KR20210028618A - Composition for Preventing or Treating Muscular disease containing Artemisia dracunculus L. extract - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscular diseases including sarcopenia, muscular atrophy, muscular dystrophy, muscle degeneration, and the like, which contains an Artemisia dracunculus extract. More specifically, the Artemisia dracunculus extract of the present invention increases the expression amount of genes producing muscle protein, reduces the expression amount of genes destroying muscle protein, and thus exhibits antioxidant and anti-inflammatory effects. Therefore, the Artemisia dracunculus extract of the present invention can be usefully used as a therapeutic agent for muscle diseases derived from natural products without side effects.

Description

Composition for preventing or treating muscle diseases containing tarragon (Tarragon, Little Dragon, Mugwort, Estragon) extract {Composition for Preventing or Treating Muscular disease containing Artemisia dracunculus L. extract}

The present invention relates to a composition for preventing or treating muscle diseases including sarcopenia, muscular atrophy, muscular dystrophy, muscle degeneration, etc., containing extracts of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) .

Muscle (Muscle) is responsible for about 40% of the human body, and in order to maintain the functional ability of the human body and prevent metabolic diseases, it is essential to secure adequate muscle mass. It is largely divided into smooth muscle, cardiac muscle, and skeletal muscle, and skeletal muscle occupies a significant part of the entire body and promotes the movement of the skeleton.

Muscle diseases go through a course in which walking and mobility functions gradually become impaired due to weakening of skeletal muscles, and activities of daily living (ADL) become difficult and independent life becomes impossible. In addition, since it causes cardiopulmonary dysfunction and causes other complications, it is important to accurately understand and approach the characteristics of each muscle disease.

In sarcopenia, the motor nerve that induces the contraction of the skeletal muscle is degenerated and the contraction of the skeletal muscle does not proceed, or the expression of the protein involved in the contraction of the muscle in the skeletal muscle is decreased or altered, so that the normal skeletal muscle contraction does not proceed In the long term, it is known that the motor nerves or skeletal muscles are transformed into fibrous tissue. It is also known to be caused by various causes, such as aging, hormonal abnormalities, poor nutrition, lack of physical activity, inflammatory and degenerative diseases.

It is known that exercise, protein, and calorie supplementation are helpful for sarcopenia, but it is not very helpful in the elderly, who make up the majority of sarcopenia patients, so there is an urgent need for a treatment for sarcopenia. However, currently, the drugs used for sarcopenia have a direct effect on improving muscle loss and increasing muscle mass, and are still at the level of clinical trials, and there are currently no drugs that have been finally approved by the FDA.

Inflammatory myopathy is known that inflammation occurs in muscles and surrounding tissues, and the inflammation destroys muscle tissues, weakening the muscles, resulting in loss of strength and muscle pain, and in the long term, muscle atrophy may occur due to reduced muscle mass. Because the muscles are inflamed, they are sometimes called myositis and are largely classified into polymyositis and dermatomyositis. It is known that it is an autoimmune disease caused by abnormalities in the body's immune system and can be caused by viruses or some drugs (penicillamine, alpha interferon, cimetidine, phenytoin, hepatitis B vaccine, etc.).

As a drug for treating polymyositis or dermatomyositis, steroids are mainly used, and the response is improved in 70 to 80% of patients. Used as a high-concentration oral therapy or as an injection, muscle strength may be remarkably improved, but side effects (weight gain, osteoporosis, worsening diabetes, heartburn, indigestion, worsening stomach ulcers, etc.) occur, and other immunosuppressants (imuraan Etc.) are used together. In addition, intravenous immunoglobulins are sometimes used when the therapeutic effect of various immunosuppressants is inferior or cannot be used due to side effects. On the other hand, recently developed immunosuppressants are known to have some effects on multiple myositis, but the development of therapeutic agents without side effects is constantly required.

In addition, muscular atrophy is a disease in which the muscles of the limbs are atrophy, and the expression of MuRF-1 and Atrogin-1 is increased to break down the myosin heavy chain of the muscles, resulting in muscle atrophy, which decreases the size of the muscles. It is known to be done.

On the other hand, as a related prior art, Korean Patent No. 1,921,085 relates to a pharmaceutical composition for the treatment of sarcopenia or muscular atrophy comprising a glucagon-like peptide-1 (GLP-1), a GLP-1 derived peptide, or a GLP-1 degradation inhibitor, Disclosed is a composition exhibiting an effect selected from the group consisting of weight gain, skeletal muscle weight increase, increased expression of a gene that produces muscle protein, suppression of expression of a gene that destroys muscle protein, and combinations thereof.

In addition, Korean Patent No. 1,809,156 relates to a composition for preventing, improving, or treating muscle diseases or improving muscle function, including fucosterol, fucosterol, maternal and maternal crushed material, maternal and maternal extract, maternal and soybean crushed product Alternatively, the extract of Fudo chinensis increases the protein expression of p-mTOR, a major gene involved in muscle protein synthesis, suppresses the mRNA expression of MuRF-1 and Atrogin-1, which are involved in muscle protein degradation, and the mRNA expression of MyoD and Myogenin, which are involved in muscle differentiation. As it increases, it has the effect of remarkably enhancing muscle function, and it is a natural product, so it is disclosed that it can be safely used without side effects.

However, the above documents only disclose genes that produce and degrade muscle proteins, and the antioxidant and anti-inflammatory effects of tarragon extract, increase the expression levels of MyoD and Myogenin genes that produce muscle proteins, and Atrogin-1 and destroy muscle proteins. The efficacy of reducing the expression level of the MuRF-1 gene is not disclosed.

Accordingly, the inventors of the present invention endeavored to develop a natural product having an effect of improving muscle reduction, and as a result, the extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) has antioxidant and anti-inflammatory effects. It was newly identified that it can increase the expression levels of MyoD and Myogenin genes that produce muscle proteins, and decrease the expression levels of Atrogin-1 and MuRF-1 genes that destroy muscle proteins, and use the tarragon extract to treat muscle diseases. By revealing that it can be used in, the present invention was completed.

Korean Patent No. 1,921,085 Korean Patent No. 1,809,156

The present invention is to provide a pharmaceutical composition for preventing or treating muscle diseases containing an extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) as an active ingredient, and health food.

The present invention provides a pharmaceutical composition for preventing and treating muscle diseases containing an extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) as an active ingredient.

In addition, the present invention provides a health food for preventing or improving muscle diseases containing tarragon extract as an active ingredient.

The extract of tarragon according to the present invention (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) extracts not only antioxidant and anti-inflammatory effects, but also increases the amount of gene expression that produces muscle proteins, destroys muscle proteins. Since it reduces the amount of gene expression, it can be usefully used in the treatment of various muscle diseases.

1 is a schematic diagram of a tarragon extract manufacturing process according to the solvent.
2 is a diagram confirming the cytotoxicity of tarragon extract.
3 is a diagram showing the measurement result of ROS production of tarragon extract.
Figure 4 is a diagram showing the result of measuring the amount of IL-1β production of ethanol extract of tarragon.
Figure 5 is a diagram showing the measurement result of IL-6 production of tarragon extract.
6 is a diagram confirming the cytotoxicity of tarragon extract against C2C12 cells.
7 is a diagram showing the result of measuring the MyoD gene expression level of the hot water extract of tarragon.
8 is a diagram showing the result of measuring the expression level of Myogenin gene in a tarragon extract.
9 is a diagram showing the result of measuring the Atrogin-1 gene expression level of ethanol extract of tarragon.
10 is a diagram showing the measurement result of MuRF-1 gene expression level of ethanol extract of tarragon.
11 is a view showing a picture taken with an optical microscope of the change in the area of the root canal of the hot water extract of tarragon.
12 is a view showing the measurement result of the change in the area of the root canal of the hot water extract of tarragon.

Hereinafter, the present invention will be described in more detail.

It provides a pharmaceutical composition for preventing or treating muscle diseases containing the extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) of the present invention as an active ingredient.

The tarragon extract is preferably prepared by a manufacturing method comprising the following steps, but is not limited thereto:

1) extracting by adding an extraction solvent to tarragon;

2) filtering the extract of step 1); And

3) A step of drying after concentrating the filtered extract of step 2) under reduced pressure.

In the above method, the extraction solvent of step 1) is preferably extracted using water, C ₁ to C ₂ lower alcohol or a mixture thereof as a solvent, but is not limited thereto.

In the above method, the lower alcohol of step 1) is preferably ethanol or methanol, but is not limited thereto.

In the above method, the vacuum concentration in step 3) is preferably a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, the drying is preferably vacuum drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

The tarragon extract has antioxidant and anti-inflammatory effects, and preferably has an effect of preventing or treating muscle diseases through the effect of increasing the amount of gene expression that generates muscle protein and reducing the amount of gene expression that destroys muscle protein. It doesn't work.

The muscle diseases include sarcopenia, muscle atrophy, myasthenia, muscle dystrophy, myotonia, hypotonia, muscle weakness, and muscle weakness. It is preferably one or more diseases selected from the group consisting of (muscular dystrophy), amyotrophic lateral sclerosis, and inflammatory myopathy.

In a specific embodiment of the present invention, the present inventors prepared tarragon hot water or ethanol extract (see Fig. 1).

In addition, in order to confirm the cytotoxicity of the tarragon extract, the extract was treated with RAW 264.7 cells and the absorbance was measured at 450 nm. As a result, it was confirmed that the tarragon extract did not show cytotoxicity (FIG. 2, Table 5, and Table 6). Reference).

In addition, in order to confirm the antioxidant effect of the tarragon extract, the extract was treated with RAW 264.7 cells and the change according to the intensity of fluorescence intensity was measured with a flow cytometer. As a result, the extract of the tarragon extract reduced the amount of ROS (reactive oxygen species) produced. Therefore, it was confirmed that there is an antioxidant effect (see Fig. 3 and Table 7).

In addition, in order to confirm the anti-inflammatory effect of the tarragon extract, the extract was treated with RAW 264.7 cells and measured with Luminex. As a result, the tarragon extract decreased the production of IL-1β and IL-6, and thus it was confirmed that it has an anti-inflammatory effect. (See Fig. 4, Fig. 5, Table 8 and Table 9).

In addition, in order to confirm the therapeutic effect of the tarragon extract on muscle diseases, the extract was treated with C2C12 cells and the absorbance was measured at 450 nm. As a result, it was confirmed that the tarragon extract did not show toxicity to muscle cells (Fig. 6, Table 10). And Table 11).

In addition, in order to confirm the therapeutic effect of tarragon extract on muscle diseases, as a result of confirming the effect of expression of genes involved in muscle protein synthesis or degradation by processing the extract on C2C12 cells, tarragon extract was found to be MyoD gene and Myogenin gene involved in muscle synthesis. It was confirmed that the expression was increased and the Atrogin-1 gene and MuRF-1 gene expression involved in muscle decomposition were reduced, so that there was an effect of treating muscle diseases (FIGS. 7, 8, 9, 10, Table 13, Table 14, Table 15 and Table 16).

In addition, in order to confirm the muscle disease treatment effect of the tarragon extract, as a result of measuring the root canal area by treating the extract to C2C12 cells, it was confirmed that the tarragon extract increased the root canal area, thus having an effect of treating muscle diseases (Fig. 11). , See Figure 12 and Table 17).

Therefore, the extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) of the present invention exhibits antioxidant or anti-inflammatory effects, and genes involved in increasing and degrading gene expression involved in muscle protein synthesis By showing the effect of reducing expression and increasing the width of the root canal, the tarragon extract can be usefully used in a pharmaceutical composition for preventing or treating muscle diseases.

The composition containing the tarragon extract of the present invention may contain one or more active ingredients exhibiting the same or similar functions in addition to the above ingredients.

The composition of the present invention may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose , Mannitol, syrup, arabic rubber, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate , Sucrose, dextrose, sorbitol and talc, and the like may be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

That is, the composition of the present invention can be administered in various oral and parenteral dosage forms at the time of actual clinical administration.When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. It can be prepared using. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and these solid preparations include at least one excipient, such as starch, calcium carbonate, and sucrose in the tarragon extract. ), lactose, or gelatin. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, and syrups, but may include various excipients, such as humectants, sweeteners, fragrances, and preservatives, in addition to water and liquid paraffin, which are commonly used simple diluents. . Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The composition of the present invention may be administered orally or parenterally according to a desired method, and when administered parenterally, external skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection injection method It is preferable to choose. The dosage range varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and disease severity.

The composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of disease, severity, and drug activity of the patient. , Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.

Specifically, the effective amount of the composition according to the present invention may vary depending on the age, sex, and weight of the patient, and generally 0.1 mg to 100 mg, preferably 0.5 mg to 10 mg per 1 kg of body weight is administered daily or every other day. Alternatively, it can be administered in 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, the severity of obesity, sex, weight, age, etc., the dosage amount does not limit the scope of the present invention in any way.

In addition, it provides a health food for preventing or improving muscle diseases containing the tarragon extract of the present invention as an active ingredient.

The tarragon extract is preferably one that has an activity for preventing or improving muscle disease, but is not limited thereto.

Since the tarragon extract of the present invention exhibits a significant effect of preventing or treating muscle diseases, the tarragon extract may be usefully used as a health food composition for preventing or improving muscle diseases.

There is no particular limitation on the type of the food. Examples of foods to which the above substances can be added include various foods such as confectionery, bread, and noodles, drinks such as water, soft drinks, fruit drinks, gum, tea, vitamin complexes, seasonings, health functional foods, etc. It includes all health functional foods in the usual sense.

The tarragon extract of the present invention may be added to food as it is or may be used with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined depending on the purpose of use (for prevention or improvement). In general, the amount of the compound in the health food may be added in 0.01 to 15% by weight, preferably 0.1 to 5% by weight of the total food weight, and in the health beverage composition, 0.01 to 5.0 g, preferably 0.01 to 5.0 g based on 100 It can be added in a proportion of 1.0 g. However, in the case of long-term intake for the purpose of health control, the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

The health functional beverage composition of the present invention is not particularly limited in other ingredients except for containing the compound as an essential ingredient in the indicated ratio, and may contain various flavoring agents or natural carbohydrates as additional ingredients, such as in a conventional beverage. Examples of the natural carbohydrates described above include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like, and polysaccharides such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumachin, stevia extract, etc.) and synthetic flavoring agents (saccharin, aspartan, etc.) can be advantageously used. The proportion of the natural carbohydrate is generally about 0.1 to 2.0 g, preferably about 0.1 to 1.0 g per 100 of the composition of the present invention.

The health functional food of the present invention can be easily obtained by adding the extract of the present invention described above during the manufacturing process of the food or by adding the extract of the present invention described above after the preparation of the food. At this time, taste and odor correction agents may be added as needed.

In addition to the above, the tarragon extract of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and weighting agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid, and It may contain salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. In addition, the tarragon extract of the present invention may contain pulp for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not so important, but is generally selected in the range of about 20 parts by weight per 100 parts by weight of the tarragon extract of the present invention.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples specifically illustrate the present invention, and the contents of the present invention are not limited by the Examples and Experimental Examples.

<Example 1> Preparation of tarragon extract

<1-1> Preparation of ethanol extract of tarragon

Tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) was extracted for 8 to 14 hours at 45 to 75°C using 16 times the amount of 70% ethanol of the sample, and filtered under reduced pressure (Whatman filter paper #2) was concentrated and then stored at -20°C.

In addition, the extraction yield according to the extraction temperature and extraction time is shown in the following [Table 1] and [Table 2].

Meanwhile, in the following experimental example, an experiment was performed using an ethanol extract of tarragon extracted at 75° C. for 12 hours using 70% ethanol.

Samples yield(%) 8 hr 10 hr 12 hr 14 hr Ethanol extract of tarragon 20.1 24.5 28.9 29.0

Samples yield(%) 45℃ 55℃ 65℃ 75℃ Ethanol extract of tarragon 18.3 21.5 24.3 28.9

<1-2> Preparation of hot water extract of tarragon

Extraction was performed at 65 to 95° C. for 8 to 14 hours using 16 times the amount of distilled water of the tarragon sample, cooled to room temperature, filtered and concentrated to prepare a tarragon hot water extract.

In addition, the extraction yield according to the extraction temperature and extraction time is shown in the following [Table 3] and [Table 4].

On the other hand, in the following experimental example, an experiment was performed using a hot water extract of tarragon extracted at 95° C. for 12 hours using distilled water.

Samples yield(%) 8 hr 10 hr 12 hr 14 hr Tarragon Hot Water Extract 20.1 24.5 28.9 29.0

Samples yield(%) 65℃ 75℃ 85℃ 95℃ Tarragon Hot Water Extract 12.5 15.3 17.7 18.9

<Experimental Example 1> Confirmation of cytotoxicity

<1-1> RAW 264.7 cell subculture

The frozen RAW 264.7 cells were transferred to a 50 ml tube, and 9 ml of PBS was added to suspend the cells, followed by centrifugation at 1,200 rpm for 5 minutes to remove the supernatant. Cells were suspended in 1 ml of DMEM (Dulbecco's modified Eagle's medium) medium composed of 10% FBS (fetal bovine serum) and 1% penicillin/streptomycin, and cultured in a cell incubator (37° C., 5% CO ₂ ). The number of passages was 5 or more, and 24 hours were acclimated before processing the samples.

<1-2> Cytotoxicity measurement

To measure the cytotoxicity of the tarragon extract, RAW 264.7 cells cultured in Experimental Example <1-1> were used. RAW 264.7 cells were dispensed into a 96 well plate at 1.5×10 ⁵ cells/well and cultured in a cell incubator (37° C., 5% CO ₂ ) for 24 hours. After cultivation, it was replaced with a new culture solution, and the tarragon extract was treated at concentrations of 25, 50 and 100 µg/ml, and then cultured in a cell incubator for 24 hours. After incubation, 10 µl of WST solution was added and _{reacted in a cell incubator (37° C., 5% CO 2} ) for 30 minutes. After the reaction, the absorbance was measured at 450 nm, and the cell viability for the control group not treated with the tarragon extract was expressed as a percentage.

As a result, as shown in [Fig. 2], [Table 5] and [Table 6], the result of measuring cytotoxicity through RAW 264.7 cells was 100.0±1.0% of the control group, and all treatment concentrations of the tarragon extract It was confirmed that the survival rate of 90% or more appeared compared to the control group in (Fig. 2).

Unit:% Sample Name Control 25 μg/ml 50 μg/ml 100 μg/ml Ethanol extract of tarragon 100.0±1.0 105.7±9.9 101.4±7.3 93.0±4.1

Unit:% Sample Name Control 25 μg/ml 50 μg/ml 100 μg/ml Tarragon Hot Water Extract 100.0±1.0 103.5±5.1 107.5±4.0 101.0±4.8

The following experiment was carried out by selecting a concentration of 50 μg/ml among the concentrations in which cytotoxicity was not confirmed.

<Experimental Example 2> Confirmation of antioxidant effect

In order to confirm the antioxidant effect of the tarragon extract, the production amount of ROS (Reactive oxygen species) was measured using RAW 264.7 cells prepared in Experimental Example <1-1>.

RAW 264.7 cells were dispensed into a 12 well plate at 2×10 ⁵ cells/well and cultured in a cell incubator (37° C., 5% CO ₂ ) for 24 hours. After cultivation, it was replaced with a new culture solution, and LPS was treated at a concentration of 50 µg/ml of tarragon extract at a concentration of 1 µg/ml, and then cultured in a cell incubator for 24 hours. After incubation, the collected cells were centrifuged at 4°C and 1,200 rpm for 5 minutes, washed twice with PBS, and DCFH-DA (2',7'-dichlorodihydrofluorescein diacetate) was added to 20 μM, followed by staining in a cell incubator for 15 minutes. . After staining, centrifuge again at 4°C and 1,200 rpm for 5 minutes, remove the supernatant, and then suspend 400 µl of PBS again and measure the change according to the intensity of fluorescence intensity using a flow cytometer. Expressed as a percentage.

As a result, as shown in [Fig. 3] and [Table 7], when the ROS production amount of the control group treated with LPS alone was 100.0±1.0%, it was confirmed that the tarragon extract significantly reduced ROS production ( Fig. 3).

Unit: pg/ml Sample
Name Nor Con 50 μg/ml Sample
Name Nor Con 50 μg/ml Tarragon
ethanol
extract 25.9
±4.3 100.0
±1.0 61.5±1.0 Tarragon
Hydrothermal
extract 19.0
±4.4 100.0
±1.0 61.9±1.3

<Experimental Example 3> Confirmation of anti-inflammatory effect

In order to confirm the anti-inflammatory effect of the tarragon extract, the amount of cytokine produced was measured using RAW 264.7 cells prepared in Experimental Example <1-1>.

RAW 264.7 cells were dispensed into a 12 well plate at 2×10 ⁵ cells/well and cultured in a cell incubator (37° C., 5% CO ₂ ) for 24 hours. After cultivation, it was replaced with a new culture solution, treated with a concentration of 50 µg/ml of tarragon extract and 1 µg/ml of LPS, and then cultured in a cell incubator for 24 hours. After incubation, the supernatant was obtained by centrifugation at 1,200 rpm for 5 minutes, and measured as follows using an article composed of a Milliplex map mouse cytokine/chemokine magnetic bead panel-immunology multiplex assay kit. 25 µl of the supernatant was dispensed into a 96 well plate, 25 µl of each of the assay buffer, matrix buffer, and antibody-immobilized beads were added and mixed, followed by reaction at room temperature for 2 hours and washed twice using a washing buffer solution. After washing, 25 µl of detection antibody was added to react in the dark for 1 hour at room temperature, and 25 µl of Streptavidin-Phycoerythrin was added to react at room temperature for 30 minutes, followed by washing twice using a washing buffer solution. After washing, 150 µl of PBS was added, shaken for 5 minutes, and measured using Luminex.

As a result, as shown in [Fig. 4] and [Table 8], when the IL-1β production amount of the control group treated with only LPS was 123.3±3.3 pg/ml, the ethanol extract of tarragon of the present invention was the IL-1β It was confirmed that the production was significantly reduced (FIG. 4).

Unit: pg/ml Sample Name Nor Con 50 μg/ml Ethanol extract of tarragon 46.0±0.8 123.3±3.3 93.9±8.3

In addition, as shown in [Fig. 5] and [Table 9], when the IL-6 production amount of the control group treated with LPS alone was 151839.8±2593.1 pg/ml and 145561.7±18836.0 pg/ml, respectively, the tarragon of the present invention The extracts were 111151.5±13370.4 and 100273.6±12658.0, respectively, and it was confirmed that IL-6 production significantly decreased (FIG. 5).

Unit: pg/ml Sample
Name Nor Con 50 μg/ml Sample
Name Nor Con 50 μg/ml Tarragon
ethanol
extract 116.8
±27.3 151839.8
±2593.1 111151.5
±13370.4 Tarragon
Hydrothermal
extract 118.3
±12.7 145561.7
±18836.0 100273.6
±12658.0

Therefore, it was confirmed that the tarragon extract of the present invention decreases the production of IL-1β and IL-6, which are inflammatory cytokines, and thus exhibits a significant anti-inflammatory effect.

<Experimental Example 4> Confirmation of the effect of tarragon extract on the treatment of muscle diseases

<4-1> reagent

Reagents include Dulbecco's Modified Eagle's Medium (DMEM; Gibco BRL, USA), fetal bovine serum (FBS; Gibco BRL, USA), trypsin-EDTA (Thermofisher, USA), trypan blue (Sigma Co., USA), EZ-Cytox ( Daeilab, Korea), dulbecco's phosphate buffered saline (Welgene, Korea), RIPA buffer (Thermo Co., USA), sample loading buffer (BIO-RAD Co., Japan), 30% Acrylamide/Bis Solution 29:1(3.3%) C) (BIO-RAD Co., Japan), Skim Milk (BD Co., France), Pierce BCA Proein Assay Kit (Thermo Co., USA), TEMED (BIO-RAD Co., Japan), phosphorylation-AKT ( p-AKT), AKT, phosphorylation-mTOR (p-mTOR), mTOR antibody (Danvers., USA), Protease inhibitor cocktail, phosphatase inhibitor cocktail (Sigma Co., USA), Total RNA prep kit (Intronbio, Korea), AccuPower CycleScript RT PreMix (Bioneer, Korea), SYBR Green (Qiagen, Germany), etc. were used.

<4-2> Device

Instruments are centrifuge (Sigma Co., USA), deep-freezer (Sanyo Co., Japan), vortex mixer (Vision scientific Co., Korea), plate shaker (Lab-Line Co., USA), ELISA reader (Molecular Devices) Co., USA), optical microscope (Carl ZEISS Co., Germany), Light Microscope (Carl Zeiss, Co., Germany), Mini-Protean tetra Cell (BIO-RAD Co., Japan), Nanodrop (Thermo fisher, USA) ), Alpha Cycler 1 PCRmax (PCRmax, UK) real time PCR (Qiagen, Germany), etc. were used.

<4-3> C2C12 cell subculture

C2C12 cells were purchased from the American Type Culture Collection (ATCC, USA), and cultured in a cell incubator (37° C., 5% CO ₂ ) using DMEM medium added with 10% FBS.

<4-4> Cytotoxicity measurement

In order to measure the cytotoxicity of the tarragon extract to muscle cells, C2C12 cells cultured in Experimental Example <4-3> were used. C2C12 cells were aliquoted into 96 well plates at 1×10 ⁴ cells/well and cultured for 24 hours. It was replaced with a new culture solution, and the tarragon extract was treated at concentrations of 25, 50 and 100 µg/ml, and cultured for another 48 hours. After incubation, 10 µl of EZ-Cytox solution was added and reacted in a cell incubator for 30 minutes. After the reaction, the change in absorbance at 450 nm was measured, and the cell viability of the control group not treated with the tarragon extract was expressed as a percentage.

As a result, as shown in [Fig. 6], [Table 10] and [Table 11], the result of measuring cytotoxicity through C2C12 cells was 100.00±2.25% for the control group, at all treatment concentrations of the tarragon extract. It was confirmed that a survival rate of 90% or more appeared compared to the control group (Fig. 6).

Unit:% Sample Name Control 25 μg/ml 50 μg/ml 100 μg/ml Ethanol extract of tarragon 100.0±2.25 114.37±4.92 116.46±4.92 136.48±2.16

Unit:% Sample Name Control 25 μg/ml 50 μg/ml 100 μg/ml Tarragon Hot Water Extract 100.0±2.29 115.41±12.59 111.71±7.14 93.10±2.52

The following experiment was carried out by selecting a concentration of 50 μg/ml among the concentrations in which cytotoxicity was not confirmed.

<4-5> Confirmation of the effect of gene expression involved in muscle protein synthesis or degradation

C2C12 cells prepared in Experimental Example <4-3> were used to confirm the effect of expression of genes involved in the synthesis or degradation of muscle proteins of the tarragon extract.

C2C12 cells were aliquoted into 6 well plates at 6×10 ⁵ cells/well and cultured for 24 hours. After 24 hours, the medium was replaced with a differentiation medium for cell differentiation, and the medium was changed every two days for 6 days. After 6 days, 50 ㎍ / ㎖ + TNF-α was treated and reacted for 48 hours again. 1 ml of cell lysis buffer was added and mixed, then 200 μl of chloroform was added and mixed again. After centrifugation at 13,000 rpm for 10 minutes, 400 µl of the supernatant was collected, 400 µl of the binding buffer was added, mixed, injected into a column, and centrifuged. 700 µl of washing buffer A was added to the column for centrifugation, and 700 µl of washing buffer B was added to each column, followed by centrifugation, and 50 µl of elution buffer was added and centrifuged to extract RNA.

For the reverse transcription reaction, 1 µg of total RNA was added to the RT premix (reverse transcriptase, reaction buffer, dNTPs, dT20 primer, stabilizer), and diethyl pyrocarbonate (DEPC)-treated distilled water was added to a final volume of 20 µl. . After mixing this mixture, centrifugal sedimentation at 2,000 rpm for 5 seconds and reacting for 60 minutes in a 45°C heating block to synthesize first-strand cDNA. This was reacted again at 95° C. for 5 minutes to inactivate M-MLV RT, and then the synthesized cDNA was used for PCR.

In order to amplify the synthesized cDNA, real-time PCR was performed, and 1 µl of cDNA, 2 µl of each primer, 10 µl of SYBR Green, 5 µl of DEPC-DW were added to a real-time dedicated tube. The reaction was performed at 94°C for 5 minutes, followed by 15 seconds at 94°C, 30 seconds at the annealing temperature of each primer, 30 seconds at 72°C, and reacted at 94°C for 1 minute, followed by reaction at 55°C for 1 minute. Finally, the final process of generating SYBR Green, a fluorescent conjugation material, was performed by increasing the primer annealing by 0.5℃ to 94℃ by 0.5℃ until reaching 94℃. The sequence and annealing temperature of the primer used are shown in [Table 12].

<Real-time PCR primer sequence>
F: forward, R: reverse Primer F/R Sequences Size
(bp) Annealing
Temp. (℃) MyoD F ATGATGACCCGTGTTTCGACT (SEQ ID NO: 1) 119 65 R CACCGCAGTAGGGAAGTGT (SEQ ID NO: 2) Myogenin F GCAGGCTCAAGAAAGTGAATGA (SEQ ID NO: 3) 122 65 R TAGGCGCTCAATGTACTGGAT (SEQ ID NO: 4) Atrogin-1 F TCAAAGGCCTCACGCGATCACC (SEQ ID NO: 5) 215 65 R CCTCAATGACGTATCCCCCG (SEQ ID NO: 6) MuRF-1 F GAGGGGCTACCTTCCTCTCA (SEQ ID NO: 7) 210 65 R TTTACCCTCTGTGGTCACGC (SEQ ID NO: 8) GAPDH F TGCTGCATACGAGCATCCAT (SEQ ID NO: 9) 167 59 R TGTCCTCAAAGTGAACCGCA (SEQ ID NO: 10)

As a result, as shown in [FIG. 7] and [Table 13], when the MyoD gene expression level of the control group treated with only TNF-α was 1.00±0.00%, the tarragon hot water extract of the present invention showed MyoD gene expression. It was confirmed that it was significantly increased (Fig. 7).

Unit:% Sample Name Nor Con 50 μg/ml Tarragon Hot Water Extract 3.20±0.49 1.00±0.00 5.10±0.56

In addition, as shown in [Fig. 8] and [Table 14], when the Myogenin gene expression level of the control group treated with only TNF-α was 1.00±0.00%, the tarragon extract of the present invention significantly increased Myogenin gene expression. It was confirmed to be made (Fig. 8).

Unit:% Sample
Name Nor Con 50 μg/ml Sample
Name Nor Con 50 μg/ml Tarragon
ethanol
extract 0.90
±1.0 1.00
±0.00 5.20±0.92 Tarragon
Hydrothermal
extract 0.90
±1.0 1.00
±0.00 1.60±0.12

In addition, as shown in [Fig. 9] and [Table 15], when the Atrogin-1 gene expression level of the control group treated with only TNF-α was 1.00±0.00%, the ethanol extract of tarragon of the present invention was Atrogin-1 It was confirmed that the gene expression was significantly reduced (FIG. 9).

Unit:% Sample Name Nor Con 50 μg/ml Ethanol extract of tarragon 0.80±0.03 1.00±0.00 0.50±0.08

In addition, as shown in [Fig. 10] and [Table 16], when the expression level of MuRF-1 gene of the control group treated with only TNF-α is 1.00±0.00%, the ethanol extract of tarragon of the present invention is MuRF-1 gene It was confirmed that the expression was significantly reduced (FIG. 10).

Unit:% Sample Name Nor Con 50 μg/ml Ethanol extract of tarragon 0.40±0.12 1.00±0.00 0.10±0.03

Therefore, the tarragon extract of the present invention increases the expression of the MyoD gene and the Myogenin gene involved in muscle synthesis and reduces the expression of the Atrogin-1 gene and MuRF-1 gene involved in muscle degradation, so the tarragon extract can be used for the treatment of sarcopenia. Was confirmed.

<4-6> Measurement of canal width

C2C12 cells prepared in Experimental Example <4-3> were used to confirm the effect of increasing the root canal width of the tarragon extract.

C2C12 cells were aliquoted into 6 well plates at 6×10 ⁵ cells/well and cultured for 24 hours. After 24 hours, the culture medium was replaced with a differentiation medium for cell differentiation, and the medium was changed every two days for 6 days. After 6 days, 50 ㎍ / ㎖ + TNF-α was treated and reacted for 48 hours again. After 48 hours reaction, the cell root canal width was confirmed with an optical microscope equipped with a digital camera.

As a result, as shown in [Fig. 11], [Fig. 12] and [Table 17], in the case of the control group treated with only TNF-α, the root canal area was 13.8±1.38 cm, and in the group treated with tarragon hot water extract, 22.20±2.47 cm It was confirmed that the area was significantly increased (Figs. 11 and 12).

Unit: cm Sample Name Nor Con 50 μg/ml Tarragon Hot Water Extract 31.2±2.06 13.8±1.38 22.20±2.47

Claims (2)

Contains an extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) as an active ingredient, wherein the extract is extracted with a mixed solvent of water and ethanol, which increases the expression of Myogenin. That,
A muscle disease selected from the group consisting of muscle dystrophy, myotonia, hypotonia, muscle weakness, muscle dystrophy, and amyotrophic lateral sclerosis. Pharmaceutical composition for prophylaxis or treatment.
Contains an extract of tarragon (English: Tarragon, Little Dragon, Mugwort, Estragon, scientific name: Artemisia dracunculus L.) as an active ingredient, wherein the extract is extracted with a mixed solvent of water and ethanol, which increases the expression of Myogenin. That,
A muscle disease selected from the group consisting of muscle dystrophy, myotonia, hypotonia, muscle weakness, muscle dystrophy, and amyotrophic lateral sclerosis. Health food for prevention or improvement.

Images