KR20210029883A - Composition for anti-inflammatory or whitening comprising green barley extract or its fractions and uses thereof - Google Patents

Abstract

The present invention relates to an anti-inflammatory or whitening composition containing a green barley extract or a fraction thereof, and uses thereof. Since the green barley extract or the fraction thereof of the present invention excellently inhibits nitric oxide or inflammatory cytokine levels, tyrosinase activity or melanin production in addition to a DPPH radical scavenging effect, thereby being able to be effectively provided as the anti-inflammatory or whitening composition or a composition for preventing, alleviating or treating inflammatory disease or diseases related to hyperpigmentation.

Description

Composition for anti-inflammatory or whitening comprising green barley extract or its fractions and uses thereof}

The present invention relates to an anti-inflammatory or whitening composition comprising a green barley extract or a fraction thereof, and a use thereof.

Inflammation is one of the defense mechanisms of a living body against tissue damage, external irritation, or various infectious agents. When cells or tissues are damaged or destroyed by various factors such as harmful substances or organisms introduced from the outside, It is an immune response that occurs locally to minimize this and restore the damaged area to its original state. In other words, the inflammatory reaction is a useful defense mechanism to protect the living body and remove products generated by tissue damage.

It is known that the progression of the inflammatory reaction in the body is related to the activity of the enzyme COX (cyclooxygenase). COX enzyme is a major enzyme involved in the biosynthesis of prostaglandin present in a living body, and it is known that two types of isomeric enzymes, COX-1 and COX-2, exist. COX-1 is present in tissues such as the stomach and kidneys at a certain level and is involved in maintaining homeostasis, whereas COX-2 is intracellularly induced by mitogens or cytokines during inflammation or other immune responses. It is a transient and rapidly expressed enzyme.

Another powerful inflammatory mediator, nitric oxide (NO), is produced from L-arginine by nitric oxide synthase (NOS), and external stress such as ultraviolet (UV) rays or substances such as endotoxins or cytokines Produced by many types of cells. These inflammatory stimuli increase the expression of inducible NOS (iNOS) in the cell, which in turn induces the production of nitric oxide in the cell and activates macrophages, which can trigger an inflammatory response. Accordingly, a number of studies have recently been conducted on substances or compositions capable of inhibiting the production of nitrogen monoxide as a way to effectively alleviate inflammation.

Usually, the treatment of inflammation can be promoted through anti-inflammatory action. The anti-inflammatory action refers to the action of promoting inflammation treatment by inhibiting the proliferation of invading bacteria or by activating macrophages that eat foreign substances. Steroids are currently the most potent anti-inflammatory drugs.

However, most steroid preparations are chemically synthesized substances, and when used for a long period of time, side effects such as adrenal suppression, retention of body fluids, and cataracts are often accompanied. Therefore, there is a need for research on a drug containing a natural plant extract as an active ingredient, or a substance that can be safely ingested without a separate purification process, and can suppress various inflammations.

Due to environmental pollution, the skin's exposure to ultraviolet rays is increasing, and skin color deposition due to skin aging is intensifying. In addition, as interest in skin coloring is increasing for cosmetic reasons, research to find a more stable and effective whitening material is being actively conducted. Tyrosine, a type of amino acid, is oxidized by tyrosinase to become dopa and dopaquinone, which is again 5,6-dihydroxy indole, indole. 5,6-quinone) is automatically oxidized and finally produced melanin polymer by polymerization. Related studies include studies on materials that inhibit tyrosinase activity to inhibit melanin synthesis (arbutin, kojic acid, licorice extract, black oak extract, etc.), and studies on materials that have the effect of removing the stratum corneum (AHA, BHA, amino acids, salicylic acid, etc.). , Research on UV-blocking materials (titanium dioxide, gamma-orizanol, oxybenzone, etc.), research on materials that are toxic to melanocytes to reduce the function of melanocytes, the place of melanin biosynthesis (vitamin C, etc.), active oxygen Research on removal materials (vitamin E, vitamin C) is being conducted. However, most of these have insufficient effects or are incomplete in formulation, their use is limited in terms of skin stability, and their dependence on imports is high. Recently, safer and more effective melanin production inhibitors have been developed. Many studies to do are in demand. Therefore, research on functional whitening materials using various natural extracts as an alternative whitening raw material has also been actively conducted, and Sangbaek pea, Cheonflower powder extract, Yulpi, and Mung bean are used as whitening materials, and development of excellent alternative whitening agents is urgently needed.

Republic of Korea Patent Publication No. 10-2019-0050667 relates to an antioxidant or anti-inflammatory composition containing sprout barley extract as an active ingredient, and refers to young shoots of barley (Hordeum vulgare L.) high in saponarin. Barley extract is produced to provide a composition having an antioxidant or anti-inflammatory effect.

However, there is no research or description on the anti-inflammatory or whitening effect of the extract or fraction of green barley.

Accordingly, the present inventors have made diligent efforts to provide substances derived from natural products having excellent anti-inflammatory or whitening effects without causing side effects to the human body, and as a result, it has been confirmed that green barley extract or a fraction thereof can provide effective anti-inflammatory or whitening activity. The present invention has been completed.

Accordingly, an object of the present invention is to provide an anti-inflammatory or whitening composition comprising a green barley extract or a fraction thereof, and a use thereof.

In order to achieve the object of the present invention, the present invention provides an anti-inflammatory or whitening composition comprising a green barley extract or a fraction thereof.

According to a preferred embodiment of the present invention, the green barley extract may be prepared with any one or more parts selected from the group consisting of stems, fruits, leaves, flowers, and roots of green barley.

According to a preferred embodiment of the present invention, the green barley extract may be prepared by using water, an organic solvent, or a mixture thereof as a solvent.

According to a preferred embodiment of the present invention, the green barley extract is prepared by any one or more methods selected from the group consisting of decompression high temperature extraction, hot water extraction, reflux extraction, hot water extraction, room temperature extraction, ultrasonic extraction, and steam extraction method. I can.

According to a preferred embodiment of the present invention, the fraction may be fractionated by using the green barley extract as a solvent using at least one selected from the group consisting of nucleic acid, chloroform, ethyl acetate, butanol and water.

According to a preferred embodiment of the present invention, the composition may be any one or more selected from the group consisting of a cosmetic composition, a food composition, a pharmaceutical composition, and a quasi-drug composition.

The present invention may also provide a composition for preventing, improving, or treating inflammatory diseases comprising a green barley extract or a fraction thereof.

According to a preferred embodiment of the present invention, the inflammatory disease is arthritis, rhinitis, hepatitis, keratitis, gastritis, enteritis, nephritis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, urethritis, cystitis, burn inflammation, dermatitis, allergy, atopy. , Periodontitis, gingivitis, otitis media, sore throat, arthritis, rheumatoid arthritis, tendinitis, tendonitis, neurodegenerative inflammation, and acute to chronic inflammatory diseases.

The present invention may also provide a composition for preventing, improving, or treating diseases related to hyperpigmentation, including a green barley extract or a fraction thereof.

According to a preferred embodiment of the present invention, the hyperpigmentation-related diseases include freckles, senile spots, liver spots, melasma, brown or black spots, sun pigment spots, cyanic melasma, hyperpigmentation after drug use, gestationality. It may be any one or more selected from the group consisting of hyperpigmentation after a brown spot (gravidic chloasma) and wound or inflammation.

In addition to the DPPH radical scavenging effect, the green barley extract or a fraction thereof of the present invention excellently inhibits the level of nitric oxide or inflammatory cytokines, the activity of tyrosinase, or the production of melanin, so that the composition for anti-inflammatory or whitening or inflammatory diseases or hyperpigments It can be effectively provided as a composition for preventing, ameliorating or treating deposition-related diseases.

1 is a graph showing the DPPH radical scavenging activity of the green barley extract or a fraction thereof of the present invention.
Figure 2 shows the cytotoxicity of the green barley extract or a fraction thereof to macrophages of the present invention.
3 is a graph showing the ability to inhibit nitric oxide (NO) production of a green barley extract or a fraction thereof of the present invention by concentration.
Figure 4 is a graph showing the anti-inflammatory effect of the chloroform fraction of the green barley extract of the present invention. It was confirmed that the green barley chloroform fraction significantly inhibited the expression of the inflammation-mediated cytokines IL-6, iNOS, or COX2.
Figure 5 is a graph showing the ability to inhibit the tyrosinase (Tyrosinase) activity of the green barley extract or a fraction thereof of the present invention. It was confirmed that each green barley extract or a fraction thereof inhibited tyrosinase activity in a concentration-dependent manner.
Figure 6 shows the cytotoxicity of the blue barley fraction of the present invention against melanoma cell lines.
7 is a graph showing the inhibitory effect of melanin production in a range in which the green barley fraction of the present invention does not exhibit cytotoxicity to melanoma cell lines.

Hereinafter, the present invention will be described in more detail.

As described above, materials that have been previously used to inhibit inflammation or excessive melanin production have limitations in that anti-inflammatory or whitening effects are insignificant or safety for the skin is insufficient, so an alternative agent capable of providing excellent effects is required. It was becoming.

The green barley extract or a fraction thereof of the present invention has a high total phenol and flavonoid content (Example 2), and excellent DPPH free radical scavenging activity, thereby providing a high antioxidant effect (Example 3). In addition, the green barley extract or a fraction thereof of the present invention can also provide an anti-inflammatory effect by effectively inhibiting the production of nitric oxide or the expression of inflammatory-mediated cytokines under conditions that are not toxic to macrophages (Examples 4 and Examples. 5). Additionally, the green barley extract or a fraction thereof of the present invention can also provide a whitening effect by inhibiting tyrosinase activity and significantly inhibiting its melanogenesis under conditions that are not toxic to melanogenic cells (Example 6 and implementation). Example 7).

The'blue barley' of the present invention is also referred to as green barley or blue barley belonging to the rice tree pollen family of monocotyledons. Unlike general yellow barley ( Hordeum vulgare L.), which has a yellowish color in general, it has a blue color and is similar in shape to ordinary yellow barley, so some misunderstand it as under-ripe barley. Like ordinary yellow barley, it has excellent nutritional value and is high in nutritional value, and it can also be used for food.

'Anti-inflammatory' in the present invention may be used interchangeably with'inflammation suppression or improvement', and may mean any action that alleviates an inflammatory response.

The term "whitening" of the present invention may mean any action of inhibiting, preventing, or improving skin pigmentation by inhibiting the production of melanin.

The term "prevention" of the present invention refers to any action in which inflammatory diseases or hyperpigmentation-related diseases are suppressed or the onset of the green barley or a fraction thereof of the present invention is suppressed or delayed.

The term'improvement' or'treatment' of the present invention means any action that improves or benefits the degree of symptoms related to inflammatory diseases or hyperpigmentation related diseases due to the green barley or its fractions of the present invention. .

Accordingly, the present invention can provide an anti-inflammatory or whitening composition comprising a green barley extract or a fraction thereof.

The green barley extract of the present invention may be prepared from any one or more parts selected from the group consisting of stems, fruits, leaves, flowers, and roots of green barley, and is preferably made of stems and leaves of green barley. In addition, the green barley extract may be prepared using water, an organic solvent, or a mixture thereof as a solvent. The solvent is preferably water or a C1 to C4 lower alcohol, more preferably water, methanol, ethanol or propanol, and most preferably ethanol as a solvent.

The ethanol extract of green barley may be included in the composition at a concentration of 10 to 500 µg/ml, but preferably at a concentration of 300 to 500 µg/ml.

The green barley extract may be prepared by any one or more methods selected from the group consisting of decompression high temperature extraction, hot water extraction, reflux extraction, hot water extraction, room temperature extraction, ultrasonic extraction, and steam extraction, preferably reflux extraction method. It is preferred that it has been prepared. After the extraction process, a purification process for increasing the purity of the extract, such as filtration, centrifugation, or concentration process may be additionally included. The concentration may be performed by any one or more methods selected from the group consisting of precipitation concentration, evaporation concentration, vacuum concentration, ultrafiltration method, reverse osmosis method, and centrifugation method, and it is preferable to concentrate by vacuum concentration method.

The fraction of the green barley extract may be fractionated by using the green barley extract as a solvent using at least one selected from the group consisting of hexane, chloroform, ethyl acetate, butanol, and water, preferably hexane, chloroform, or water. It may be fractionated by.

The hexane fraction of the green barley extract may be included in a concentration of 10 to 500 µg/ml, but preferably may be included in a concentration of 10 to 130 µg/ml, and more preferably in a concentration of 10 to 80 µg/ml It is desirable to be.

The chloroform fraction of the green barley extract may be included in a concentration of 10 to 500 µg/ml, but preferably in a concentration of 70 to 500 µg/ml, and more preferably in a concentration of 70 to 300 µg/ml It is preferable to be included.

The water fraction of the green barley extract may be included in a concentration of 10 to 500 µg/ml, but preferably in a concentration of 150 to 500 µg/ml.

The composition of the present invention may be any one or more selected from the group consisting of cosmetic compositions, food compositions, pharmaceutical compositions, and quasi-drug compositions.

The cosmetic composition of the present invention contains a green barley extract or a fraction thereof as an active ingredient, and a basic cosmetic composition (face wash such as lotion, cream, essence, cleansing foam and cleansing water, pack, body oil), along with dermatologically acceptable excipients, It can be prepared in the form of a color cosmetic composition (foundation, lipstick, mascara, makeup base), hair product composition (shampoo, conditioner, hair conditioner, hair gel), and soap.

The excipient is not limited thereto, but may include, for example, an emollient, a skin penetration enhancer, a colorant, a fragrance, an emulsifier, a thickener, and a solvent. In addition, fragrances, pigments, disinfectants, antioxidants, preservatives and moisturizing agents may be additionally included, and thickeners, inorganic salts, synthetic polymer materials, etc. may be included for the purpose of improving physical properties. For example, in the case of preparing a face wash and soap with the cosmetic composition of the present invention, it can be easily prepared by adding the green barley extract or a fraction thereof to a conventional face wash and soap base. In the case of preparing a cream, it can be prepared by adding a green barley extract or a fraction thereof to a cream base of a general oil-in-water (O/W) type. Synthetic or natural materials such as proteins, minerals, vitamins, etc. for the purpose of improving physical properties, such as fragrances, chelating agents, coloring agents, antioxidants, preservatives, etc., can be additionally added.

The content of the green barley extract or fractions thereof contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, and more preferably 0.01 to 5% by weight, based on the total weight of the composition. When the content is less than 0.001% by weight, the desired anti-inflammatory or whitening effect cannot be expected, and when the content is more than 10% by weight, safety or formulation may be difficult to manufacture.

When the green barley extract or a fraction thereof of the present invention is used as a quasi-drug additive, the composition may be added as it is or used with other quasi-drug components, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).

Preferably, the quasi-drug composition may be an antiseptic agent, shower foam, gagrin, wet tissue, detergent soap, hand wash, humidifier filler, mask, ointment, or filter filler.

In addition, the present invention can provide a pharmaceutical composition for preventing or treating inflammatory diseases comprising a green barley extract or a fraction thereof.

The green barley extract or its fractions are the same as those contained in the anti-inflammatory or whitening composition, so the description is replaced with the description.

The inflammatory disease is arthritis, rhinitis, hepatitis, keratitis, gastritis, enteritis, nephritis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, urethritis, cystitis, burn inflammation, dermatitis, allergy, atopic, periodontitis, gingivitis, otitis media , Sore throat, arthritis, rheumatoid arthritis, tendinitis, tendonitis, neurodegenerative inflammation, and acute to chronic inflammatory diseases.

The pharmaceutical composition of the present invention may be in various oral or parenteral dosage forms. When formulating the composition, one or more buffers (e.g., saline or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., Aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient in one or more compounds, such as starch (corn starch, wheat starch, rice starch, potato Starch), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl -It is prepared by mixing cellulose or gelatin. For example, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, pulverizing it, adding a suitable auxiliary, and processing it into a granule mixture.

In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions or syrups, and various excipients, such as wetting agents, sweeteners, fragrances or preservatives, are included in addition to water and liquid paraffin, which are commonly used simple diluents. I can. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and anti-aggregating agents, flavoring agents, emulsifying agents, solubilizing agents, dispersing agents, flavoring agents, antioxidants, packaging agents. , Pigments and preservatives, etc. may additionally be included.

Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations or suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin, glycerol, gelatin, and the like may be used.

The composition of the present invention may be administered orally or parenterally, and for parenteral administration, the composition may be used externally to the skin; Intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dura mater or intracerebrovascular injection; Transdermal administration; Alternatively, it may be formulated in the form of a nasal inhalant according to a method known in the art.

In the case of the injection, it must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof, and/or solvents or dispersion media containing vegetable oils. I can. More preferably, suitable carriers include isotonic solutions such as Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose. Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be additionally included. In addition, the injection may further contain an isotonic agent such as sugar or sodium chloride in most cases.

In the case of transdermal administration, ointments, creams, lotions, gels, external solutions, pasta, liniment, and air rolls are included. In the above, transdermal administration means that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.

In the case of inhalation dosages, the compounds used according to the invention can be used in pressurized packs or with suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered from a nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch.

The composition of the present invention is administered in a pharmaceutically effective amount. A pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of disease, severity, drug activity, drug sensitivity, administration time of the patient. , Route of administration and rate of excretion, duration of treatment, factors including concurrent drugs and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. That is, the total effective amount of the composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered for a long period in multiple doses. . It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.

The dosage of the pharmaceutical composition of the present invention varies according to the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. As a daily dosage, when parenterally administered, it is preferably administered in an amount of 0.01 to 50 mg, more preferably 0.1 to 30 mg per 1 kg of body weight per day based on the green barley extract or a fraction thereof, and when administered orally Based on the green barley extract or a fraction thereof of the present invention, per 1 kg of body weight per day, preferably 0.01 to 100 mg, more preferably 0.01 to 10 mg may be administered in an amount of 1 to several times. However, since it may increase or decrease depending on the route of administration, the severity of obesity, sex, weight, age, etc., the dosage amount does not limit the scope of the present invention in any way.

The composition of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers.

The pharmaceutical composition of the present invention may also be provided in the form of an external preparation comprising a green barley extract or a fraction thereof as an active ingredient. When the pharmaceutical composition for preventing or treating inflammatory diseases of the present invention is used as an external preparation for skin, additionally fatty substances, organic solvents, solubilizing agents, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents ), fragrances, surfactants, water, ionic emulsifiers, nonionic emulsifiers, fillers, sequestering agents, chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic activators, lipophilic activators Or it may contain adjuvants commonly used in the field of dermatology such as any other ingredients commonly used in skin external preparations such as lipid vesicles. In addition, the above ingredients may be introduced in an amount generally used in the field of dermatology.

When the pharmaceutical composition for preventing or treating inflammatory diseases of the present invention is provided as an external preparation for skin, it may be a formulation such as an ointment, patch, gel, cream, or spray, but is not limited thereto.

The present invention may also provide a health functional food composition for preventing or improving inflammatory diseases comprising a green barley extract or a fraction thereof.

The green barley extract or its fractions are the same as those contained in the anti-inflammatory or whitening composition, so the description is replaced with the description.

Since the inflammatory disease is the same as the disease targeted by the pharmaceutical composition, the description is replaced with the description.

The health functional food composition according to the present invention can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruit, canned food, jam, marmalade, etc.), fish, meat and processed foods thereof (e.g. ham, sausage) Corn beef), bread and noodles (e.g. udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, sweets, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine , Vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.), etc. can be prepared by adding the green barley extract or fractions thereof of the present invention. In addition, although not limited thereto as a nutritional supplement, it may be prepared by adding the green barley extract or fractions thereof of the present invention to capsules, tablets, pills, and the like. In addition, the health functional food is not limited thereto, but for example, liquefied, granulated, encapsulated so that the green barley extract or a fraction thereof of the present invention itself can be prepared in the form of tea, juice, and drink so that it can be consumed (health drink). It can be powdered and consumed. In addition, in order to use the green barley extract or a fraction thereof of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it may be prepared in the form of a composition by mixing the green barley extract or a fraction thereof of the present invention with a known active ingredient known to have an effect of preventing or improving inflammatory diseases.

When using the green barley extract or a fraction thereof of the present invention as a health drink, the health drink composition may contain various flavoring agents or natural carbohydrates, etc. as an additional component, like a conventional beverage. The natural carbohydrates described above include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin and cyclodextrin; It may be a sugar alcohol such as xylitol, sorbitol, and erythritol. Sweeteners include natural sweeteners such as taumatin and stevia extract; Synthetic sweeteners such as saccharin and aspartame can be used. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

In addition, the green barley extract or a fraction thereof of the present invention may be contained as an active ingredient of a food composition for preventing or improving inflammatory diseases, the amount of which is not particularly limited to an amount effective to achieve an inflammatory disease prevention or improvement action, but all It is preferably 0.01 to 100% by weight based on the total weight of the composition. The health functional food composition of the present invention may be prepared by mixing green barley extract or a fraction thereof with other active ingredients known to be effective in inflammatory diseases.

In addition to the above, the health functional food of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives. , Glycerin, alcohol, or a carbonation agent. In addition, the health functional food of the present invention may contain flesh for the manufacture of natural fruit juice, fruit juice beverage, or vegetable beverage. These ingredients may be used independently or in combination. Although the proportion of these additives is not very important, it is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The present invention may also provide a pharmaceutical composition for preventing or treating diseases related to hyperpigmentation, including a green barley extract or a fraction thereof.

The green barley extract or its fractions are the same as those contained in the anti-inflammatory or whitening composition, so the description is replaced with the description.

The hyperpigmentation-related diseases of the present invention may include all diseases in which pigmentation of the skin occurs due to excessive melanin production, but preferably freckles, senile spots, liver spots, melasma, brown or black spots, sun pigment spots , Cyanic melasma, hyperpigmentation after drug use, gestational brown spot (gravidic chloasma), and hyperpigmentation after injury or inflammation is preferably any one or more selected from the group consisting of.

Since the pharmaceutical composition has the same meaning as the pharmaceutical composition for preventing or treating the inflammatory disease, the description is replaced with the description.

The present invention may also provide a health functional food composition for preventing or improving diseases related to hyperpigmentation, including a green barley extract or a fraction thereof.

The green barley extract or its fractions are the same as those contained in the anti-inflammatory or whitening composition, so the description is replaced with the description.

The hyperpigmentation-related disease of the present invention is the same as the subject of the pharmaceutical composition for preventing or treating hyperpigmentation-related diseases, so the description is replaced with the description.

Since the health functional food composition has the same meaning as the health functional food composition for preventing or improving the inflammatory disease, the description is replaced with the description.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it is apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Preparation of green barley extract and fraction

<1-1> Preparation of green barley extract

A mixture of 20 g of pulverized green barley (Jeju Plant Resources Research Institute) and 400 ml of 70% ethanol was refluxed twice for 2 hours at 75° C., filtered, and concentrated under reduced pressure to prepare a green barley extract.

<1-2> Preparation of fractions of green barley extract

The green barley extract prepared in Example <1-1> was suspended in 100 ml of distilled water, and the same amount of hexane (100 ml) was added and shaken, and the process of collecting and concentrating the hexane soluble part was repeated three times to obtain a hexane fraction. Secured. The same method was sequentially performed to obtain a chloroform fraction, and finally a water fraction.

Analysis of Total Phenol and Flavonoid Contents of Blue Barley Extract or Fractions thereof

It was attempted to quantify phenolic substances and flavonoids using a folin-denis quantification method (gallic acid equivalent method).

Specifically, green barley extract or a fraction thereof Each sample (40 µl, 1 mg/ml) was _{mixed with 60 µl of 20% sodium carbonate (Na 2} CO ₃ , Sigma, Korea) aqueous solution and 20 µl of Folin-Ciocalteu (FC) and reacted for 10 minutes. After the reaction, the absorbance was measured at 700 nm with a microplate reader, and the total phenol content (GA mg/g) was calculated as a weight (mg) ratio of gallic acid equivalents, which is a standard sample, to the weight (g) of the dry extract. In addition, each of the green barley extract or its fraction samples (25 µl, 1 mg/ml) was _{reacted for 5 minutes by mixing 8 µl of a 5% NaNO 2} solution and 125 µl of sterile distilled water. After the reaction, _{15 µl of 10% AlCl 3} was added and the absorbance was measured at 510 nm by further reacting for 6 minutes, and the total flavonoid content as a weight (mg) ratio of catechin equivalents, which is a standard sample, to the weight (g) of the dry extract. (C mg/g) was calculated.

sample Total polyphenol content (GA mg/g) Total flavonoid content (C mg/g) 70% ethanol extract 13.58 ± 0.62 - Hexane fraction 21.86 ± 0.27 7.67 ± 3.33 Chloroform fraction 40.06 ± 0.56 13.67 ± 0.76 Water fraction 29.97 ± 0.72 -

As a result, as shown in [Table 1], it was confirmed that the chloroform fraction of the green barley extract was the highest in both the total polyphenol content and the total flavonoid content.

Analysis of Antioxidant Activity of Green Barley Extract or Fractions thereof

The electron donating ability was measured using the DPPH radical scavenging method to confirm the antioxidant effect of the green barley extract or its fraction.

Specifically, 100 µl of DPPH solution (0.2 mM) dissolved in methanol and blue barley extract diluted in methanol or a fraction thereof Each sample (100 µl; 100, 200 or 400 µg/ml) was mixed, reacted at room temperature for 10 minutes, and absorbance was measured at 517 nm with a microplate reader. The degree of free radical scavenging was expressed as a percentage based on the negative control without the addition of the samples, and comparative analysis was performed using ascorbic acid (vitamin C, 30 μM), a representative antioxidant, as a positive control. The measurement was expressed as an average value of three repeated experiments, and the percentage formula of the inhibitory ability is as shown in [Equation 1] below. A denotes sample absorbance, B denotes color control absorbance, and C denotes control absorbance.

[Equation 1]

DPPH radical scavenging activity (%) = {1-(A-B) / C} × 100

As a result, as shown in [Fig. 1], the chloroform fraction or water fraction of the green barley extract showed high DPPH radical scavenging ability in a concentration-dependent manner. The concentration of the chloroform fraction of the green barley extract 400 ㎍ / ㎖ showed the best scavenging activity (42.72%), which was confirmed to be similar to ascorbic acid (45.67%).

Analysis of Anti-inflammatory Activity of Green Barley Extract or Fractions thereof

<4-1> Confirmation of cytotoxicity of green barley extract or fractions thereof

It was attempted to confirm whether the green barley extract or a fraction thereof prepared in <Example 1> was toxic to macrophage cell lines.

Specifically, RAW 264.7 murine macrophage cell line (ATCC) was added to DMEM medium with 10% fetal bovine serum (FBS) and 1% antibiotics (penicillin and streptomycin) at 37°C (5% CO ₂ ). Cultured. Cultured cells were adhered to a 24-well plate with DMEM containing 10% FBS at 3×10 ³ cells per well for 24 hours at 37°C (5% CO _{2 ).} , 100, 200 or 400 μg/ml), lipopolysaccharides (LPS; 1 μg/ml) or quercetin (5 μM) and cultured for 72 hours. -y1)-2-5-diphenyltetrazolium bromide) was added and incubated for 3 hours in dark conditions. After culturing, the medium was removed, and 100 µl of dimethyl sulfoxide (DMSO) was added to dissolve formazan crystal, and the absorbance at 570 nm was measured to confirm the cell viability according to the following [Equation 2]. Quercetin was used as a positive control.

[Equation 2]

Cell viability (%) = (control absorbance / experimental group absorbance) × 100

As a result, as shown in [Fig. 2], except for the concentration of 200 and 400 μg/ml of the hexane fraction and 400 μg/ml of the chloroform fraction, the remaining green barley extract or its fractions are higher than those of LPS alone treatment, or It was confirmed that cytotoxicity was not observed by showing similar cell viability.

<4-2> Confirmation of Nitric Oxide Inhibitory Activity of Blue Barley Extract or Fraction

Cells cultured in the same manner as in Example <4-1> were treated with samples of various concentrations of green barley extract or fractions thereof (50, 100, 200 or 400 μg/ml) and reacted at 37° C. for 30 minutes. After the reaction, 1 µg/ml of LPS was treated and further cultured at 37° C. for 24 hours to induce nitric oxide (NO) production. Absorbance was measured using a microplate reader at 530 nm and compared with a standard calibration curve for nitrite to evaluate the ability to inhibit NO generation.

As a result, as shown in [Fig. 3], 400 ㎍ / ㎖ concentration of green barley 70% ethanol extract, 50 or 100 ㎍ / ㎖ concentration of hexane fraction and 100 or 200 ㎍ / ㎖ concentration of chloro The foam fraction significantly inhibited the generation of NO due to the LPS treatment, which was confirmed to be at a level similar to that of the positive control group. In particular, the hexane or chloroform fraction of the green barley extract most effectively inhibited NO generation.

Analysis of Inhibitory Activity of Inflammatory-mediated Cytokine Expression of Fractions

In Example <4-2>, the expression levels of IL-6, iNOS and COX2 cytokines in RAW 264.7 were confirmed according to the treatment of the chloroform fraction, which was found to have the most excellent NO production inhibitory activity.

Specifically, total RNA of RAW 264.7 cells treated with the chloroform fraction of 100 µg/ml green barley extract was extracted using TRIzol reagent, and 1 µg of RNA was mixed with oligo-dT primer and ImProm-II reverse transcriptase. And reacted at 42° C. for 60 minutes to synthesize cDNA. 1 µl of cDNA was mixed with 12.5 µl of Sensi-FAST SYBR No_ROX and 10 pmol of an inflammation-mediated cytokine gene-specific primer (Table 2). Quantitative PCR analysis was performed by reacting 40 times for 10 seconds at 60° C. and 15 seconds at 72° C. The expression level of each cytokine was normalized based on the expression level of the GAPDH gene as a control, and expressed as a relative expression level compared to the immunoglobulin E (IgE) treatment group.

gene Primer sequence (5'-3') Sequence number IL-6 F: TGCTGGTGACAACCACGGCC One R: GTACTCCAGAAGACCAGAGG 2 iNOS F: CCCTTCCGAAGTTTCTGGCAGCAGC 3 R: GGCTGTCAGAGCCTCGTGGCTTTGG 4 COX2 F: CACTACATCCTGACCCACTT 5 R: ATGCTCCTGCTTGAGTATGT 6

As a result, as shown in [Fig. 4], it was confirmed that the chloroform fraction of the green barley extract inhibited the expression of IL-6, iNOS and COX2 cytokines at a significant level.

Analysis of Tyrosinase Inhibitory Activity of Green Barley Fractions

It was attempted to confirm whether the green barley fraction could inhibit the activity of tyrosinase, which is essential for melanogenesis.

Specifically, 35 µl of 2 mM tyrosine and 40 µl of 0.1 M sodium phosphate buffer (pH 6.8) were mixed with various concentrations of green barley extract or its fraction samples (50, 100, 200, 400 µg/ml) and After mixing, 5 μl of 250 U/ml mushroom tyrosinase was added, followed by reaction at 37° C. for 10 minutes. By measuring the absorbance at 475 nm with a microplate reader, the tyrosinase inhibitory activity was evaluated by the following [Equation 3], and arbutin (0.5 mM) was used as a positive control. A is the absorbance of the sample-treated group reacted with tyrosinase, B is the absorbance of the sample-treated group without tyrosinase, C is the absorbance of the sample-treated group reacted with tyrosinase and D Is the absorbance of the sample treated group not treated with tyrosinase.

[Equation 3]

Tyrosinase inhibition rate (%) = {1-(C-D) / (A-B)} × 100

As a result, as shown in [Fig. 5], each green barley extract or a fraction thereof inhibited tyrosinase activity in a concentration-dependent manner. In particular, treatment of the water fraction of the green barley extract at a concentration of 400 ㎍/㎖ inhibited the tyrosinase activity to a level of 56.63%, which was confirmed to be at a level similar to that of the positive control group.

Effect of Blue Barley Fractions on Melanoma Cell Lines

<7-1> Cytotoxicity of the green barley fraction

It was attempted to confirm whether the fraction of the blue barley extract prepared in <Example 1> was toxic to melanoma cell lines.

Melanoma B16F10 cell line (ATCC, 6475) was cultured in a 37°C, 5% CO ₂ incubator using DMEM containing 10% FBS, and all cells in the experiment were 80 to 90% confluency. ). The cells were placed in a 96-well plate with DMEM containing 10% FBS at a rate of 3×10 ³ cells/well at 100 μl each, and cultured for 24 hours at _{37° C. and 5% CO 2.} After cultivation, the medium was removed, and extracts of different concentrations were treated and treated three times for each group, followed by incubation for 72 hours _{at 37°C and 5% CO 2.} After incubation, 5 mg/ml of MTT reagent was dispensed into the medium containing the test solution by 10 µl per well, and the 96-well plate was incubated for 3 hours by blocking the light. When the culture was completed, the medium containing the MTT reagent was removed, 100 µl of DMSO was added to dissolve the formazan crystal, and the absorbance at 570 nm was measured to confirm the cell viability according to the following [Equation 2].

[Equation 2]

Cell viability (%) = (control absorbance / experimental group absorbance) × 100

As a result, as shown in [Fig. 6], it was confirmed that treatment of the hexane fraction of 50 μg/ml and the chloroform fraction of 50 to 100 μg/ml did not affect the viability of B16F10 cells.

<7-2> Inhibitory effect of blue barley fractions on melanogenesis

The purpose of this study was to evaluate the ability to inhibit melanogenesis in melanoma cells with the concentration of the green barley fraction that did not affect the cell viability.

^{Specifically, melanoma B16F10 cells were dispensed at a concentration of 1×10 5} cells/well in a 6-well plate with DMEM containing 10% FBS, and cultured for 24 hours under conditions of 37° C. and 5% CO _2. After incubation, the medium was removed, and 50 µg/ml of the hexane fraction and 50 or 100 µg/ml of the green barley extract were added to a DMEM culture solution containing 10% FBS, respectively, and α-MSH (100 nM) was added as an inducer Incubated for 72 hours under conditions of 37° C. and 5% CO _2. After incubation, the medium was removed, washed twice with PBS, and 1 ml of PBS was dispensed per well to recover cell pellets. The recovered pellet was centrifuged at 14,000 rpm for 20 minutes, and then the supernatant was removed. The cell pellet was dried at 60° C. for 1 hour, and then 150 μl of 1M NaOH containing 10% DMSO was added and treated in a 60° C. thermostat for 1 hour to dissolve melanin in the cells. 100 µl of this lysate was placed in a 96-well plate, absorbance was measured at 405 nm with an ELISA reader, and melanin content was quantified by comparing it with a standard curve using a melanin standard solution. The melanin content inhibition rate (%) was calculated using the following [Equation 4].

[Equation 4]

Melanin content inhibition rate (%) = 1-(control melanin content / experimental group melanin content) × 100

As a result, as shown in [Fig. 7], 50 ㎍ / ㎖ of the hexane fraction melanin production of the green barley extract was suppressed to 28.96% compared to the control, which was found to be a statistically significant level than arbutin. The chloroform fraction of 50 ~ 100 ㎍ / ㎖ green barley extract was also found to have a lower level of melanin production than the positive control. In particular, the 100 ㎍ / ㎖ of green barley chloroform fraction was 20.32%, inhibiting it to a statistically significant level than arbutin. I could confirm.

SEQUENCE LISTING <110> GLOCAL Industry-Academic Cooperation Foundation Konkuk University <120> Composition for anti-inflammatory or whitening comprising green barley extract or its fractions and uses thereof <130> 1066079 <160> 6 <170> PatentIn version 3.2 <210> 1 <211> 20 <212> DNA <213> Artificial <220> <223> IL-6_F <400> 1 tgctggtgac aaccacggcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial <220> <223> IL-6_R <400> 2 gtactccaga agaccagagg 20 <210> 3 <211> 25 <212> DNA <213> Artificial <220> <223> iNOS_F <400> 3 cccttccgaa gtttctggca gcagc 25 <210> 4 <211> 25 <212> DNA <213> Artificial <220> <223> iNOS_R <400> 4 ggctgtcaga gcctcgtggc tttgg 25 <210> 5 <211> 20 <212> DNA <213> Artificial <220> <223> COX2_F <400> 5 cactacatcc tgacccactt 20 <210> 6 <211> 20 <212> DNA <213> Artificial <220> <223> COX2_R <400> 6 atgctcctgc ttgagtatgt 20

Claims (12)

Anti-inflammatory or whitening composition comprising a green barley extract or a fraction thereof.
The composition of claim 1, wherein the green barley extract is prepared from one or more parts selected from the group consisting of stems, fruits, leaves, flowers, and roots of green barley.
The composition of claim 1, wherein the green barley extract is prepared using water, an organic solvent, or a mixture thereof as a solvent.
The composition of claim 1, wherein the green barley extract is prepared by any one or more methods selected from the group consisting of decompression high temperature extraction, hot water extraction, reflux extraction, hot water extraction, room temperature extraction, ultrasonic extraction, and steam extraction method. .
The composition of claim 1, wherein the fraction is fractionated by using the green barley extract as a solvent using at least one selected from the group consisting of nucleic acid, chloroform, ethyl acetate, butanol, and water.
The composition of claim 1, wherein the composition is at least one selected from the group consisting of cosmetic compositions, food compositions, pharmaceutical compositions, and quasi-drug compositions.
A pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising a green barley extract or a fraction thereof.
8. , Otitis media, pharyngitis, arthritis, rheumatoid arthritis, tendinitis, tendonitis, neurodegenerative inflammation, and a pharmaceutical composition, characterized in that at least one selected from the group consisting of acute to chronic inflammatory diseases.
Health functional food composition for preventing or improving inflammatory diseases comprising a green barley extract or a fraction thereof.
A pharmaceutical composition for preventing or treating diseases related to hyperpigmentation, comprising a green barley extract or a fraction thereof.
The method of claim 10, wherein the hyperpigmentation-related diseases include freckles, senile spots, liver spots, melasma, brown or black spots, sun pigment spots, cyanic melasma, hyperpigmentation after drug use, gestational brown spots (gravidic chloasma) and any one or more selected from the group consisting of hyperpigmentation after wound or inflammation.
Health functional food composition for preventing or improving hyperpigmentation-related diseases, including a green barley extract or a fraction thereof.

Images