KR101885847B1

KR101885847B1 - Peptides Having Activities for Hair Growth and Promoting Melanin Synthesis and Uses Thereof

Info

Publication number: KR101885847B1
Application number: KR1020170121472A
Authority: KR
Inventors: 정용지; 김은미; 이응지
Original assignee: (주)케어젠
Priority date: 2017-09-20
Filing date: 2017-09-20
Publication date: 2018-08-07
Also published as: KR20170110558A

Abstract

본 발명은 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공한다. 본 발명의 펩타이드는 모낭 세포 성장을 촉진하며, 발모 관련 성장인자 및 발모 관련 인자들의 발현을 증가시킴으로써 발모에 우수한 효과를 나타내며, 탈모 방지 또는 개선, 발모 촉진 및 모발 성장 개선용도로 이용될 수 있다. 본 발명의 펩타이드는 멜라닌 형성에 관여하는 인자들의 발현을 증가시킴으로써 멜라닌 생성에 있어서 우수한 효과를 나타내며, 멜라닌 저색소증의 예방, 개선 및 치료용도로 이용될 수 있다. 상술한 본 발명의 펩타이드의 우수한 활성 및 안정성은 의약, 의약외품 및 화장품에 매우 유리하게 적용될 수 있도록 한다.The present invention provides peptides exhibiting hair growth promoting activity and melanin production promoting activity. The peptide of the present invention promotes hair follicle cell growth and exhibits an excellent effect on hair growth by increasing expression of hair growth related growth factors and hair growth related factors, and can be used for preventing or improving hair loss, promoting hair growth and improving hair growth. The peptide of the present invention shows an excellent effect on melanin production by increasing the expression of factors involved in melanin formation and can be used for prevention, improvement and treatment of melanin hypochloremia. The above-mentioned excellent activity and stability of the peptide of the present invention can be very advantageously applied to medicines, quasi-drugs and cosmetics.

Description

Peptides Having Activities for Hair Growth and Promoting Melanin Synthesis and Uses Thereof}

본 발명은 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드 및 이의 용도에 관한 것이다.The present invention relates to a peptide exhibiting a hair growth promoting activity and a melanogenesis promoting activity, and a use thereof.

모낭은 포유동물 피부의 독특한 기관으로서 원시 표피의 하부가 성장하여 보다 깊은 피부 층으로 신장된 기관이다. 모낭의 기부에는 소낭 또는 진피 유두 세포로서 알려진 세포의 플러그가 존재 하며(Stenn and Paus, Physiol . Rev., 81: 449 (2002)) 유두는 모낭의 정상적인 순환(Oliver, Embryol . Exp . Morph. 15: 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) 및 모간의 성장에 필수적이다. 모간은 케라틴 필라멘트와 필라멘트 응집 단백질로 충전된 단단하게 밀착된 상피 세포로 제조된 트레드 형상의 구조이다.Hair follicles are unique organs of mammalian skin, where the lower part of the primitive epidermis grows and extends into a deeper layer of skin. At the base of the hair follicle, there is a plug of cells known as follicles or dermal papilla cells (Stenn and Paus, Physiol . Rev., 81: 449 (2002)), and the papilla is the normal circulation of the hair follicle (Oliver, Embryol . Exp . Morph. 15 : 3311 (1966); Oliver, Embryol . Exp . Morph. 16: 231 (1966)) and essential for the growth of hair shafts. The hair shaft is a tread-shaped structure made of tightly adhered epithelial cells filled with keratin filaments and filament aggregation proteins.

인간의 모발은 주기적으로 생장기, 퇴행기, 휴지기를 반복하며 모발이 빠지고 다시 생성되는 과정을 거치게 된다. 모발 주기의 결정은 호르몬 조절이나 많은 성장인자 등의 조절을 통하여 이루어진다. 한편, 모발은 심한 스트레스나 영양 결핍 등에 의해 일찍 퇴행기를 거쳐 휴지기로 접어들어 심한 탈모가 유발될 수 있다(American Journal of Pathology, 162(3)(2003), (Arck, Petra Clara; Handjiski, Bori)). 남성형 대머리에 있어서 두피의 전면 및 상부의 모낭은 안드로겐에 대해 감수성을 나타낸다. 그래서 남성형 대머리의 경우, 모낭의 파괴보다는 모낭의 소형화에 해당되는데 남성 호르몬인 안드로겐의 과도한 분비가 원인이다. 안드로겐 과다 분비로 인해 5-알파 환원효소가 활성화 되어 테스토스테론이 디하이드로테스토스테론(dihydrotestosterone,DHT)으로 변형되며, 이렇게 생성된 디하이드로테스토스테론은 모발이 자라는 기간을 단축시키고, 모낭을 소형화시켜 굵고 튼튼한 성모의 수를 감소시킴으로써 탈모를 유발시킨다. Human hair periodically repeats the growth phase, degeneration phase, and resting phase, and the hair goes through the process of being removed and regenerated. The determination of the hair cycle is made through hormonal control or control of many growth factors. On the other hand, hair may undergo a regression period early due to severe stress or nutritional deficiencies, causing severe hair loss ( American Journal of Pathology , 162(3)(2003), (Arck, Petra Clara; Handjiski, Bori). ). In male pattern baldness, the hair follicles on the front and top of the scalp are sensitive to androgens. So, in the case of male pattern baldness, it corresponds to the miniaturization of the hair follicle rather than the destruction of the follicle, which is caused by excessive secretion of the male hormone androgens. Due to the excessive secretion of androgens, 5-alpha reductase is activated and testosterone is transformed into dihydrotestosterone (DHT). The dihydrotestosterone produced in this way shortens the growth period of the hair and reduces the hair follicles to make thick and strong hairs. It causes hair loss by reducing the number.

일반적으로 나이가 들어감에 따라 탈모가 확산된다. 예를 들면, 흉터 탈모증, 화상 또는 압박 상해와 관련된 흉터형성 상태와 같은 상이한 질환 상태가 현저한 탈모를 일으킬 수 있다. 이런 탈모현상을 치료하기 위해 지금까지는 의약품으로 여러 가지 물질 등이 사용되어 왔으나 가격이 너무 비싸고, 여러 가지 부작용들이 유발된다. 또한, 이런 의약품들은 지속적인 사용을 필요로 하며 사용을 중단하였을 때에는 다시 탈모가 유발되고 효능에 대한 개개인의 차이가 심하며, 부작용도 개개인 마다 차이가 난다는 단점이 있다.In general, hair loss spreads with age. For example, different disease states, such as scar alopecia, scarring conditions associated with burns or compression injuries, can cause significant hair loss. To treat such a hair loss phenomenon, various substances have been used as medicines so far, but the price is too high and various side effects are caused. In addition, these drugs require continuous use, and when the use is stopped, hair loss is induced again, individual differences in efficacy are severe, and side effects are also different for each individual.

그 외 화장품으로 이용되고 있는 원료들은 가격이 저렴하다는 장점이 있지만, 식물 추출물 유래 성분들로 구성되어 있기 때문에 실제 그 효능은 크지 않다는 단점이 있다. 따라서 효과적이면서 비용적인 측면에서도 보다 경제적인 새로운 유효성분에 대한 요구가 당업계에 대두하고 있다.Other ingredients used in cosmetics have the advantage of being inexpensive, but since they are composed of ingredients derived from plant extracts, their effectiveness is not so great. Therefore, there is a demand in the art for a new active ingredient that is effective and more economical in terms of cost.

지금까지 알려진 2가지 이용 가능한 약물(미녹시딜 및 피나스테라이드)은 추가 탈모를 지연시킬 수는 있지만, 새로운 모낭의 재생을 유도하지는 못했다. 또한, 두발 화장품 중에서 식물 추출물 등을 이용한 탈모방지 제품이 많이 출시되었는데, 특히, 고삼, 고추, 당약, 상백피, 상엽, 임삼, 감초, 작약, 지황, 회향, 산수유, 마늘등의 추출물을 함유한 제품, 크산틴 및 성장호르몬을 함유하는 조성물을 첨가하여 디하이드로테스토스테론의 과잉에 따른 세포대사 억제를 개선함과 동시에 성장 호르몬이 모발성장을 촉진함으로써 탈모방지 및 모발을 재생하여 모발성장 촉진 효과를 나타내는 제품, 발모 및 모발의 성장을 촉진하기 위해 미네랄 및 비타민류, 녹차, 로즈마리, 쑥, 감초 추출액을 함유한 제품을 개발하여 두피와 모발에 영양을 공급하며 탈모의 예방 및 모발 성장 촉진에 효과가 있는 발모 촉진용 제품, 비타민 B, 비타민 C, 비타민 D, 비타민 E, 니코틴산, 판토텐산, 비오틴 및 엽산 등의 물질과 식물추출물을 혼합하여 인체 내의 5-알파 환원효소를 억제하여 남성호르몬의 대사과정에서 디하이드로테스토스테론이 형성되지 않도록 하며 머리카락의 신진대사작용을 돕는 남성형 탈모제품들이 개발되었으나 신생모발의 생성까지 영향을 미치는 제품은 찾기 어려웠다. Two available drugs known to date (minoxidil and finasteride) may delay further hair loss, but did not induce regeneration of new hair follicles. In addition, among hair cosmetics, many products for preventing hair loss using plant extracts have been released. In particular, products containing extracts such as gosam, red pepper, sugar drug, sangbaekpi, upper leaf, forest ginseng, licorice, peony, reindeer, fennel, cornus milk, and garlic , A product containing a composition containing xanthine and growth hormone to improve the inhibition of cell metabolism due to an excess of dihydrotestosterone and at the same time prevent hair loss and regenerate hair by promoting hair growth by growth hormone. , Development of a product containing minerals and vitamins, green tea, rosemary, mugwort, and licorice extract to promote hair growth and hair growth, supplying nutrients to the scalp and hair, preventing hair loss and promoting hair growth. By mixing substances such as promoting products, vitamin B, vitamin C, vitamin D, vitamin E, nicotinic acid, pantothenic acid, biotin and folic acid, and plant extracts, it inhibits 5-alpha reductase in the human body and makes it dihydro in the process of male hormone metabolism. Male-type hair loss products were developed that prevent the formation of testosterone and aid in the metabolism of the hair, but it was difficult to find a product that affects the formation of new hair.

피부세포는 자외선이나 환경오염, 그 밖의 외부 요인의 자극에 대해 방어기전으로 표피기저층에 존재하는 멜라닌 세포(melanocyte)의 멜라닌소체(melanosome)에서 멜라닌을 생성한다. 멜라닌은 동물들의 피부, 눈동자, 머리카락의 색을 결정하는 중요한 요인이다. 저색소증은 피부암의 위험인자로도 알려졌다. 동양인들은 멜라닌이 과다로 생성되는 것에 민감하여 멜라닌 생성을 억제하는 미백관련이 연구가 많이 수행되었다. 하지만 최근에는 멜라닌 생성이 억제되어 나타나는 백반증(Vitiligo)에 대한 요구도 증가하고 있어 이에 대한 연구도 진행되고 있다.Skin cells produce melanin from the melanosomes of melanocytes in the base of the epidermis as a defense mechanism against stimulation from ultraviolet rays, environmental pollution, and other external factors. Melanin is an important factor in determining the color of the skin, eyes, and hair of animals. Hypopigmentation is also known as a risk factor for skin cancer. Asians are sensitive to the excessive production of melanin, so many studies have been conducted on whitening, which inhibits the production of melanin. However, in recent years, the demand for vitiligo, which appears due to inhibition of melanin production, is also increasing, and studies on this are also underway.

백반증은 멜라닌 세포의 사멸이나 괴사로 인한 여러 가지 크기 및 형태의 백색반이 피부에 나타나는 후천성 탈색소 질환이다. 전세계적으로 인구의 약 1%에서 나타나는 비교적 흔한 질환으로, 인종이나 지역에 따른 차이는 없다. 발생 연령은 10~30세에 가장 많고, 95%의 경우 40세 이전에 발병하고, 환자의 30%에서 가족력이 있다. 백반증이 생기는 원인에 대해서 아직 정확히 밝혀진 바는 없으나, 자가 면역설, 신경체액설, 멜라닌 세포 자가 파괴설 등 여러 가지 설이 제시되고 있다. 자가 면역설은 멜라닌 세포계 항원에 대한 자가항체의 발현으로 멜라닌 세포의 파괴 또는 기능 이상이 초래되거나 세포 독성 림프구나 활성화된 림프구가 분비한 림포카인에 멜라닌 세포가 파괴된다는 설이다. 신경체액설은 카테콜아민 생합성의 이상과 모노아민 산화효소의 증가 등으로 인하여 스트레스와 관련된 과산화수소가 만들어지고 이로 인해 멜라닌 세포가 파괴된다는 설로, 백반증이 신경절을 따라 발생하거나 신경 손상이나 스트레스 후에 발병할 수도 있다. 멜라닌 세포 자가 파괴설은 멜라닌 형성 과정에서 생기는 중간대사 물질이나 최종대사 물질인 페놀 복합체가 멜라닌 세포 내에 축척되어 세포를 파괴한다는 설이다. 그 외 고유세포 결손(inherent cellular defect), 유전요인, 세포사멸, 칼슘대사 이상 등의 다양한 인자들이 제시되고 있다. Vitiligo is an acquired depigmentation disease in which white spots of various sizes and shapes appear on the skin due to the death or necrosis of melanocytes. It is a relatively common disease that occurs in about 1% of the population worldwide, and does not differ by race or region. The age of onset is most common between 10 and 30 years of age, 95% of cases develop before 40 years of age, and 30% of patients have a family history. Although the cause of vitiligo has not been accurately identified yet, various theories have been suggested, such as autoimmune theory, neuronal humoral theory, and melanocyte self-destruction theory. The autoimmune theory is that the expression of an autoantibody against a melanocyte-based antigen results in the destruction or dysfunction of melanocytes, or that melanocytes are destroyed by lymphokines secreted by cytotoxic lymphocytes or activated lymphocytes. Neural humoral hypothesis is the theory that hydrogen peroxide related to stress is produced due to abnormalities in catecholamine biosynthesis and increased monoamine oxidase, thereby destroying melanocytes, and vitiligo may occur along the ganglion or after nerve damage or stress. The theory of melanocyte self-destruction is that the phenol complex, an intermediate metabolite or final metabolite generated during the melanogenesis process, accumulates in melanocytes and destroys the cell. In addition, various factors such as inherited cellular defects, genetic factors, apoptosis, and abnormal calcium metabolism have been suggested.

멜라닌은 멜라닌 생성세포(melanocytes)로부터 합성되고 자외선 조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 그러므로 멜라닌 합성이 정상적으로 일어나지 않는 사람들에서는 모든 피부가 백색으로 되기보다는 부분적으로 백색으로 변해 얼룩이 생기는 외형적인 문제점도 있고 외부 자극에 민감해지는 것이 더 문제이다.Melanin is synthesized from melanocytes and plays an important role in protecting the skin by absorbing UV rays or toxic substances and chemicals. Therefore, in people whose melanin synthesis does not normally occur, there is also an external problem of partially turning white and staining rather than whitening all of the skin, and being sensitive to external stimuli is more problematic.

멜라닌 합성에 중요한 효소인 티로시나아제(tyrosinase)와 TRP-1(tyrosinase related protein-1), TRP-2는 산화적 반응에 촉매로 작용한다(Pigment Cell Res. 14 (6): 43744). 티로시나아제는 티로신(tyrosine)을 DOPA(L-3,4-dihydroxyphenylalanine)로, DOPA를 DOPA 퀴논(quinone)으로 산화시키는 작용을 하고, TRP-1은 dihydroxyindole carboxylic acid oxidase로서 5,6-dihydroxyindole-2-carboxylic acid(DHICA)를 indol-5,6-quinone-2-carboxylic acid로 변화시키는데 관여한다. 또한, TRP-1은 티로시나아제를 안정화시키고 활성을 조절하는 역할을 한다.Tyrosinase, tyrosinase related protein-1 (TRP-1), and TRP-2, which are important enzymes for melanin synthesis, act as catalysts in oxidative reactions (Pigment Cell Res. 14 (6): 43744). Tyrosinase acts to oxidize tyrosine to DOPA (L-3,4-dihydroxyphenylalanine), DOPA to DOPA quinone, and TRP-1 is dihydroxyindole carboxylic acid oxidase, which is 5,6-dihydroxyindole- It is involved in converting 2-carboxylic acid (DHICA) into indol-5,6-quinone-2-carboxylic acid. In addition, TRP-1 plays a role in stabilizing tyrosinase and regulating its activity.

TRP-2는 DOPA 크롬 타우토머라아제로써 DOPA 크롬을 DHICA로 변화시켜 멜라닌세포를 이루는 유멜라논(eumelanon)과 페오멜라논(pheomelanon)을 형성하고 이들의 비율에 따라 피부, 머리타락, 눈동자의 색깔 등이 결정된다.TRP-2 is a DOPA chromium tautomerase, which converts DOPA chromium into DHICA to form eumelanon and pheomelanon that form melanocytes, and depending on their ratio, The color, etc. are determined.

멜라닌 합성은 자외선 조사와 MSH(α-melanocyte stimulating hormone)로 인해 활성화된다. α-MSH는 펩타이드 호르몬으로 자외선에 의해 생성되며 뇌하수체 및 피부를 포함한 여러 세포에서 만들어지는 것으로 알려져 있다. α-MSH는 측분비(paracrine)에 의해 멜라닌 생성세포의 MCR(melanocortin receptor)에 작용하여 전사인자인 MITF(microphthalmia-associated transcription factor)의 활성을 조절하여 멜라닌 합성에 중요한 역할을 하는 티로시나아제, TRP-1(DHICA oxidase), TRP-2(DOPAchrome tautomerase) 등의 활성을 조절한다(THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July 31, pp. 195609565, 1998).Melanin synthesis is activated by UV irradiation and α-melanocyte stimulating hormone (MSH). α-MSH is a peptide hormone that is produced by ultraviolet rays and is known to be made in various cells including the pituitary gland and skin. α-MSH is a tyrosinase that plays an important role in melanin synthesis by controlling the activity of the transcription factor MITF (microphthalmia-associated transcription factor) by acting on the melanocortin receptor (MCR) of melanogenic cells by paracrine. It regulates the activities of TRP-1 (DHICA oxidase) and TRP-2 (DOPAchrome tautomerase) (THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 31, Issue of July 31, pp. 195609565, 1998).

멜라닌 형성세포가 UV 또는 α-MSH에 의해서 자극이 되면 각각 p38이나 PKA(protein kinase A)에 의해서 티로시나아제가 활성화된다고 보고되었다. 그런데 이 두 가지 경로 중 특히 α-MSH → cAMP → PKA 과정이 멜라닌 합성에 중요한 역할을 하는데, cAMP의 증가는 CREB(cAMP-responsive element binding protein) 인산화를 촉진시키고 이것이 전사인자인 MITF의 발현을 증가시키고, 이것은 티로시나아제의 활성을 향상시키며, 티로시나아제 mRNA 발현을 증가시킨다는 보고들이 있다(Nucleic Acids Res. 30 (14): 3096106, Pigment Cell Melanoma Res 21 (6): 66576).When melanocytes are stimulated by UV or α-MSH, it has been reported that tyrosinase is activated by p38 or protein kinase A (PKA), respectively. However, among these two pathways, α-MSH → cAMP → PKA, in particular, plays an important role in melanin synthesis. Increasing cAMP promotes CREB (cAMP-responsive element binding protein) phosphorylation, which increases the expression of the transcription factor MITF. It has been reported that it enhances the activity of tyrosinase and increases tyrosinase mRNA expression (Nucleic Acids Res. 30 (14): 3096106, Pigment Cell Melanoma Res 21 (6): 66576).

한편, 우리나라를 비롯한 동양인들은 누구나 하얀 피부색을 가지기를 원하기 때문에 멜라닌 생성을 억제하는 미백 성분에 대한 연구를 많이 수행해 왔다. 그러나 멜라닌은 피부의 멜라닌 생성세포로부터 합성되며 자외선조사나 독성 물질과 화학물질을 흡수함으로써 피부를 보호하는데 중요한 역할을 한다. 멜라닌의 정상적인 합성이 나타나지 않는 경우는 피부가 외부 자극에 민감하고 외형적으로도 비정상적으로 보이므로 멜라닌 합성이 정상화될 수 있도록 치료하는 것이 필요하고 이에 대한 연구도 수행된 것들이 있다. 그러나 아직까지 멜라닌 합성을 촉진시키는 것에 대한 기술개발이 충분히 수행되지 않았다.On the other hand, since Asians including Korea want everyone to have a white skin color, many studies have been conducted on whitening ingredients that inhibit melanin production. However, melanin is synthesized from the skin's melanogenic cells and plays an important role in protecting the skin by absorbing UV rays or toxic substances and chemicals. When the normal synthesis of melanin does not appear, since the skin is sensitive to external stimuli and looks abnormal in appearance, it is necessary to treat melanin synthesis to normalize, and some studies have been conducted on this. However, technology development for promoting melanin synthesis has not been sufficiently carried out yet.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Throughout this specification, a number of papers and patent documents are referenced and citations are indicated. The disclosure contents of the cited papers and patent documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 노력한 결과, 서열목록 제1서열 또는 제2서열의 아미노산 서열을 갖는 펩타이드가 우수한 발모 효능 및 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고 이들이 탈모 방지 또는 개선 및 멜라닌 저색소증의 예방 및 치료에 유용하게 사용될 수 있음을 규명함으로써, 본 발명을 완성하게 되었다. As a result of trying to develop a peptide having biologically effective activity, the present inventors confirmed that the peptide having the amino acid sequence of the first or second sequence of the sequence listing exhibits excellent hair growth efficacy and melanin production promoting activity, and they prevent hair loss or By finding that it can be usefully used for improvement and prevention and treatment of melanin hypopigmentation, the present invention has been completed.

따라서, 본 발명의 목적은 서열목록 제1서열 내지 제2서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 1종의 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드를 제공하는 데 있다.Accordingly, an object of the present invention is to provide a peptide that exhibits hair growth promoting activity consisting of one amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 1 to 2 in the Sequence Listing.

본 발명의 다른 목적은 상기 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물을 제공하는 데 있다.Another object of the present invention is to provide a composition for preventing or improving hair loss comprising the peptide as an active ingredient.

본 발명의 또 다른 목적은 상기 펩타이드를 유효성분으로 포함하는 발모 촉진 및 모발 성장 개선용 조성물을 제공하는 데 있다.Another object of the present invention is to provide a composition for promoting hair growth and improving hair growth, comprising the peptide as an active ingredient.

본 발명의 또 다른 목적은 서열목록 제1서열 내지 제2서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 1종의 아미노산 서열로 이루어진 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공하는 데 있다.Another object of the present invention is to provide a peptide that exhibits melanogenesis promoting activity consisting of one amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 1 to 2 in the Sequence Listing.

본 발명의 또 다른 목적은 상기 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물을 제공하는 데 있다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating melanin hypopigmentation comprising the peptide as an active ingredient.

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 서열목록 제1서열 내지 제2서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 1종의 아미노산 서열로 이루어진 발모 촉진 활성을 나타내는 펩타이드를 제공한다.According to an aspect of the present invention, there is provided a peptide exhibiting hair growth promoting activity consisting of one amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 1 to 2 in the Sequence Listing.

본 발명자들은 생물학적으로 유효한 활성을 갖는 펩타이드를 개발하고자 노력한 결과, 서열목록 제1서열 또는 제2서열의 아미노산 서열을 갖는 펩타이드가 우수한 발모 효능 및 멜라닌 생성 촉진 활성을 나타낸다는 것을 확인하고 이들이 탈모 방지 또는 개선 및 멜라닌 저색소증의 예방 및 치료에 유용하게 사용될 수 있음을 규명하였다.As a result of trying to develop a peptide having biologically effective activity, the present inventors confirmed that the peptide having the amino acid sequence of the first or second sequence of the sequence listing exhibits excellent hair growth efficacy and melanin production promoting activity, and they prevent hair loss or It was found that it can be usefully used for improvement and prevention and treatment of melanin hypopigmentation.

본 발명의 펩타이드는 서열목록 제1서열 내지 제2서열의 아미노산 서열들로부터 구성된 군으로부터 선택되는 아미노산 서열을 포함한다. 바람직하게는, 본 발명에서의 펩타이드는 서열목록 제1서열 내지 서열목록 제2서열의 아미노산 서열들로부터 구성된 군으로부터 선택되는 아미노산 서열로 필수적으로 구성되어 있다. The peptide of the present invention includes an amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NOs: 1 to 2 in the Sequence Listing. Preferably, the peptide in the present invention consists essentially of an amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 2.

본 명세서에서 용어 “펩타이드”는 펩타이드 결합에 의해 아미노산 잔기들이 서로 결합되어 형성된 선형의 분자를 의미한다. 본 발명의 펩타이드는 당업계에 공지된 화학적 합성 방법, 특히 고상 합성 기술(solid-phase synthesis techniques; Merrifield, J. Amer . Chem . Soc . 85:2149-54(1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.: Rockford, 111(1984)) 또는 액상 합성 기술(US 등록특허 제5,516,891호)에 따라 제조될 수 있다.In the present specification, the term “peptide” refers to a linear molecule formed by bonding of amino acid residues to each other by peptide bonds. The peptides of the present invention are chemically synthesized methods known in the art, in particular solid-phase synthesis techniques; Merrifield, J. Amer . Chem . Soc . 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis , 2nd.ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891).

본 발명의 펩타이드는 본 발명자들이 보유하고 있는 펩타이드 라이브러리 가운데 세포 증식 실험을 통해 발모 효능이 우수한 펩타이드를 스크리닝한 것으로써, 총 2종이 본 발명의 펩타이드로 제공된다.The peptides of the present invention are screened for peptides having excellent hair growth efficacy through cell proliferation experiments among the peptide libraries possessed by the present inventors, and a total of two types are provided as the peptides of the present invention.

본 발명의 펩타이드는 아미노산 서열의 일부 부위를 선정하고 그 활성을 증가시키기 위해 N-말단 또는 C-말단에 변형을 유도할 수 있다. 이러한 변형을 통해 본 발명의 펩타이드는 생체내 투여시의 반감기를 증가시켜 높은 반감기를 가질 수 있다.The peptide of the present invention may select a part of the amino acid sequence and induce a modification at the N-terminus or C-terminus in order to increase its activity. Through this modification, the peptide of the present invention can have a high half-life by increasing the half-life when administered in vivo.

또한, 본 발명의 펩타이드의 C-말단은 히드록시기(-OH), 아미노기(-NH₂), 아자이드(-NHNH₂) 등으로 변형되어 있으며, 펩타이드의 N-말단은 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 및 폴리에틸렌글리콜(PEG)로 구성된 군으로부터 선택되는 보호기가 결합될 수 있다.In addition, the C-terminus of the peptide of the present invention _{is modified with a hydroxy group (-OH), an amino group (-NH 2} ), an azide (-NHNH ₂ ), and the like, and the N-terminus of the peptide is an acetyl group, a fluorenyl group. A protecting group selected from the group consisting of oxycarbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group and polyethylene glycol (PEG) may be bonded.

상술한 아미노산의 변형은 본 발명의 펩타이드의 안정성을 크게 개선하는 작용을 한다. 본 명세서에서 용어 “안정성”은 인 비보 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미한다. 상술한 보호기는 생체 내의 단백질 절단효소의 공격으로부터 본 발명의 펩타이드를 보호하는 작용을 한다.The above-described amino acid modification acts to greatly improve the stability of the peptide of the present invention. In the present specification, the term “stability” means not only in vivo stability, but also storage stability (eg, room temperature storage stability). The above-described protecting group functions to protect the peptide of the present invention from attack by protein cleavage enzymes in vivo.

본 발명의 구현예에 따르면, 본 발명의 펩타이드는 모낭 세포 성장을 촉진하며, 모발 성장 관련 인자인 β-카테닌의 활성을 증가시키고, 발모 관련 성장인자인 KGF, VEGF의 발현을 증가시키며, 발모 시그널링 분자인 PI3K의 발현을 증가시키고, ERK의 인산화를 증가시키며, 모발 성장 관련 인자인 MSX2, 및 카라틴-14의 발현을 증가시키고, 모발 성장 지연과 관련된 TGF-β1의 발현을 감소시키며, 세포 사멸 억제 단백질인 Bcl-2의 발현 증가 및 세포 사멸 관련 단백질인 Bax의 발현 감소를 유도한다. 이러한 결과는 본 발명의 펩타이드가 발모에 대하여 매우 우수한 효능을 가진다는 것을 의미한다. 따라서 본 발명의 펩타이드는 탈모 방지 또는 개선, 발모 촉진 및 모발 성장 개선용도로 이용될 수 있다. According to an embodiment of the present invention, the peptide of the present invention promotes hair follicle cell growth, increases the activity of β-catenin, a hair growth-related factor, increases the expression of KGF and VEGF, which are hair growth-related growth factors, and signals hair growth. Increases the expression of the molecule PI3K, increases the phosphorylation of ERK, increases the expression of hair growth-related factors MSX2, and karatin-14, decreases the expression of TGF-β1 related to hair growth delay, and apoptosis. It induces an increase in the expression of the inhibitory protein Bcl-2 and a decrease in the expression of the apoptosis-related protein Bax. These results mean that the peptides of the present invention have a very good effect on hair growth. Therefore, the peptide of the present invention can be used for preventing or improving hair loss, promoting hair growth, and improving hair growth.

본 발명의 다른 양태에 따르면, 본 발명의 펩타이드를 유효성분으로 포함하는 탈모 방지 또는 개선용 조성물을 제공한다.According to another aspect of the present invention, there is provided a composition for preventing or improving hair loss comprising the peptide of the present invention as an active ingredient.

본 발명에 있어서, “탈모 방지”는 모낭 또는 두피에서 모발이 탈락되는 현상이 저지되거나 약화되는 것을 의미한다. In the present invention, "prevention of hair loss" means that a phenomenon in which hair is removed from a hair follicle or scalp is prevented or weakened.

본 발명의 펩타이드는 모근을 생성할 수 있게 하는 피부조직의 머리카락 난포(hair follicle)에 있는 세포의 증식을 유도하여 새로운 모낭이 생성할 수 있게 한다. 더욱이 β-카테닌(beta-catenin)의 시그널을 활성화 시켜 발모 촉진 유전자를 발현시키며, 발모에 관여하는 성장인자들의 발현을 증가시킨다. 본 펩타이드는 모발이 생성되고 성장되는 시기인 생장기를 촉진시키는 역할을 하며 여러 가지 환경적인 요인으로 인해 퇴행기로 가는 모발의 주기를 생장기에 유지하도록 함으로써 탈모억제 효과를 나타내고 정상 모발에서는 모발에 영양분을 공급하여 모발 건강을 유지할 수 있도록 한다. 따라서, 본 발명의 조성물은 탈모 방지 및 개선에 매우 효과적이다.The peptide of the present invention induces the proliferation of cells in the hair follicle of the skin tissue, which enables the generation of the hair follicle, so that new hair follicles can be generated. Moreover, by activating a signal of β-catenin, a hair growth promoting gene is expressed, and the expression of growth factors involved in hair growth is increased. This peptide plays a role in promoting the growth period, which is the time when hair is produced and grown, and has the effect of inhibiting hair loss by maintaining the cycle of the hair going to the degenerative period due to various environmental factors, and supplying nutrients to the hair in normal hair. To keep your hair healthy. Therefore, the composition of the present invention is very effective in preventing and improving hair loss.

본 발명의 조성물은 상술한 본 발명의 펩타이드를 유효성분으로 포함하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.Since the composition of the present invention contains the peptide of the present invention described above as an active ingredient, descriptions of the contents in common between the two are omitted in order to avoid excessive complexity of the present specification.

본 발명의 다른 양태에 따르면, 본 발명의 펩타이드를 유효성분으로 포함하는 발모 촉진 및 모발 성장 개선용 조성물을 제공한다.According to another aspect of the present invention, there is provided a composition for promoting hair growth and improving hair growth, comprising the peptide of the present invention as an active ingredient.

본 발명에서 “발모 촉진”은 모발이 생성되는 것을 의미하며, 모발 생성 속도 및 생성량을 증가시키는 넓은 의미로 사용된다. 또한 모근 기능이 강화되거나, 모발의 탈락 및 생성 주기가 짧아져 모낭에서 자라는 모발의 수가 증가되는 것을 의미한다.In the present invention, "promoting hair growth" means that hair is generated, and is used in a broad sense to increase the rate and amount of hair generation. In addition, it means that the number of hairs growing in the hair follicle is increased because the hair root function is strengthened or the period of hair dropping and generation is shortened.

본 발명에 있어서, “모발 성장”은 생성된 모발(머리카락)의 굵기가 증가되거나 길이 자람 속도에 영향을 미치는 것을 의미한다.In the present invention, "hair growth" means that the thickness of the generated hair (hair) increases or affects the rate of lengthening.

본 발명의 조성물은 화장품 조성물로 제조될 수 있다. The composition of the present invention can be prepared as a cosmetic composition.

본 발명의 조성물이 화장품 조성물로 제조될 경우, 상술한 본 발명의 펩타이드의 화장품학적 유효량(cosmetically effective amount) 및 화장품학적으로 허용되는 담체가 포함될 수 있다. When the composition of the present invention is prepared as a cosmetic composition, a cosmetically effective amount of the peptide of the present invention described above and a cosmetically acceptable carrier may be included.

본 명세서에서 용어 “화장품학적 유효량”은 상술한 본 발명의 조성물의 효능을 달성하는 데 충분한 양을 의미한다.As used herein, the term “cosmetically effective amount” means an amount sufficient to achieve the efficacy of the composition of the present invention described above.

본 발명의 화장품 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 포옴, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing , Oil, powder foundation, emulsion foundation, wax foundation, and may be formulated as a spray, but is not limited thereto. In more detail, it may be prepared in the form of a flexible lotion, nutritional lotion, nutritional cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.

본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component. I can.

본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additionally chlorofluorohydrocarbon, propane / May contain propellants such as butane or dimethyl ether.

본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the present invention is a solution or emulsion, a solvent, a solubilizing agent or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and crystallites Sex cellulose, aluminum metahydroxide, bentonite, agar or tracanth, and the like can be used.

본 발명의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a surfactant containing cleansing, as a carrier component, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used.

본 발명의 화장품 조성물에 포함되는 성분은 유효성분으로서의 펩타이드류와 담체 성분 이외에, 화장품 조성물에 통상적으로 이용되는 성분들을 포함하며, 예컨대 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제를 포함할 수 있다.The ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions, in addition to peptides and carrier ingredients as active ingredients, such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances. Phosphorus adjuvants may be included.

본 발명의 다른 일 양태에 따르면, 본 발명은 서열목록 제1서열 내지 제2서열에 기재된 아미노산 서열로 구성된 군으로부터 선택되는 1종의 아미노산 서열로 이루어진 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공한다. According to another aspect of the present invention, the present invention provides a peptide that exhibits melanogenesis promoting activity consisting of one amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 1 to 2 in the Sequence Listing.

본 발명의 구현예에 따르면, 본 발명의 펩타이드는 멜라닌 형성 세포에서 멜라닌 생성을 증가시키며, 멜라닌 합성을 조절하는 효소인 티로시나아제의 발현을 증가시키고, 멜라닌 형성에 관여하는 인자인 MITF, TRP1의 발현을 증가시킨다. 이러한 결과는 본 발명의 펩타이드가 멜라닌 생성을 증가시킴으로써 멜라닌 저색소증이 완화되도록 하는 효과를 가진다는 것을 의미한다. 따라서 본 발명의 펩타이드는 멜라닌 저색소증의 예방, 개선 및 치료용도로 이용될 수 있다. According to an embodiment of the present invention, the peptide of the present invention increases melanin production in melanocytes, increases the expression of tyrosinase, an enzyme that regulates melanin synthesis, and increases the expression of MITF and TRP1, which are factors involved in melanin formation. Increase expression. These results mean that the peptide of the present invention has an effect of reducing melanin hypopigmentation by increasing melanin production. Therefore, the peptide of the present invention can be used for prevention, improvement and treatment of melanin hypopigmentation.

본 발명에서 멜라닌 저색소증은 백반증, 백색증, 탈색소 모반, 백색 비강진, 어루러기, 염증후 탈색증, 반상 경피증, 부분 백피증, 특발성 적상 저색소증 또는 점상 백피증이다. In the present invention, the melanin hypopigmentation is vitiligo, albinism, depigmented nevus, white nasal vesicles, rosacea, post-inflammatory depigmentation, scleroderma, partial leukocytosis, idiopathic redness hypopigmentation or petechiae leukoplakia.

본 발명의 다른 양태에 따르면, 본 발명의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 치료용 약제학적 조성물을 제공한다.According to another aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating melanin hypopigmentation comprising the peptide of the present invention as an active ingredient.

본 발명의 조성물이 약제학적 조성물로 제조될 경우, 상술한 본 발명의 펩타이드의 약제학적 유효량(pharmaceutically effective amount) 및 약제학적으로 허용되는 담체가 포함될 수 있다. When the composition of the present invention is prepared as a pharmaceutical composition, a pharmaceutically effective amount of the peptide of the present invention described above and a pharmaceutically acceptable carrier may be included.

본 명세서에서 용어 “약제학적 유효량”은 상술한 펩타이드의 효능 또는 활성을 달성하는 데 충분한 양을 의미한다.As used herein, the term "pharmaceutically effective amount" means an amount sufficient to achieve the efficacy or activity of the above-described peptide.

본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used at the time of formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It does not become. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components.

본 발명의 약제학적 조성물은 비경구로 투여하는 것이 바람직하며, 예를 들어 피부 국소 투여에 의해 투여할 수 있다. The pharmaceutical composition of the present invention is preferably administered parenterally, and can be administered, for example, by topical skin administration.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.001-1000 ㎎/㎏이다.A suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, mode of administration, age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity of the patient, Usually the skilled practitioner can readily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-1000 mg/kg.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 또는 젤(예컨대, 하이드로젤) 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by a person having ordinary knowledge in the technical field to which the present invention belongs. Alternatively, it may be prepared by enclosing it in a multi-dose container. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule or gel (eg, hydrogel), and may additionally include a dispersant or a stabilizer. .

본 발명의 다른 양태에 따르면, 본 발명의 펩타이드를 유효성분으로 포함하는 멜라닌 저색소증의 예방 또는 개선용 화장품 조성물을 제공한다.According to another aspect of the present invention, there is provided a cosmetic composition for preventing or improving melanin hypopigmentation comprising the peptide of the present invention as an active ingredient.

본 발명의 특징 및 이점을 요약하면 다음과 같다: The features and advantages of the present invention are summarized as follows:

(a) 본 발명은 발모 촉진 활성 및 멜라닌 생성 촉진 활성을 나타내는 펩타이드를 제공한다. (a) The present invention provides a peptide exhibiting hair growth promoting activity and melanin production promoting activity.

(b) 본 발명의 펩타이드는 모낭 세포 성장을 촉진하며, 발모 관련 성장인자 및 발모 관련 인자들의 발현을 증가시킴으로써 발모에 우수한 효과를 나타내며, 탈모 방지 또는 개선, 발모 촉진 및 모발 성장 개선용도로 이용될 수 있다. (b) The peptide of the present invention promotes hair follicle cell growth, exhibits excellent effects on hair growth by increasing the expression of hair growth factors and hair growth factors, and can be used for preventing or improving hair loss, promoting hair growth, and improving hair growth. I can.

(c) 본 발명의 펩타이드는 멜라닌 형성에 관여하는 인자들의 발현을 증가시킴으로써 멜라닌 생성에 있어서 우수한 효과를 나타내며, 멜라닌 저색소증의 예방, 개선 및 치료용도로 이용될 수 있다. (c) The peptides of the present invention exhibit excellent effects in melanin production by increasing the expression of factors involved in melanin formation, and can be used for prevention, improvement, and treatment of melanin hypopigmentation.

(d) 상술한 본 발명의 펩타이드의 우수한 활성 및 안정성은 의약, 의약외품 및 화장품에 매우 유리하게 적용될 수 있도록 한다.(d) The excellent activity and stability of the peptide of the present invention described above makes it possible to be applied very advantageously to medicines, quasi-drugs, and cosmetics.

도 1은 본 발명의 합성예에 의하여 제조된 서열목록 제1서열(a), 제2서열(b) 펩타이드의 인간 모유두 세포(Human hair follicle dermal papilla cells, HHFDPC) 성장 촉진 효과를 나타낸 그래프이다.
도 2는 본 발명의 서열목록 제1서열(a), 제2서열(b) 펩타이드에 의해 β-카테닌 및 P-GSK3β의 발현이 증가되는 것을 확인한 결과이다.
도 3은 본 발명의 서열목록 제1서열(a), 제2서열(b) 펩타이드에 의한 PI3K 발현 증가 및 ERK 인산화 증가를 확인한 결과이다.
도 4는 본 발명의 서열목록 제1서열(a) 및 제2서열(b)의 펩타이드에 의한 Bcl-2의 발현 증가 및 Bax의 발현 감소를 확인한 결과이다.
도 5는 본 발명의 서열목록 제1서열(a), 제2서열(b) 펩타이드에 의한 케라틴-14의 발현 증가를 확인한 결과이다.
도 6은 본 발명의 서열목록 제1서열의 펩타이드에 의한 VEGF 및 KGF의 발현 증가를 확인한 결과이다.
도 7은 본 발명의 서열목록 제1서열(a) 및 제2서열(b)의 펩타이드에 의한 TGF-β1 발현 억제를 확인한 결과이다.
도 8은 본 발명의 서열목록 제1서열의 펩타이드에 의한 MSX2 발현 증가를 확인한 결과이다.
도 9는 본 발명의 서열목록 제1서열(a) 및 제2서열(b) 펩타이드에 의한 멜라닌 형성 증가 효과를 확인한 결과이다.
도 10은 본 발명의 서열목록 제1서열 펩타이드에 의해 MITF, 티로시나아제 및 TRP1의 mRNA 발현이 증가되는 것을 확인한 결과이다.
도 11은 본 발명의 서열목록 제1서열 펩타이드에 의해 MITF 및 티로시나아제의 단백질 발현이 증가되는 것을 확인한 결과이다.1 is a graph showing the effect of promoting the growth of human hair follicle dermal papilla cells (HHFDPC) of the peptides of the first sequence (a) and second sequence (b) of the sequence listing prepared according to the synthesis example of the present invention.
2 is a result of confirming that the expression of β-catenin and P-GSK3β is increased by the peptides of the first sequence (a) and second sequence (b) of the sequence listing of the present invention.
3 is a result of confirming an increase in PI3K expression and an increase in ERK phosphorylation by the peptides of the first sequence (a) and second sequence (b) of the sequence listing of the present invention.
4 is a result of confirming the increase in the expression of Bcl-2 and the decrease in the expression of Bax by the peptides of the first sequence (a) and the second sequence (b) of the sequence listing of the present invention.
5 is a result of confirming the increase in expression of keratin-14 by the peptides of the first sequence (a) and second sequence (b) of the sequence listing of the present invention.
6 is a result of confirming the increase in the expression of VEGF and KGF by the peptide of the first sequence of the sequence listing of the present invention.
7 is a result of confirming the inhibition of TGF-β1 expression by the peptides of the first sequence (a) and second sequence (b) of the sequence listing of the present invention.
Figure 8 is a result of confirming the increase in MSX2 expression by the peptide of the first sequence of the sequence listing of the present invention.
9 is a result of confirming the effect of increasing melanin formation by the peptides of the first sequence (a) and second sequence (b) of the sequence listing of the present invention.
10 is a result of confirming that the mRNA expression of MITF, tyrosinase, and TRP1 is increased by the peptide of SEQ ID NO: 1 of the present invention.
11 is a result of confirming that the protein expression of MITF and tyrosinase is increased by the peptide of SEQ ID NO: 1 of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

실시예 Example

합성예 1: 펩타이드의 합성Synthesis Example 1: Synthesis of Peptide

클로로 트리틸 클로라이드 레진(Chloro trityl chloride resin; CTL resin, Nova biochem Cat No. 01-64-0021) 700 mg을 반응용기에 넣고 메틸렌 클로라이드(MC) 10 ㎖를 가하여 3분간 교반하였다. 용액을 제거하고 디메틸포름 아마이드(DMF) 10 ㎖를 넣어 3분간 교반한 후 다시 용매를 제거하였다. 반응기에 10 ㎖의 디클로로메탄용액을 넣고 Fmoc-Cys(Trt)-OH (Bachem, Swiss) 200 mmole 및 디이소프로필 에틸아민(DIEA) 400 mmole을 넣은 후 교반하여 잘 녹이고, 1시간 동안 교반하면서 반응시켰다. 반응 후 세척하고 메탄올과 DIEA(2:1)를 DCM(dechloromethane)에 녹여 10분간 반응시키고 과량의 DCM/DMF(1:1)로 세척하였다. 용액을 제거하고 디메틸포름 아마이드(DMF)를 10 ㎖ 넣어 3분간 교반한 후 다시 용매를 제거하였다. 탈보호 용액(20%의 피페리딘(Piperidine)/DMF) 10㎖를 반응 용기에 넣고 10분간 상온에서 교반한 후 용액을 제거하였다. 동량의 탈보호 용액을 넣고 다시 10분간 반응을 유지한 후 용액을 제거하고 각각 3분씩 DMF로 2회, MC로 1회, DMF로 1회 세척하여 Cys(Trt)-CTL Resin을 제조하였다. 새로운 반응기에 10 ㎖의 DMF 용액을 넣고 Fmoc-Ser(tBu)-OH (Bachem, Swiss) 200 mmole, HoBt 200 mmole 및 Bop 200 mmole을 넣은 후 교반하여 잘 녹였다. 반응기에 400 mmole DIEA를 분획으로 2번에 걸쳐 넣은 후 모든 고체가 녹을 때까지 최소한 5분간 교반하였다. 녹인 아미노산 혼합용액을 탈보호된 레진이 있는 반응용기에 넣고 1시간 동안 상온에서 교반하면서 반응시켰다. 반응액을 제거하고 DMF 용액으로 3회 5분씩 교반한 후 제거하였다. 반응 레진을 소량 취하여 카이저 테스트(Nihydrin Test)를 이용하여 반응 정도를 점검하였다. 탈보호 용액으로 상기와 같이 동일하게 2번 탈보호 반응시켜 Ser(tBu)-Cys(Trt)-CTL Resin을 제조하였다. DMF와 MC로 충분히 세척하고 다시 한 번 카이저 테스트를 수행한 다음 상기와 동일하게 아래의 아미노산 부착 실험을 수행하였다. 선정된 아미노산 서열에 의거하여 Fmoc-Arg(Pbf)-OH, Fmoc-Leu-OH, Fmoc-Gln(Trt)-OH, Fmoc-Ser(tBu)-OH, Fmoc-Ser(tBu)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Cys(Trt)-OH, Fmoc-Ala-OH 순으로 연쇄반응을 시켰다. Fmoc-보호기를 탈보호 용액으로 10분씩 2번 반응시킨 후 잘 세척하여 제거하였다. 무수초산과 DIEA, HoBt를 넣어 한시간동안 아세틸화를 수행한 뒤 제조된 펩티딜 레진을 DMF, MC 및 메탄올로 각각 3번을 세척하고, 질소 공기를 천천히 흘려 건조한 후, P₂O₅ 하에서 진공으로 감압하여 완전히 건조한뒤 탈루 용액[트리플로로화 초산(Trifluroacetic acid) 95%, 증류수 2.5%, 티오아니졸(Thioanisole) 2.5%] 30 ㎖을 넣은 후 상온에서 가끔 흔들어주며 2 시간 반응을 유지하였다. 필터링을 하여 레진을 거르고, 레진을 소량의 TFA 용액으로 세척한 후 모액과 합하였다. 감압을 이용하여 전체 볼륨이 절반 정도 남도록 증류하고 50 ㎖의 차가운 에테르를 가하여 침전을 유도한 후, 원심분리하여 침전을 모으고, 2번 더 차가운 에테르로 세척하였다. 모액을 제거하고 질소 하에서 충분히 건조하여 정제 전 Ala-Cys-Thr-Ser-Ser-Gln-Leu-Arg-Ser-Cys 펩타이드 1을 0.73 g 합성하였다(수율: 87.1%). 분자량 측정기를 이용하여 측정시 분자량 1055.2 (이론값 : 1055.19)를 얻을 수 있었다. 다른 서열2 펩타이드도 위와 같은 방법으로 합성을 진행하였다.700 mg of chloro trityl chloride resin (CTL resin, Nova biochem Cat No. 01-64-0021) was placed in a reaction vessel, and 10 ml of methylene chloride (MC) was added, followed by stirring for 3 minutes. The solution was removed, 10 ml of dimethylformamide (DMF) was added, stirred for 3 minutes, and the solvent was removed again. 10 ml of dichloromethane solution was added to the reactor, 200 mmole of Fmoc-Cys(Trt)-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added, then stirred to dissolve well, and reacted with stirring for 1 hour. Made it. After the reaction was washed, methanol and DIEA (2:1) were dissolved in DCM (dechloromethane), reacted for 10 minutes, and washed with an excess of DCM/DMF (1:1). The solution was removed, 10 ml of dimethylformamide (DMF) was added, stirred for 3 minutes, and the solvent was removed again. 10 ml of a deprotection solution (20% piperidine/DMF) was added to the reaction vessel and stirred at room temperature for 10 minutes, and then the solution was removed. After adding the same amount of the deprotection solution and maintaining the reaction for another 10 minutes, the solution was removed and washed twice with DMF, once with MC, and once with DMF for 3 minutes each to prepare Cys(Trt)-CTL Resin. 10 ml of DMF solution was added to a new reactor, 200 mmole of Fmoc-Ser(tBu)-OH (Bachem, Swiss), 200 mmole of HoBt, and 200 mmole of Bop were added, followed by stirring to dissolve well. After adding 400 mmole DIEA to the reactor twice as a fraction, the mixture was stirred for at least 5 minutes until all solids were dissolved. The dissolved amino acid mixture solution was placed in a reaction vessel with a deprotected resin and reacted with stirring at room temperature for 1 hour. The reaction solution was removed, and the mixture was stirred 3 times for 5 minutes with a DMF solution, and then removed. A small amount of reaction resin was taken and the degree of reaction was checked using a Kaiser test (Nihydrin Test). Ser(tBu)-Cys(Trt)-CTL Resin was prepared by performing a deprotection reaction twice in the same manner as above with a deprotection solution. After sufficiently washing with DMF and MC, performing the Kaiser test again, the following amino acid adhesion experiment was performed in the same manner as above. Based on the selected amino acid sequence, Fmoc-Arg(Pbf)-OH, Fmoc-Leu-OH, Fmoc-Gln(Trt)-OH, Fmoc-Ser(tBu)-OH, Fmoc-Ser(tBu)-OH, Fmoc -Thr(tBu)-OH, Fmoc-Cys(Trt)-OH, and Fmoc-Ala-OH were sequentially subjected to a chain reaction. The Fmoc-protecting group was reacted twice with a deprotection solution for 10 minutes each, and then washed well and removed. After performing acetylation for an hour by adding acetic anhydride, DIEA, and HoBt, the prepared peptidyl resin was washed 3 times with DMF, MC and methanol, respectively, and dried by slowly flowing nitrogen air, and then P ₂ O ₅ After drying completely under reduced pressure under vacuum, 30 ml of a desulfurization solution [Trifluroacetic acid 95%, distilled water 2.5%, Thioanisole 2.5%] was added, and the reaction was allowed to react for 2 hours with occasional shaking at room temperature. Maintained. The resin was filtered by filtering, and the resin was washed with a small amount of TFA solution and then combined with the mother liquor. After distillation using reduced pressure so that the total volume remains about half, 50 ml of cold ether was added to induce precipitation, and then the precipitate was collected by centrifugation, followed by washing with cold ether twice. The mother liquor was removed and sufficiently dried under nitrogen to synthesize 0.73 g of Ala-Cys-Thr-Ser-Ser-Gln-Leu-Arg-Ser-Cys peptide 1 (yield: 87.1%) before purification. When measured using a molecular weight analyzer, a molecular weight of 1055.2 (theoretical value: 1055.19) could be obtained. Other sequence 2 peptides were also synthesized in the same manner as above.

번호number 아미노산 서열Amino acid sequence 분석값(질량분석기)Analysis value (mass spectrometer) 분석치Analysis value 이론치Theoretical value 서열 1 (펩타이드-1)SEQ ID NO: 1 (peptide-1) ACTSSQLRSCACTSSQLRSC 1055.21055.2 1055.191055.19 서열 2 (펩타이드-2)SEQ ID NO: 2 (peptide-2) KYLLVHRPYYRRKYLLVHRPYYRR 1664.01664.0 1663.971663.97

실시예 1: DPC 증식 어세이Example 1: DPC proliferation assay

인간 모유두 세포(Human hair follicle dermal papilla cells)를 2x10³ 세포/웰의 밀도로 96-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 3일간 배양하고 4 mg/ml MTT 용액을 100 μl씩 웰에 처리하여 4시간 반응시켰다. 생성된 포마잔을 DMSO 처리를 통해 녹여낸 후 마이크로플레이트 리더를 사용하여 560 nm에서의 흡광도를 측정하였다.Human hair follicle dermal papilla cells were seeded in a 96-well plate at a density of ^{2×10 3 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 3 days, and 100 μl of 4 mg/ml MTT solution was treated in the wells and reacted for 4 hours. After dissolving the generated formazan through DMSO treatment, the absorbance at 560 nm was measured using a microplate reader.

그 결과, 서열목록 제1서열 또는 제2서열 펩타이드 처리에 의해 인간 모유두 세포의 성장이 농도 의존적으로 촉진되는 것을 확인하였다(도 1). As a result, it was confirmed that the growth of human dermal papilla cells was promoted in a concentration-dependent manner by treatment with the peptides of the first sequence or the second sequence of the sequence listing (FIG. 1).

실시예 2: β-카테닌 활성 시험Example 2: β-catenin activity test

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 핵과 세포질 단백질을 각각 분리하였다. β-카테닌 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 β-카테닌 발현 양상을 비교하였다. Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, peptides were treated, cultured for 15 and 30 minutes, and cells were recovered to separate nuclei and cytoplasmic proteins, respectively. Western blotting was performed using a β-catenin antibody (santacruz biotechnology, USA) to compare the expression patterns of β-catenin.

그 결과, 인간 모유두 세포에서 β-카테닌의 활성 및 GSK3β 인산화 수준이 서열목록 제1서열 또는 제2서열 펩타이드 처리에 의해 증가되었다(도 2). β-카테닌 활성은 GSKβ 인산화에 따른 분해에 의해 복합체로부터 유리되면서 나타나는 반응으로 모발 성장 관련 분자의 발현을 증가시킨다. As a result, the activity of β-catenin and the level of phosphorylation of GSK3β in human dermal papilla cells were increased by treatment with the peptides of SEQ ID NO: 1 or 2 (FIG. 2). β-catenin activity increases the expression of hair growth-related molecules as a reaction that appears as being released from the complex by degradation due to GSKβ phosphorylation.

실시예 3 : PI3K & p-ERK WBExample 3: PI3K & p-ERK WB

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 15, 30분 배양하고 세포를 회수하여 세포 용해물을 준비하였다. PI3K 항체(santacruz biotechnology, USA) 및 phospho-ERK 항체(Cell Signaling Technology, USA)를 이용하여 웨스턴 블롯팅을 수행하여 단백질 발현 양상을 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 15 to 30 minutes, and cells were recovered to prepare a cell lysate. Western blotting was performed using PI3K antibody (santacruz biotechnology, USA) and phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression patterns.

그 결과, 서열목록 제1서열 및 제2서열의 펩타이드 처리에 의해 인간 모유두 세포의 성장에 영향을 주는 PI3K 발현 및 ERK 인산화 레벨이 증가되었다(도 3).As a result, PI3K expression and ERK phosphorylation levels, which affect the growth of human dermal papilla cells, were increased by the peptide treatment of SEQ ID NOs: 1 and 2 (FIG. 3).

실시예 4: Bcl-2/Bax WBExample 4: Bcl-2/Bax WB

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 배양하고 세포를 회수하여 세포 용해물을 준비하였다. Bcl-2 및 Bax 항체(santacruz biotechnology, USA)를 이용하여 웨스턴 블롯을 수행하여 단백질 발현 양상을 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 24 hours, and cells were recovered to prepare a cell lysate. Western blot was performed using Bcl-2 and Bax antibodies (santacruz biotechnology, USA) to compare protein expression patterns.

그 결과, 서열목록 제1서열 및 제2서열의 펩타이드 처리에 의해 인간 모유두 세포에서 항-세포사멸 단백질인 Bcl-2의 발현이 증가되었고, 세포 사멸 관련 단백질인 Bax의 발현이 감소되었다(도 4).As a result, the expression of the anti-apoptotic protein Bcl-2 in human dermal papilla cells was increased by the peptide treatment of the first and second sequences of the Sequence Listing, and the expression of the apoptosis-related protein Bax was decreased (Fig. 4 ).

실시예 5: 케라틴-14 RT-PCRExample 5: Keratin-14 RT-PCR

인간 모유두 세포를 5x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 케라틴-14 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자의 mRNA 발현 정도를 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{5×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 24 hours, and the cells were recovered and RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using a PCR premix (Intron, Korea) and keratin-14 primer, followed by electrophoresis on a 5% agarose gel. The levels of mRNA expression of the growth factors were compared.

프라이머primer 서열(5’-3’)Sequence (5’-3’) 케라틴-14 정방향Keratin-14 forward CCACCTTTCATCTTCCCAATTCTCCCACCTTTCATCTTCCCAATTCTC 케라틴-14 역방향Keratin-14 reverse GTGCGGATCTGGCGGTTGGTGCGGATCTGGCGGTTG

그 결과, 서열목록 제1서열 및 제2서열의 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 관련 인자인 케라틴-14의 mRNA 발현이 증가되는 것을 확인하였다(도 5).As a result, it was confirmed that the mRNA expression of keratin-14, a hair growth-related factor, was increased in human dermal papilla cells by treatment of the peptides of the first and second sequences of the Sequence Listing (FIG. 5).

실시예 6: KGF, VEGF RT-PCRExample 6: KGF, VEGF RT-PCR

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 KGF, VEGF 각각의 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 24 hours, and the cells were recovered and RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and each sample was processed by electrophoresis on a 5% agarose gel after PCR using a PCR premix (Intron, Korea) and primers of KGF and VEGF. Under conditions, the mRNA expression levels of the growth factors were compared.

프라이머primer 서열(5’-3’)Sequence (5’-3’) KGF 정방향KGF forward direction TCTGTCGAACACAGTGGTACCT TCTGTCGAACACAGTGGTACCT KGF 역방향KGF reverse GTGTGTCCATTTAGCTGATGCATGTGTGTCCATTTAGCTGATGCAT VEGF 정방향VEGF forward CCATGAACTTTCTGCTGTCTTCCATGAACTTTCTGCTGTCTT VEGF 역방향VEGF reverse TCGATCGTTCTGTATCAGTCTTCGATCGTTCTGTATCAGTCT

실험결과, 서열목록 제1서열의 펩타이드 처리에 의해 인간 모유두 세포의 성장에 영향을 주는 VEGF 및 KGF의 발현이 증가되는 것을 확인하였다(도 6).As a result of the experiment, it was confirmed that the expression of VEGF and KGF, which affects the growth of human dermal papilla cells, was increased by treatment with the peptide of SEQ ID NO: 1 (FIG. 6).

실시예 7: TGF-β1 RT-PCRExample 7: TGF-β1 RT-PCR

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 TGF-β1 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 24 hours, and the cells were recovered and RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using a PCR premix (Intron, Korea) and TGF-β1 primer, followed by electrophoresis on a 5% agarose gel. The levels of mRNA expression of the growth factors were compared.

프라이머primer 서열(5’-3’)Sequence (5’-3’) TGF-β1 정방향TGF-β1 forward direction GCCCTGGATACCAACTATTGC GCCCTGGATACCAACTATTGC TGF-β1 역방향TGF-β1 reverse TCAGCACTTGCAGGAGTAGCGTCAGCACTTGCAGGAGTAGCG

그 결과, 서열목록 제1서열의 펩타이드 처리에 의해 인간 모유두 세포에서 모발 성장 억제 인자 중 하나인 TGF-β1의 발현이 억제되는 것을 확인하였다(도 7).As a result, it was confirmed that the expression of TGF-β1, one of the hair growth inhibitory factors, was suppressed in human dermal papilla cells by the peptide treatment of SEQ ID NO: 1 (FIG. 7).

실시예 8: MSX2 RT-PCRExample 8: MSX2 RT-PCR

인간 모유두 세포를 4x10⁵ 세포/웰의 밀도로 6-웰 플레이트에 시딩한 후 밤새 배양하였다. 무혈청 배지로 바꿔준 후 펩타이드를 처리하여 24시간 동안 배양하고 세포를 회수하여 RNA를 분리하였다. RNA 정량 후 cDNA 합성 키트(Intron, Korea)를 이용하여 cDNA를 합성하고 PCR 프리믹스(Intron, Korea) 및 MSX2 프라이머를 이용하여 PCR 진행 후 5% 아가로스 겔에 전기영동하여 각 샘플 처리 조건에서 상기 성장인자들의 mRNA 발현 정도를 비교하였다.Human dermal papilla cells were seeded in a 6-well plate at a density of ^{4×10 5 cells/well and cultured overnight.} After changing to a serum-free medium, the peptide was treated and cultured for 24 hours, and the cells were recovered and RNA was isolated. After RNA quantification, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea), and PCR was performed using a PCR premix (Intron, Korea) and MSX2 primers, followed by electrophoresis on a 5% agarose gel to grow the growth under each sample treatment condition. The levels of mRNA expression of the factors were compared.

프라이머primer 서열(5’-3’)Sequence (5’-3’) MSX2 정방향MSX2 forward direction AACACAAGACCAACCGGAAGAACACAAGACCAACCGGAAG MSX2 역방향MSX2 reverse GCAGCCATTTTCAGCTTTTCGCAGCCATTTTCAGCTTTTC

그 결과, 서열목록 제1서열의 펩타이드 처리에 의해 인간 모유두 세포에서 모간(hair shaft) 신장(elongation)에 영향을 주는 인자인 MSX2의 발현이 증가되었다(도 8).As a result, the expression of MSX2, a factor affecting hair shaft elongation in human dermal papilla cells, was increased by treatment with the peptide of SEQ ID NO: 1 (FIG. 8).

실시예 9: 멜라닌 측정 어세이Example 9: Melanin measurement assay

6-웰 배양용 평판에 멜라닌형성 세포(B16F10 cell line)를 37℃ 배양기에서 24시간 배양한 후, 각 판의 배지를 제거하고 새로운 배지로 교체 후 본 펩타이드를 농도 별로 처리하였다. 72시간 동안 배양 한 후 배양액을 제거 하고 세포를 떼어 낸 뒤 1.5 ml 튜브로 옮겨 13,000rpm에서 3분간 원심분리 하여 상층액을 제거하고, 세포 펠렛을 회수하여 멜라닌을 관찰하였다. 세포 펠렛을 2 M NaOH 150 μl씩 넣어 60℃에서 30분 동안 세포 내 멜라닌을 용해시켰다. 96-웰 평판 각 웰에 용해시켜 얻은 상층액을 100 μl씩 넣어 490 nm에서 흡광도를 측정하였다.After culturing melanin-forming cells (B16F10 cell line) on a 6-well culture plate in an incubator at 37° C. for 24 hours, the medium of each plate was removed, replaced with a new medium, and the peptides were treated according to concentrations. After culturing for 72 hours, the culture medium was removed, the cells were removed, transferred to a 1.5 ml tube, centrifuged at 13,000 rpm for 3 minutes to remove the supernatant, and the cell pellet was recovered to observe melanin. The cell pellet was added to 150 μl of 2 M NaOH each to dissolve melanin in the cells at 60° C. for 30 minutes. 100 μl of the supernatant obtained by dissolving in each well of a 96-well plate was added to measure absorbance at 490 nm.

그 결과, 서열목록 제1서열 및 제2서열의 펩타이드 처리에 의해 멜라닌 세포에서 멜라닌 생성이 증가되었다(도 9). As a result, melanin production was increased in melanocytes by the treatment of the peptides of the first and second sequences of Sequence Listing (FIG. 9).

실시예 10: 멜라닌 생성 관련 유전자 RT-PCRExample 10: Melanogenesis-related gene RT-PCR

멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 24시간 배양 후 펩타이드를 농도별로 처리하였다. 72시간 동안 배양된 세포의 RNA 추출 후 cDNA를 제작하였다. 멜라닌 형성에 관여 하는 인자인 MITF 및 티로시나아제에 대한 각각의 특이적인 프라이머를 이용하여 PCR하여 각 유전자의 발현 변화를 관찰하였다.The melanogenic cells (B16F10 cell line) were cultured in a 6-well culture plate for 24 hours, and then the peptides were treated by concentration. After RNA extraction of cells cultured for 72 hours, cDNA was prepared. Changes in expression of each gene were observed by PCR using specific primers for MITF and tyrosinase, which are factors involved in melanin formation.

프라이머primer 서열(5’-3’)Sequence (5’-3’) MITF 정방향MITF forward CCAGCCTGGCGATCATGTCATCCAGCCTGGCGATCATGTCAT MITF 역방향MITF reverse GGTCTGGACAGGAGTTGCTGGGTCTGGACAGGAGTTGCTG 티로시나아제 정방향Tyrosinase forward GGCCAGCTTTCAGGCAGAGGGGCCAGCTTTCAGGCAGAGG 티로시나아제 역방향Tyrosinase reverse TGGTGCTTCATGGGCAAAATTGGTGCTTCATGGGCAAAAT TRP1 정방향TRP1 forward direction TCTGTGAAGGTGTGCAGGAGTCTGTGAAGGTGTGCAGGAG TRP1 역방향TRP1 reverse CCGAAACAGAGTGGAAGGTTCCGAAACAGAGTGGAAGGTT

그 결과, 멜라닌 세포에 서열목록 제1서열의 펩타이드 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF 및 효소인 티로시나아제의 mRNA 발현이 증가되었다(도 10).As a result, mRNA expression of MITF, a transcription factor involved in the process of melanin formation, and tyrosinase, an enzyme, were increased when the peptide of the first sequence in the sequence listing was treated in melanocytes (FIG. 10).

실시예 11: 멜라닌 생성 관련 단백질 웨스턴 블롯팅Example 11: Western blotting of proteins related to melanogenesis

멜라닌형성 세포(B16F10 세포주)를 6-웰 배양용 평판에 24시간 배양 후, 본 펩타이드를 농도별로 처리하였다. 72시간 동안 배양 한 후 세포를 용해하여 멜라닌 형성에 관여 하는 인자인 MITF 및 티로시나아제의 발현을 특이적인 항체(2종류 모두 Santacruz biotechnology, USA)를 이용하여 웨스턴 블롯으로 확인하였다. Melanogenic cells (B16F10 cell line) were cultured in a 6-well culture plate for 24 hours, and then the peptides were treated by concentration. After incubation for 72 hours, the cells were lysed, and the expression of MITF and tyrosinase, which are factors involved in melanin formation, was confirmed by Western blot using specific antibodies (both types of Santacruz biotechnology, USA).

그 결과, 멜라닌 세포에 서열목록 제1서열의 펩타이드 처리 시 멜라닌 형성 과정에 관여하는 전사인자인 MITF 및 효소인 티로시나아제의 단백질 발현이 증가되었다(도 11).As a result, protein expression of MITF, a transcription factor involved in the process of melanin formation, and tyrosinase, an enzyme, were increased when the peptide of the first sequence in the sequence listing was treated in melanocytes (FIG. 11).

이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is clear that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> CAREGEN CO., LTD. <120> Peptides Having Activities for Hair Growth and Promoting Melanin Synthesis and Uses Thereof <130> PN160081 <160> 18 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Peptide 1 <400> 1 Ala Cys Thr Ser Ser Gln Leu Arg Ser Cys 1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Peptide 2 <400> 2 Lys Tyr Leu Leu Val His Arg Pro Tyr Tyr Arg Arg 1 5 10 <210> 3 <211> 24 <212> DNA <213> Keratin-14 Forward Primer <400> 3 ccacctttca tcttcccaat tctc 24 <210> 4 <211> 18 <212> DNA <213> Keratin-14 Reverse Primer <400> 4 gtgcggatct ggcggttg 18 <210> 5 <211> 22 <212> DNA <213> KGF Forward Primer <400> 5 tctgtcgaac acagtggtac ct 22 <210> 6 <211> 23 <212> DNA <213> KGF Reverse Primer <400> 6 gtgtgtccat ttagctgatg cat 23 <210> 7 <211> 21 <212> DNA <213> VEGF Forward Primer <400> 7 ccatgaactt tctgctgtct t 21 <210> 8 <211> 21 <212> DNA <213> VEGF Reverse Primer <400> 8 tcgatcgttc tgtatcagtc t 21 <210> 9 <211> 21 <212> DNA <213> TGF-beta 1 Forward Primer <400> 9 gccctggata ccaactattg c 21 <210> 10 <211> 21 <212> DNA <213> TGF-beta 1 Reverse Primer <400> 10 tcagcacttg caggagtagc g 21 <210> 11 <211> 20 <212> DNA <213> MSX2 Forward Primer <400> 11 aacacaagac caaccggaag 20 <210> 12 <211> 20 <212> DNA <213> MSX2 Reverse Primer <400> 12 gcagccattt tcagcttttc 20 <210> 13 <211> 21 <212> DNA <213> MITF Forward Primer <400> 13 ccagcctggc gatcatgtca t 21 <210> 14 <211> 20 <212> DNA <213> MITF Reverse Primer <400> 14 ggtctggaca ggagttgctg 20 <210> 15 <211> 20 <212> DNA <213> Tyrosinase Forward Primer <400> 15 ggccagcttt caggcagagg 20 <210> 16 <211> 20 <212> DNA <213> Tyrosinase Reverse Primer <400> 16 tggtgcttca tgggcaaaat 20 <210> 17 <211> 20 <212> DNA <213> TRP1 Forward Primer <400> 17 tctgtgaagg tgtgcaggag 20 <210> 18 <211> 20 <212> DNA <213> TRP1 Reverse Primer <400> 18 ccgaaacaga gtggaaggtt 20 <110> CAREGEN CO., LTD. <120> Peptides Having Activities for Hair Growth and Promoting Melanin Synthesis and Uses Thereof <130> PN160081 <160> 18 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Peptide 1 <400> 1 Ala Cys Thr Ser Ser Gln Leu Arg Ser Cys 1 5 10 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Peptide 2 <400> 2 Lys Tyr Leu Leu Val His Arg Pro Tyr Tyr Arg Arg 1 5 10 <210> 3 <211> 24 <212> DNA <213> Keratin-14 Forward Primer <400> 3 ccacctttca tcttcccaat tctc 24 <210> 4 <211> 18 <212> DNA <213> Keratin-14 Reverse Primer <400> 4 gtgcggatct ggcggttg 18 <210> 5 <211> 22 <212> DNA <213> KGF Forward Primer <400> 5 tctgtcgaac acagtggtac ct 22 <210> 6 <211> 23 <212> DNA <213> KGF Reverse Primer <400> 6 gtgtgtccat ttagctgatg cat 23 <210> 7 <211> 21 <212> DNA <213> VEGF Forward Primer <400> 7 ccatgaactt tctgctgtct t 21 <210> 8 <211> 21 <212> DNA <213> VEGF Reverse Primer <400> 8 tcgatcgttc tgtatcagtc t 21 <210> 9 <211> 21 <212> DNA <213> TGF-beta 1 Forward Primer <400> 9 gccctggata ccaactattg c 21 <210> 10 <211> 21 <212> DNA <213> TGF-beta 1 Reverse Primer <400> 10 tcagcacttg caggagtagc g 21 <210> 11 <211> 20 <212> DNA <213> MSX2 Forward Primer <400> 11 aacacaagac caaccggaag 20 <210> 12 <211> 20 <212> DNA <213> MSX2 Reverse Primer <400> 12 gcagccattt tcagcttttc 20 <210> 13 <211> 21 <212> DNA <213> MITF Forward Primer <400> 13 ccagcctggc gatcatgtca t 21 <210> 14 <211> 20 <212> DNA <213> MITF Reverse Primer <400> 14 ggtctggaca ggagttgctg 20 <210> 15 <211> 20 <212> DNA <213> Tyrosinase Forward Primer <400> 15 ggccagcttt caggcagagg 20 <210> 16 <211> 20 <212> DNA <213> Tyrosinase Reverse Primer <400> 16 tggtgcttca tgggcaaaat 20 <210> 17 <211> 20 <212> DNA <213> TRP1 Forward Primer <400> 17 tctgtgaagg tgtgcaggag 20 <210> 18 <211> 20 <212> DNA <213> TRP1 Reverse Primer <400> 18 ccgaaacaga gtggaaggtt 20

Claims

A peptide exhibiting hair growth promoting activity comprising the amino acid sequence set forth in SEQ ID NO: 2.

The peptide of claim 1, wherein the peptide promotes hair cell growth.

2. The peptide of claim 1, wherein the peptide increases beta -catenin expression.

The peptide according to claim 1, wherein the peptide increases expression of a hair growth-related growth factor selected from the group consisting of Keratinocyte Growth Factor (KGF) and Vascular Endothelial Growth Factor (VEGF).

The peptide according to claim 1, wherein the peptide increases expression of PI3K (Phosphoinositide 3-kinase) and ERK (Extracellular Signal-regulated Kinase) phosphorylation.

2. The peptide of claim 1, wherein the peptide increases expression of a hair growth-related factor selected from the group consisting of MSX2 (Msh homeobox 2) and keratin-14.

2. The peptide of claim 1, wherein the peptide reduces the expression of TGF- beta 1 (transforming growth factor beta 1).

The peptide according to claim 1, wherein the peptide increases the expression of Bcl-2 (B-cell lymphoma 2) and decreases the expression of Bax (BCL2-associated X protein).

A composition for preventing or improving hair loss comprising the peptide of any one of claims 1 to 8 as an active ingredient.

A composition for promoting hair growth and hair growth, comprising the peptide of any one of claims 1 to 8 as an active ingredient.

A peptide having an activity of promoting the production of melanin comprising the amino acid sequence of SEQ ID NO: 2.

12. The peptide of claim 11, wherein the peptide increases the expression of a melanin synthesis-related factor selected from the group consisting of MITF (Microphthalmia-associated transcription factor) and TRP1 (Tyrosinase-related protein 1).

12. The peptide of claim 11, wherein the peptide increases tyrosinase expression.

14. A pharmaceutical composition for preventing or treating melanin hypoperichosis comprising the peptide of any one of claims 11 to 13 as an active ingredient.

15. The method of claim 14, wherein the hypoxia is selected from the group consisting of vitiligo, albinism, decolorizing nevi, white pangolin, flocculant, post-inflammatory decolorization, scleroderma, partial albinism, idiopathic red hypochloremia, A pharmaceutical composition for the prevention or treatment of hypopigmentation.