]

{In the above formula 1,

X ₁ and X ₂ are each independently H or OH,

Y is a linkage group of the formula A or formula B represented by the following structure,

<Formula A> <Formula B>

,

,

Z is glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), histidine (His), lysine (Lys), arginine (Arg), serine (Ser), cysteine (Cys), alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), valine (Val), threonine (Thr), methionine (Met), proline (Pro), phenylalanine (Phe), tyrosine (Tyr) ) And tryptophan (Trp) is a peptide consisting of 1 to 10 amino acids selected from the group.}

In Formula 1, Z is preferably at least 2 to 7 amino acids, and most preferably 2 to 5 amino acids.

The Chemical Formula 1 is characterized by being represented by any one of the following Chemical Formulas 2 to 4.

[Formula 2]

[Formula 3]

[Formula 4]

{In the formulas 2 to 4, Z is the same as the definition in claim 1.}

In the present invention, Z in Chemical Formula 4 provides a compound comprising an Ala-Arg-Pro sequence.

In addition, in another aspect, the present invention provides a composition for inhibiting melanin production, comprising the peptide derivative represented by Formula 1 and a pharmaceutically acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a composition for skin whitening by inhibiting melanin production.

The peptide derivative combined with coumarin acid or caffeic acid according to the present invention is not toxic to skin irritation and can be very useful in industrial fields such as pharmaceutical and cosmetic compositions as it improves the effect of improving whitening at low concentrations. .

1 shows an LC-Mass analysis result of an I-1 compound according to an embodiment of the present invention.
Figure 2 shows the HPLC analysis results of the I-1 compound according to an embodiment of the present invention.
Figure 3 shows the results of cytotoxicity analysis of the I-1 to I-9 compounds according to an embodiment of the present invention.
Figure 4 shows the analysis results for the melanin production inhibitory effect of the I-2, I-6, I-8 and I-9 compounds according to an embodiment of the present invention.
Figure 5 shows the analysis results for the inhibitory effect of tyrosinase activity of the I-2, I-6, I-8 and I-9 compounds according to an embodiment of the present invention.
Figure 6 shows the results of TYR, MITF, TYRP1 and TYRP2 expression analysis of the I-2, I-6, I-8 and I-9 compounds according to an embodiment of the present invention.

Hereinafter, with reference to the embodiment of the present invention will be described in detail. In describing the present invention, when it is determined that detailed descriptions of related known configurations or functions may obscure the subject matter of the present invention, detailed descriptions thereof will be omitted. However, the following examples are only for illustrating the present invention, and the present invention is not limited by the following examples.

The present invention provides a peptide derivative having a melanin production inhibitory activity represented by Formula 1 below and a pharmaceutically acceptable salt thereof.

[Formula 1]

{In the above formula 1,

X ₁ and X ₂ are each independently H or OH,

Y is a linking group of the formula A or B represented by the following structure,

,

,

Z is glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), histidine (His), lysine (Lys), arginine (Arg), serine (Ser), cysteine (Cys), alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), valine (Val), threonine (Thr), methionine (Met), proline (Pro), phenylalanine (Phe), tyrosine (Tyr) ) And tryptophan (Trp) is a peptide consisting of 1 to 10 amino acids selected from the group.}

이며, 하기 화학식 2로 표시되는 펩타이드 유도체 또는 이의 약학적으로 허용가능한 염을 제공한다.Further, in the present invention, in Formula 1, X ₁ is H, X ₂ is OH, and Y is

, And provides a peptide derivative represented by the following Chemical Formula 2 or a pharmaceutically acceptable salt thereof.

[Formula 2]

{In Formula 2, Z is the same as the definition in Formula 1.}

이며, 하기 화학식 3으로 표시되는 펩타이드 유도체 및 이의 약학적으로 허용가능한 염을 포함한다.In addition, in the present invention, in Formula 1, X ₁ and X ₂ are OH, and Y is

, And includes a peptide derivative represented by Formula 3 below and a pharmaceutically acceptable salt thereof.

[Formula 3]

{In the formula (3), Z is the same as the definition in the formula (1).}

이며, 하기 화학식 4로 표시되는 것을 특징으로 하는 멜라닌 생성 저해 활성을 갖는 펩타이드 유도체 및 이의 약학적으로 허용가능한 염을 포함한다.Further, in the present invention, in Formula 1, X ₁ is H, X ₂ is OH, and Y is

And, it includes a peptide derivative having a melanin production inhibitory activity, characterized in that represented by the following formula (4) and a pharmaceutically acceptable salt thereof.

[Formula 4]

In Formula 1, the peptide derivative in which X ₁ is H and X ₂ is OH is a compound obtained by binding coumaric acid to a peptide, and the peptide derivative in which X ₁ and X ₂ are OH is caffeic acid. It is a compound bound to a peptide.

Kumaric acid is a natural component widely distributed in the plant system, and has the effect of inhibiting melanin production in human melanocytes and reducing the cytotoxicity of ultraviolet rays. In addition, couric acid has a tyrosinase inhibitory effect that is about 100 times stronger than known whitening substances arbutin or kojic acid, and is structurally very similar to tyrosine, a substrate of tyrosinase, effectively blocking access to the substrate.

Caffeic acid has been reported as a whitening active ingredient present in the plant world, and has excellent antioxidant and anti-inflammatory effects.

On the other hand, while kumaric acid and caffeic acid have tyrosinase inhibitory activity, these phytochemicals are less stable in solution phase, browning due to oxidation by light and heat over time, high temperature or high oxygen saturation Ground browning speeds up. As such, stabilization of the low-solubility, unstable, and toxic natural biomaterials, kumaric acid and caffeic acid, by using peptides with excellent physiological activity can increase the efficacy, and kumaric acid and caffeic acid are naturally derived substances. Depending on the biocompatibility is high, it is possible to improve the stability of the peptide in vivo, and after the peptide is decomposed, it exhibits activity to continuously provide an effect.

The Y is to act as a linker connecting the coumarin acid or caffeic acid with a peptide, the linker is Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) or Fmoc-glycyl-glycyl-glycine ( Fmoc-GGG) is preferably used, and by combining coumarin acid or caffeic acid with a peptide as a linker, it is possible to improve stability and improve the overall physical properties of the compound.

In addition, in Chemical Formula 4, Z preferably includes an Ala-Arg-Pro sequence.

In addition, in another aspect, the present invention provides a composition for inhibiting melanin production comprising the peptide derivative and a pharmaceutically acceptable salt thereof as an active ingredient.

Hereinafter, the synthesis example of the compound represented by the formula (1) of the present invention and examples thereof will be described in detail, but the present invention is not limited to the following examples.

[ Synthetic example ]

In an embodiment according to the present invention, the peptide was synthesized using solid phase peptide synthesis (SPPS). After combining Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) or Fmoc-glycyl-glycine-glycine (Fmoc-GGG), which acts as a linker to the synthesized peptide, it is combined with coumaric acid or caffeic acid. The coupling reaction was carried out to prepare a compound represented by Chemical Formula 1.

Scheme 1 below shows the reaction pathway of the peptide derivative I-1 compound to which coumarin acid is coupled according to the synthesis example of the present invention.

<Scheme 1>

I-1 Synthesis Example

1) I-1-1 (peptide) synthesis example

Preparation of the peptide was carried out in 4 steps of loading of amino acids into resin-removing Fmoc protecting group-coupling reaction of amino acids-kaiser test.

First, swelling 454 mg (500 μmol) of 2-Chlorotrityl chloride resin (1.1 mmol / g, Novabiochem®) with Dichloromethane (DCE), followed by amino acids (3 equivalents) and N, N-Diisopropylethylamine (DIPEA, 6 Equivalent) was added and reacted for 4 hours. Thereafter, to remove 9-Fluorenylmethoxycarbonyl (Fmoc) of amino acid N-term, DMF diluted with 20% piperidine was added, and the process of stirring for 5 minutes was repeated twice. Then, using solid phase peptide synthesis, 1-hydroxybenzotriazole (HOBt, 3 equivalents), N, N, N ′, N ′ -Tetramethyl- O- (1 H -benzotriazol-1-yl) uranium hexafluorophosphate ( HBTU, 3 eq.) And N, N -Diisopropylethylamine (DIPEA, 6 eq.) Were combined with amino acids for 4 hours. Whether the reaction proceeded was confirmed by adding 3 types of Kaiser test solution to the resin and heating at 120 ° C for 3 minutes. At this time, when the resin color was blue, the coupling reaction was performed again, and when there was no change in the color of the resin, the next reaction was performed. The coupling reaction was repeated to synthesize a peptide (I-1-1) having a desired sequence.

2) I-1-2 synthesis example

Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-mini-PEG) was used as a linker connecting coumarin acid to the peptide. According to a known method ( Bioorg . Med . Chem . Lett. 1995 , 5 (6), 573 ), activated Fmoc-mini-PEG [Fmoc-mini-PEG (Fmoc-mini-PEG) in the reactor containing I-1-1) 2 equivalents), HOBt (2 equivalents), HBTU (2 equivalents), and DIPEA (6 equivalents) were added, followed by reaction at room temperature for 8 hours to proceed with the coupling reaction to synthesize I-1-2. The reaction was confirmed by Kaiser test.

3) I-1-3 synthesis example

Benzotriazol-1-yloxy) tripyrrolidinophosphonium hexafluorophosphate (PyBOP) was used as a coupling reagent to bind coumarin acid.

To the I-1-2 (mini-PEG-peptide-resin from which the fmoc protecting group was removed), 2 equivalents of coumarin acid, 2 equivalents of PyBOP, 2 equivalents of HOBt, and 4 equivalents of DIPEA were added and reacted at room temperature for 16 hours. As a result, I-1-3 was synthesized. The reaction was confirmed by Kaiser test.

4) I-1 Synthesis Example

Cleavage cocktail solution was added to I-1-3 to remove resin and protecting groups, and I-1 was synthesized as a result. As the Cleavage cocktail solution, a solution of Trifluoroacetic acid (TFA): Triisopropylsilane (TIS): Thioanisole: H ₂ O = 90: 3: 3: 3 (v / v / v / v) was used. Can be. The results of LC-Mass and HPLC analysis of the synthesized I-1 compound are shown in FIGS. 1 and 2.

According to the synthesis method, coumarin acid or caffeic acid-linked peptide derivatives (I-1 to I-9) were prepared, and prep. Purification using HPLC. The molecular weight and purity of I-1 to I-9 were LC-Mass and anal. It was confirmed using HPLC (High Performance Liquid Chromatography), and the results are shown in Table 1 below.

No. X _One X ₂ Y Z theory
Molecular Weight Experiment
Molecular Weight I-1 H OH mini-PEG ARP 633.7 634.7 I-2 OH OH mini-PEG ARP 649.7 650.7 I-3 H OH mini-PEG FWY 805.9 806.7 I-4 OH OH mini-PEG FWY 821.9 822.7 I-5 H OH mini-PEG PS 493.5 494.4 I-6 OH OH mini-PEG PS 509.5 510.4 I-7 H OH mini-PEG VARP 732.8 733.9 I-8 H OH mini-PEG KVARP 861.1 862.2 I-9 H OH GGG ARP 659.7 660.7

Example  1. Assessment of toxicity in human melanocytes

The I-1 to I-9 were confirmed to be toxic in human melanin-producing cells. Human melanoma cells (SK-MEL-2) were purchased from the Korea Cell Line Bank, and the cell culture medium was 10% fetal bovine serum (FBS, Corning®, USA) in RPMI 1640 (Corning®, USA) medium. 10% penicillin (100 unit / mL) and streptomycin (100 g / mL) were added. Cell culture was performed at 37 ° C, 95% humidity, and 5% CO ₂ incubator, and human melanin-producing cells in passages 12-16 were used in the experiment.

To check for cytotoxicity, the I-1 to I-9 dissolved in tertiary distilled water were treated with 1, 10, 100, and 1000 μM concentrations, and then cultured for 72 hours. The viability of the cells was measured using the CCK-8 assay method, and the results are shown in Table 2 and FIG. 3 below. As shown in Table 2, as shown to affect the growth of human melanin-producing cells at a high concentration (1000 μM), an efficacy evaluation experiment for skin whitening was conducted at a concentration of 1000 uM or less.

No. Cell viability ( % ) One μM 10 μM 100 μM 1000 μM I-1 101.12 102.57 100.62 99.78 I-2 102.29 96.73 95.17 90.81 I-3 100.29 100.22 104.22 94.58 I-4 101.42 100.51 99.19 90.33 I-5 101.68 101.09 100.48 100.41 I-6 102.37 100.31 95.45 94.82 I-7 98.54 96.55 94.34 90.76 I-8 98.51 98.51 96.86 90.07 I-9 100.89 97.95 99.75 95.70

Example  2. Test of melanin suppression effect of human melanin producing cells

Human melanin-producing cells (SK-MEL-2) were treated with concentrations of I-2, I-6, I-8, and I-9, respectively, and the melanin production inhibitory effect was measured. SK-MEL-2 cells at a concentration of 2 × 10 ⁴ cells / well were dispensed 1 mL in 24-well plates, and cultured for 24 hours at 37 ° C., 95% humidity, and 5% CO ₂ incubator. After incubation, 100 nM α-MSH (Melanocyte stimulating hormone) and peptide derivatives (I-2, I-6, I-8 and I-9) were treated at 50 mg / L concentrations, respectively, and cultured for 72 hours. Arbutin was used as a positive control.

After incubating the cells for 72 hours, SK-MEL-2 cells were placed in a 1.5 mL tube, and then collected with a Trypsin EDTA 0.25% solution (Corning®, USA), and washed twice with PBS. The centrifuged cells were re-suspended with 500 μL of 1 N NaOH (10% DMSO) and then incubated at 80 ° C. for 1 hour. 100 μL of the culture solution was dispensed into 96-well plates, and the absorbance of melanin pigment generated in the cells was measured at 405 nm, and the results are shown in Tables 3 and 4 below.

Among the nine peptide derivatives of Table 1, compounds that decrease melanin content at 10 or 100 μM treatment concentrations were I-2, I-6, I-8, and I-9 compounds when compared to the positive control arbutin. Accordingly, as a result of testing the melanin inhibitory effect on the four peptide derivatives (I-2, I-6, I-8 and I-9), as shown in Table 3 below, similar to the conventional whitening notice raw material arbutin As it shows the effect, it can be seen that it can be used for skin whitening.

Treatment material Treatment concentration ( μM ) Melanin content ( % ) Control - 100 α-MSH 0.1 156.3 α-MSH
+ Arbutin 10 92.7 100 75.4 I-2 10 76.2 100 69.8 I-6 10 77.6 100 66.4 I-8 10 78.1 100 71.2 I-9 10 79.6 100 63.0

Example  3. Tyrosinase ( Tyrosinase ) Activity reduction test

After treating the peptide derivatives (I-2, I-6, I-8 and I-9) with human melanin-producing cells (SK-MEL-2) by concentration, the inhibitory effect of tyrosinase production was measured. SK-MEL-2 cells at a concentration of 5 × 10 ³ cells / well were dispensed in 100 μL in 96-well plates, and cultured for 24 hours at 37 ° C., 95% humidity, and 5% CO ₂ conditions. The cultured cells were treated with 100 nM α-MSH (Melanocyte stimulating hormone) and peptide derivatives (I-2, I-6, I-8 and I-9) at a concentration of 50 mg / L, and then cultured for 72 hours. Did. Arbutin was used as a positive control. The inhibitory effect of tyrosinase production on cultured human melanocytes was measured using a Tyrosinase inhibitor screening kit (Biovision_ # K575-100), and the results are shown in Tables 4 and 5 below.

As a result of confirming the effect of reducing the tyrosinase activity on the four peptide derivatives (I-2, I-6, I-8 and I-9) showing the melanin inhibitory effect in Example 2, as shown in Table 4 below , As a result of confirming the effect of reducing tyrosinase activity, the I-9 compound exhibited better tyrosinase inhibition rate than arbutin, a positive control at 10 and 100 μM treatment concentrations. Through the above results, it can be confirmed that the inhibitory effect of melanin production of the I-9 compound was greatly influenced by the reduction of tyrosinase activity in terms of the activity mechanism.

Treatment material Treatment concentration ( μM ) Tyrosinase inhibition rate ( % ) Control - 100 α-MSH 0.2 -218.7 α-MSH
+ Arbutin 10 -164.6 100 -84.0 I-2 10 -46.4 100 38.1 I-6 10 -46.2 100 0.1 I-8 10 -132.1 100 -96.5 I-9 10 43.7 100 73.2

Example  4. TYR , MITF , TYRP1  And TYRP  2, Expression test

Proteins that promote melanin production when treated with α-MSH (Melanocyte stimulating hormone) in human melanocytes, Tyrosinase, MITF (Microphthalmia-associated transcription factor), TYRP-1 (Tyrosinase-related protein 1) and TYRP-2 ( MRNA expression changes of TYR, MITF, TYRP1 and TYRP2, genes that express Tyrosinase-related protein 2) were measured.

In order to confirm the mRNA expression level of TYR, MITF, TYRP1 and TYRP2 by the peptide derivative, the peptide derivative was treated with human melanin-producing cells (SK-MEL-2) at a concentration of 10 or 100 μM and cultured for 48 hours. Gene expression changes were measured by qRT-PCR (quantitative real-time PCR), which continuously detects a fluorescent substance after binding a fluorescent substance to a DNA product amplified in a polymerase chain reaction (PCR). To quantify mRNA expression changes, total RNA was isolated from cultured human melanocytes after peptide treatment (AccuPrep® RNA Extraction Kit, Bioneer Corp., Korea) using oligo (dT) primers, totaling 1 μg CDNA was synthesized from RNA (RocketScript ^TM Reverse Transcriptase Kit, Bioneer Corp., Korea).

qRT-PCR was performed using ExcelTaq 2X Q-PCR Master Mix (SMOBIO, Hsinchu, Taiwan) and CFX96 ^TM Real-Time System (Biorad, USA), and the performance condition was preliminary denaturation at 95 ° C for 3 minutes (primary). After denaturation, denaturation, annealing, and polymerization were performed for a total of 40 cycles, respectively, at 95 ° C for 15 seconds, at 60 ° C for 30 seconds, and at 72 ° C for 30 seconds, after each cycle was completed. Fluorescence intensity was measured. The experimental results were verified with a melting curve, and the threshold cycle (Ct) value of each gene was normalized to the Ct value of GAPDH, which is an internal standard, and the amount of change in the Ct value was compared and analyzed. Primer sequences used in the experiment are shown in Table 5 below.

Gene Name Forward Primer Reverse Primer TYR TGCCCCAGAGAAGGACAAAT GTGCTGACCTCCCATGTACT MITF TGAGCATGGAAGAGACGGAG TCCAAGGAAGTCACAGGCAT TYRP -One ATGGCAGAGATGATCGGGAG GAGCTTCAACTCCAACCCTT TYRP -2 AGTACGACAGAGACAAGGAAAGT ACGGTCATCCTGGTTTCGTA GAPDH GAGTCAACGGATTTGGTCGT GATCTCGCTCCTGGAAGATG

Table 6 and Figure 6 shows the results of measuring the mRNA expression level of the four genes according to Example 4 ( TYR , MITF , TYRP1 , TYRP2 ). Among the peptide derivatives, the I-9 compound exhibited a gene reduction result correlated with melanin inhibition and tyrosinase activity test results at a 10 μM treatment concentration.

Treatment material Treatment concentration (μM) TYR
Expression MITF
Expression TYRP1
Expression TYRP2
Expression Arbutin 0 1.00 1.00 1.00 1.00 10 1.69 0.26 0.29 0.33 100 0.88 0.38 0.50 0.77 Ⅰ-2 0 1.00 1.00 1.00 1.00 10 2.35 0.65 0.85 1.31 100 0.31 0.09 0.01 0.22 Ⅰ-6 0 1.00 1.00 1.00 1.00 10 0.71 0.25 0.37 0.67 100 3.90 0.52 1.57 2.18 Ⅰ-8 0 1.00 1.00 1.00 1.00 10 0.57 0.25 0.14 0.35 100 0.24 0.04 0.09 0.13 Ⅰ-9 0 1.00 1.00 1.00 1.00 10 0.36 0.01 0.12 0.21 100 1.65 0.48 1.67 3.13

Taken together, based on the results of the above example, it is judged that the I-9 compound inhibits tyrosinase activity and the expression of four genes, thereby suppressing the final melanin production, and such a peptide material helps skin whitening. The state is expected to be used in skin care products.

Above, the present invention has been described by way of example, and those skilled in the art to which the present invention pertains will be capable of various modifications without departing from the essential characteristics of the present invention. Accordingly, the embodiments disclosed in the present specification are not intended to limit the present invention, but to explain the present invention, and the spirit and scope of the present invention are not limited by these embodiments. The scope of protection of the present invention should be interpreted by the following claims, and all technologies within the equivalent range should be interpreted as being included in the scope of the present invention.

Claims (11)

Peptide derivative having a melanin production inhibitory activity, characterized in that represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
[Formula 1]

{In the above formula 1,
X ₁ is H or OH, X ₂ is OH,
Y is a linking group represented by the following formula A or formula B,
<Formula A><FormulaB>

,

Z is any peptide selected from the group consisting of ARP, FWY, PS, VARP or KVARP.}
delete The method of claim 1, wherein in Formula 1 Y

Phosphorous peptide derivatives or pharmaceutically acceptable salts thereof
The method of claim 1, wherein in Formula 1 Y

Phosphorous peptide derivatives or pharmaceutically acceptable salts thereof
The method of claim 1, wherein the formula 1 is a peptide derivative characterized in that represented by the following formula (2) or a pharmaceutically acceptable salt thereof
[Formula 2]

According to claim 1, wherein the formula 1 is a peptide derivative characterized in that represented by the following formula (3) or a pharmaceutically acceptable salt thereof
[Formula 3]

The method of claim 1, wherein the formula 1 is a peptide derivative having a melanin production inhibitory activity, characterized in that represented by the following formula (4) and a pharmaceutically acceptable salt thereof.
[Formula 4]

delete delete A composition for skin whitening comprising the peptide derivative according to claim 1 or a pharmaceutically acceptable salt thereof. delete

Images