KR20200100543A - Novel silica forming peptides, and Method for manufacturing silica particles using the same - Google Patents

Abstract

The present invention relates to a silica synthesis peptide and a method for synthesizing silica particles using the same. In the present invention, provided is a novel silica synthesis peptide capable of controlling the size of silica nano particles by mixing ferritin (Kpa-Fn/Kpt-Fn) in which silica forming peptide is fused to the amino-terminus of the ferritin and another ferritin (Fn) without the silica forming peptide in a predetermined ratio taking advantage of properties the ferritin that each of 24 subunits of ferritin is gathered together to form a spherical ferritin protein, and this structure is disassembled in acid, and the 24 subunits are gathered back when pH is adjusted back to neutral, thereby adjusting the density of the bio-silica forming peptide. According to the present invention, as bio-silica nanoparticles with adjustable size can be prepared in a monodisperse form by adjusting the concentration of glycerol, it can be provided a new method of generating bio-silica particles that can be applied in designing of various bio-hybrid nanomaterials.

Description

Novel silica forming peptides, and method for manufacturing silica particles using the same

The present invention relates to a novel silica synthesis peptide and a silica synthesis method using the same.

The development of new useful resources due to the depletion of land resources due to the rapid increase in consumption of limited available land resources after industrialization has become an important issue for the national future. Therefore, advanced countries such as the United States, Europe, and Japan are concentrating their national capabilities on developing and securing new source materials. In addition, global warming and climate change caused by environmental pollution are acting as factors that threaten human survival, and a new paradigm is emerging that simultaneously pursues economic growth and environmental protection.

The method of producing new materials through environmentally friendly biological production methods is expected to be a technology that will not only secure source technologies, but also serve as a driving force behind national low-carbon green growth due to eco-friendly industries. In particular, silica is important for synthesizing a new hybrid material (organic-inorganic complex) because it can be covalently bonded with specific species, and as a biocompatible material, it has excellent properties that can compensate for the disadvantages of each individual material. . Currently, the industrial production process of silica requires high temperature, strong acid or strong base conditions, and there is a problem of generating environmentally harmful by-products.

However, as enzymes and peptides that can form silica at room temperature and pressure have been discovered, interest in the development of biosilica composite materials through biological production methods is increasing.

On the other hand, ferritin is a major iron storage protein in vivo and exists in a variety of living organisms ranging from mammals to bacteria. The ferritin molecule is a spherical macromolecule with a molecular weight of about 450 kDa in which 24 monomers of 18 to 22 kDa are bound, and has the form of a core shell with an empty space inside the protein. These structural features can be applied in a variety of fields. For example, ferritin's inner space can be used to transport various metal ions, isotopes, and drug delivery materials, and specific functional ligands are added to the N-terminal portion of each monomer of ferritin. By linking, target-oriented imaging lipids and drug delivery systems can be prepared. In addition, using the structural properties of ferritin itself, it can be used as a template to make a regular nanostructure.

Under the above-described technical background, the present inventors are researching a technology for manufacturing bio-silica particles that can control the size of particles, and develop a new silica-forming peptide, and when using a protein in which the silica-forming peptide and ferritin are fused, silica nanoparticles It was confirmed that the size of the can be effectively controlled, and the present invention was completed.

KR 10-2017-0120810

The technical problem to be achieved by the present invention is to provide a novel peptide capable of synthesizing silica, and a method for producing bio-silica particles that are produced as monodisperse particles using the same and can be size-controlled.

In addition, the present invention provides the use of the silica-based complex prepared by the peptide in various industrial fields such as electronics, chemistry, and pharmaceuticals.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention provides a novel silica forming peptide (SFP) comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 in order to solve the above problems.

In addition, the present invention provides a composition for silica synthesis comprising the novel silica synthesis peptide and a silica precursor.

In addition, the present invention provides a silica synthesis method comprising the step of reacting the novel silica synthesis peptide and a silica precursor, the reaction can be carried out at room temperature and / or under normal pressure conditions, pH 5-8 conditions Can be.

In addition, the present invention provides a fusion protein in which the novel silica synthesis peptide and ferritin or viral capsid protein are combined.

In addition, the present invention provides a composition for synthesizing silica particles comprising the fusion protein and a silica precursor, and the silica particles may have a structure coated with silica on the surface of the core shell structure formed by the ferritin or viral capsid protein. .

In addition, the present invention comprises the steps of (1) decomposing the fusion protein into monomers under acidic conditions; (2) preparing a core-shell structure by inducing binding of the monomeric ferritin or viral capsid subunit under weak base conditions; And (3) reacting the structure with a silica precursor.

As an embodiment of the present invention, step (1) may be performed by mixing a fusion protein and a ferritin protein, and the mixing ratio may be 1:1 to 5. The mixing ratio affects the particle size of the final product silica particles, and when the size of the silica particles to be produced is large, the ratio of the fusion protein is increased, and when the size is small, the ratio of the ferritin protein is increased.

In another embodiment of the present invention, step (1) may be performed under pH 2 to 3 conditions, and preferably may be performed under pH 2 aqueous solution.

As another embodiment of the present invention, step (2) may be performed under a pH of 7 to 9 conditions, and preferably may be performed under a pH of 8 aqueous solution.

As another embodiment of the present invention, step (3) may be performed in a solution containing glycerol, and preferably may be performed in a solution containing 50% glycerol.

In addition, the present invention provides silica particles prepared by the above method.

On the other hand, the silica particles of the present invention can be used as a drug delivery system by carrying a drug therein, and the drug is a solution in which a drug and a monomer of a fusion protein are mixed when preparing the core-shell structure in step (2). It can be carried out by adjusting the pH of the base to prepare a core-shell structure.

In addition, the silica particles of the present invention can be used as a drug delivery vehicle by loading a drug on its surface. Loading of the drug may be performed by reacting the drug with the silica particles prepared after step (3) to induce binding of the drug to the surface of the silica particles.

Meanwhile, the silica particles of the present invention can be used as a dual drug delivery system by independently loading drugs on the interior and the surface, respectively, and the drug bound to the particle surface and the release pattern of the drug supported therein and the drug loaded In consideration, drugs loaded on the surface and the interior may be the same or different from each other.

As an embodiment of the present invention, the drug may be one or more selected from the group consisting of a compound, a peptide, a protein, an imaging agent, a gene construct, and a combination thereof.

In another embodiment of the present invention, the silica precursor is tetraethyl orthosilicate, tetramethyl orthosilicate, methyl triethoxysilane, ethyl triethoxysilane, phenyl triethoxysilane, dimethyl dimethoxy silane, dimethyl diethoxysilane, Ethyl triethoxysilane, trimethylethoxysilane, triaminopropyltriethoxysilane, titania tetraisopropoxide, titanium oxysulfate, titanium bisammonium lactate dihydroxide, titanium diisopropoxide bisacetyl It may be one or more selected from the group consisting of acetonate and tetraethyl germanium.

In addition, the present invention (a) the Kps gene consisting of the nucleotide sequence of SEQ ID NO: 3 or the Kpt gene consisting of the nucleotide sequence of SEQ ID NO: 4 and ferritin or a recombinant expression vector comprising a gene encoding a viral capsid protein Step to do; (B) preparing a transformant by introducing the expression vector into a host cell; It provides a method for producing a fusion protein of a silica-forming peptide and ferritin comprising; and (c) culturing the hemoglobin.

As an embodiment of the present invention, the method comprises crushing the transformant after step (c), and removing fragments of the transformant through centrifugation, and mixing the obtained soluble fraction with a nickel resin to form a nickel resin. A high purity fusion protein may be provided by further comprising a purification step of obtaining the bound fusion protein.

In the present invention, 24 subunits of ferritin are gathered to form a spherical ferritin protein, and this structure is disassembled from acid, and when the pH is adjusted to neutral again, 24 subunits of ferritin protein are reassembled to the ferritin amino terminal. A novel silica capable of controlling the size of silica nanoparticles by mixing ferritin with silica-forming peptide fused (Kps-Fn/Kpt-Fn) and ferritin (Fn) without ferritin in a certain ratio to control the density of bio-silica-forming peptides Provides synthetic peptides.

According to the present invention, bio-silica nanoparticles with adjustable size can be prepared in a monodisperse form by controlling the concentration of glycerol, and a method for producing new bio-silica particles that can be applied to the design of various bio-hybrid nanomaterials Can provide.

1 is a view comparing and confirming the silica precipitation activity of silica forming peptides (R5, Kps, Kpt) according to pH.
2 is an adsorption isotherm of a peptide to a nickel resin [(A) 6×His. (B) Kps. (C) Kpt].
3 is a structural comparison diagram of the SFP-Fn protein, (A) is a Native-PAGE result, and (B) is a TEM image of the SFP-Fn fusion protein.
Figure 4 is a view confirming the comparison of the silica-forming ability of the SFP, Fn, and SFP-Fn fusion proteins.
5 is a schematic diagram of a ferritin-based silica particle (NPs) control method.
6 shows the particle size histogram results obtained through statistical analysis of 200 or more particles for silica particles derived from a sol-gel process in the presence of 50% glycerol using chimeric Fn as a template.
7 is an image comparing the shape of the formed silica particles according to the presence or absence of 50% glycerol during the silica formation reaction (a: SiO ₂ /Kps-Fn, b: SiO ₂ /Kpt-Fn, c: SiO ₂ /Kps -Fn, 50% glycerol added, d: SiO ₂ /Kpt-Fn, 50% glycerol added). Scale bar: 500 nm.
Figure 8 is a comparison of the amount of DNA bound to the silica particles, a is a representative diagram comparing the amount of DNA adsorbed to each silica particle by elution through agarose gel (0.7%) electrophoresis (lane 1: SiO ₂ /Kps-Fn, lane 2: SiO ₂ /Kpt-Fn, lane 3: SiO ₂ /Kps1:5, lane 4: SiO ₂ /Kpt1:5, lane 5: commercial SiO ₂ (170 nm), lane 6: commercial SiO ₂ (310 nm), lane 7: free DNA (500 ng)), b represents the result of quantification by measuring the amount of DNA eluted from silica particles with ImageJ software ( ^* P <0.01, SiO ₂ /Kps1:5 vs. ^{_{. SiO 2 / Kps-Fn **}} P <0.01, SiO 2 / Kpt1:. 5 vs. ^{_{SiO 2 / Kpt-Fn # P}} <0.001, SiO 2 / Kps1:. 5 vs. commercial silica ^## P <0.001, SiO ₂ /Kpt1:5 versus commercial silica).
9 is a view confirming the release pattern of Dox carried on Kps6:6 Fn and SiO ₂ /Kps6:6Fn according to pH.
10 is a diagram showing the emission patterns of mRFP and Dox fixed on the surface of Kpt6:6 (Dox) over time.

The present inventors have completed the present invention by intensively researching the development of a novel silica synthesis peptide and various methods of using bio-silica using the same.

The present inventors selected the Kpt peptide by searching the protein database Blast based on the Kps sequence (KPSHHHHHTGAN; US20060172282A1; DOI: https://doi.org/10.1166/jnn.2002.074) to discover a new silica synthetic peptide, and Kps As a result of confirming the silica synthesis ability by using the and Kpt peptide as a reference of the R5 peptide, it was confirmed that silica can be actively synthesized under the conditions of room temperature, normal pressure, and pH 5 to 8 for both Kps and Kpt. The Kpt peptide consisting of the sequence (KPTHHHHHHDG) present in the membrane protein (NCBI RefSeq: WP_011046633.1) of the marine microorganism Ruegeria pomeroyi DSS-3 (formerly Silicibacter pomeroyi) is silica superior to R5 and Kps under pH 5, 6, and 8 conditions. It showed formation ability (Example 1-1).

Kps and Kpt peptides can be used alone, but can impart silica-forming ability to proteins through fusion with enzymes or functional proteins. However, for expression of a recombinant protein, the fusion of multi-tags can affect protein structure and expression, so if a single binding tag has multipotency, its value and usefulness increase. Kps and Kpt were expected to be able to bind to nickel resin for purification because 6 histidine residues in the sequence exist as a repeating sequence.As a result of confirming this, it was found that both Kps and Kpt had high affinity for the nickel resin (Example 1-2).

On the other hand, 24 monomers of ferritin are gathered to form a spherical ferritin protein, and this structure is decomposed from acid, and when the pH is adjusted to neutral again, 24 monomers of ferritin protein gather to form a core-shell structure. .

Accordingly, the present inventors prepared a fusion protein (SFP-Fn) in which ferritin protein forming a core-shell structure was combined with the Kps or Kpt and purified using nickel resin, and the fusion protein was decomposed into a monomer under acidic conditions. And again, as a result of observing the shape of the structure obtained by inducing binding under neutral or basic conditions, Kps and Kpt did not affect the function of the bound ferritin protein and effectively function as an affinity tag for purification using nickel resin. Could be confirmed (Example 2).

In the present invention, the structure manufactured using the SFP-Fn may be referred to as chimeric ferritin, and the core-shell structure and chimeric ferritin may be mixed.

In addition, the present inventors prepared silica particles by mixing the core-shell structure of the fusion protein and a silica precursor, and the silica particles are a structure coated with silica on the surface of the structure composed of the fusion protein, and the size of the silica particles is It was confirmed that the silica-forming ability of SFP bound to the fusion protein was affected. Accordingly, it is expected that the size of silica particles can be adjusted according to the number and performance of SFPs located on the surface of the core-shell structure by the ferritin, and chimeric ferritin is prepared by varying the ratio of Kps-Fn/Kpt-Fn and Fn subunits. It was confirmed that the size of the silica particles can be effectively controlled by fabricating and preparing silica particles (Example 3-1). Meanwhile, chimeric ferritin produced by mixing Kps-Fn/Kpt-Fn and Fn in the present specification is classified and named according to the mixing ratio. For example, the chimeric ferritin obtained by mixing Kps-Fn and Fn at a molar ratio of 1 to 5 and reconstitution is named Kps1:5, and the chimeric ferritin obtained by mixing Kpt-Fn and Fn at a molar ratio of 1 to 5 and reconstitution is Kpt1. Named as :5.

In addition, the present inventors confirmed that the prepared silica particles clump together, but this can be prevented by adding 50% glycerol when reacting with the silica precursor (Example 3-2).

It can be seen that Kps-Fn forms silica nanoparticles having a larger size than Kpt-Fn, and Kpt-Fn, which forms smaller silica particles, can produce bio-silica with a large surface area. Accordingly, the present inventors confirmed the DNA adsorption ability on silica nanoparticles prepared with Kps-Fn, Kpt-Fn and chimeric Fn as templates, and as a result, it was confirmed that the smaller the size in the same amount of bio-silica, the better the DNA adsorption ability. The silica particles prepared with the novel SFP of the present invention exhibited better DNA adsorption capacity than commercially available silica particles (Example 5).

In addition, in order to confirm that the drug can be provided as a drug delivery system by manufacturing silica particles by supporting the drug in the core-shell structure, the present inventors mixed drugs when forming the core-shell structure of the fusion protein to The drug was loaded on and silica particles were prepared. It was confirmed that the drug-carrying silica particles rapidly released the drug under acidic conditions and slowly released the drug at a pH near neutral (Example 6).

In addition, in order to confirm that the drug can be provided as a dual drug delivery system by supporting each of the drugs inside the core-shell structure and the silica coating film, the present inventors mixed drugs when forming the core-shell structure of the fusion protein. In the process of supporting the drug inside the shell structure and forming silica particles, another drug was added to precipitate the silica around the ferritin core, and the drug present around the ferritin core was immobilized on the silica together to prepare the drug-carrying silica particles. It was confirmed that the dual drug delivery system in which the drug was carried in the ferritin inner core and the outer silica cell was released faster than the inner drug (Example 7).

The drug delivery system of the present invention may further include a pharmaceutically acceptable carrier, and the silica complex of the drug delivery system may have a core-shell structure and contain a pharmaceutical active ingredient therein.

The pharmaceutically acceptable carrier includes carriers and vehicles commonly used in the field of medicine, and specifically, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins (eg, human serum albumin), buffer substances (eg, Various phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids), water, salts or electrolytes (e.g. protamine sulfate, disodium hydrogen phosphate, camium hydrogen phosphate, sodium chloride and zinc salts), colloids Silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substrate, polyethylene glycol, sodium carboxymethylcellulose, polyarylate, wax, polyethylene glycol or wool paper, and the like.

In addition, the drug delivery system of the present invention may further include a lubricant, a wetting agent, an emulsifying agent, a suspending agent, or a preservative in addition to the above components.

In a specific embodiment of the present invention, the "vector" is not limited if it is a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Thus, the vector can be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since the plasmid is the most commonly used form of the current vector and is used in specific examples of the present invention, "plasmid" and "vector" in the specification of the present invention are sometimes interchangeably Used. However, the present invention encompasses other forms of vectors that have functions equivalent to those known or become known in the art.

In addition, in the present specification, "recombinant expression vector" refers to a fragment of double-stranded DNA as a recombinant carrier into which a fragment of a heterogeneous DNA is inserted. Here, heterologous DNA refers to heterologous DNA, which is DNA that is not naturally found in host cells. Once in the host cell, the expression vector can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated.

The vector may include a promoter operatively linked to the gene to be cloned. In the present specification, the term "promoter" promotes expression of the gene to be transfected, and the promoter includes a basic factor required for transcription (Basal element), as well as an enhancer that can be used to promote and regulate expression.

In addition, in the present specification, "transformation" or "transfection" means that DNA is introduced into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integration completion. The transformation includes any method of introducing a nucleic acid into an organism, cell, tissue or organ, and as known in the art, it can be performed by selecting an appropriate standard technique according to the host cell. These methods include electroporation, protoplasm fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation using silicon carbide fibers, agrobacteria mediated transformation, PEG, dextran sulfate. , Lipofectamine, etc. are included, but are not limited thereto.

In addition, since the expression level and modification of the protein differ depending on the host, the most suitable host cell for the purpose can be selected and used. Host cells include prokaryotes such as Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis, or Staphylococcus. Host cells are present, but are not limited thereto. In addition, fungi (e.g., Aspergillus), yeast (e.g., Pichia pastoris, Saccharomyces cerevisiae), Schizosa caromases ( Schizosaccharomyces), Neurospora crassa), and the like, cells derived from higher eukaryotes, including lower eukaryotic cells, insect cells, plant cells, and mammals, can be used as host cells.

In the present invention, various transformations can be applied and various embodiments can be applied, and specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present invention to a specific embodiment, it is to be understood to include all conversions, equivalents, and substitutes included in the spirit and scope of the present invention. In describing the present invention, when it is determined that a detailed description of a related known technology may obscure the subject matter of the present invention, a detailed description thereof will be omitted.

[Experiment method]

One. Silica forming peptide (SFP)

1-1. Preparation of SFP

The SFPs used in the experiment are shown in Table 1 below. Kpt was selected through a Blast protein database search based on the Kps sequence.

No. SFP Amino acid sequence Molecular weight (kDa) Histidine residues Hydroxyl-containing residues pI One Kps KPSHHHHHTGAN 1.36 5 2 9.71 2 Kpt KPTHHHHHHDG 1.34 6 One 7.98 3 R5 SSKKSGSYSGSKGSK 1.47 0 7 10.87

1-2. Confirmation of SFP's ability to form silica

SFP (R5, Kps, Kpt) was prepared in deionized water at a concentration of 10 mg/mL, and 1M of TMOS (Tetramethyl orthosilicate) was added 10 minutes before the reaction to a final concentration of 1mM, and silicic acid as a silica precursor. Was prepared. For silica precipitation, 10 μL of hydrolyzed 1 M TMOS and 10 μL of SFP were added to 80 μL of a buffer for the silica precipitation reaction (acetate buffer pH 5.0 and potassium phosphate buffer pH 6, 7 or 8.0), and then the mixture was brought to room temperature. It was stirred for 5 minutes to react. The precipitated silica particles were separated by centrifugation and then washed three times with deionized water. The silica-forming ability of the peptide according to the pH was quantified by the silica quantification method using the molybdenum blue method.

1-3. Confirmation of the affinity of SFP to nickel resin

10 mg/mL of peptide dissolved in PBS and 100 μL of the nickel resin were mixed by stirring at room temperature for 30 minutes, followed by centrifugation (14000×g, 5 minutes) to recover the peptide not bound to the nickel resin. The amount of peptide in the supernatant sample was measured using Pierce Quantitative Fluorometric Peptide assay (Thermo Fisher Scientific, IL, USA), and the adsorption capacity (q) and K _d value were calculated according to the Langmuir adsorption isotherm equation 1 below.

[Equation 1]

2. Preparation of Fn protein and SFP-Fn fusion protein

2-1. Expression vector and transformant preparation

The human ferritin heavy chain (Fn) gene was prepared by performing PCR using pUC57-Fn OPT (GenScript USA Inc.) as a template. Specific information on the forward/reverse primers for performing PCR is shown in Table 2 below. Subsequently, the Fn gene secured as the PCR product was inserted into the pET-42b vector to prepare a pET-Fn plasmid, and introduced into the E. coli system (BL21(DE3)) to prepare a transformant.

No. Primer Sequence 4 F-Fn CATATGACGACCGCGTCTACCTCTCAAGTG 5 R-Fn CCACTGAGGCTGTTACTTAGCACTGAGCTC

In order to prepare Kps-Fn and Kpt-Fn, 3 forward primers for each gene (F1, F2 and 3 Kps or Kpt sequences to be introduced into the amino terminus of Fn using the pUC57-Fn OPT plasmid as a template) F3-Kps or -Kpt) was prepared (Table 3). After performing the first PCR with F1 and R-Fn, PCR with F2 and R-Fn with the product as a template again, and PCR with the last F3 and R-Fn with the product as a template, Kps-Fn and Kpt After obtaining the -Fn gene, it was subcloned into a T-vector, pGEM-T Easy vector (Promega Co., Madison, WI). The Kps-Fn or Kpt-Fn gene fragment was cut from the subcloned T-vector with restriction enzymes NdeI / XhoI, and pET-Kps-Fn and pET-Kpt-Fn were prepared using the pET42b vector treated with the same restriction enzyme. An expression vector was prepared and introduced into E. coli BL21 (DE3) to produce a Kps-Fn or Kpt-Fn producing strain. All inserted DNA nucleotide sequences were confirmed by automated DNA sequencing (Cosmo Genetech Co., Seoul).

No. Primer Sequence 6 F1-Kps ACTGGTGCTAACACGACCGCGTCTAC 7 F2-Kps TCACCATCACC ATCACACTGGTGCTAAC 8 F3-Kps CATATGAAGCCGTCTCACCATCACCATCAC 9 F1-Kpt CATCATGATGGCAGTACGACCGCGTCTAC 10 F2-Kpt CCCACCATCACCATCATCATGATGGCAGT 11 F3-Kpt CATATGA AGCCGACCCACCATCACCATC

2-2. Protein expression

E. coli BL21 (DE3) into which Fn, Kps-Fn or Kpt-Fn expression vector was introduced was cultured in an LB liquid culture solution containing kanamycin (25㎍/㎖), and the absorbance of cells at 37 ℃ was about 0.6~0.8 (600nm absorbance). After growing until reaching the temperature, IPTG was added so that the final concentration was 0.1 mM. Subsequently, the strain into which the Fn expression vector was introduced was cultured overnight at 20° C. to induce protein expression, and the strain into which the Kps-Fn or Kpt-Fn expression vector was introduced was cultured at 37° C. for 4 hours to obtain Kps-Fn or Kpt-Fn. Was induced. Next, each strain was recovered by centrifugation, crushed by ultrasonic treatment, and centrifuged at 13000 rpm for 30 minutes at 4° C. to remove insoluble cell debris, and then only the soluble fraction was recovered. The soluble fraction was treated at 60° C. for 10 minutes, and the precipitated proteins were centrifuged under the same conditions to recover the final soluble fraction.

2-3. Protein purification

- Purification of Fn protein: Ammonium sulfate precipitation, phenyl-sheparose column chromatography, and Q-sepharose column chromatography.

- Purification of Kps-Fn and Kpt-Fn proteins: Purified with high purity using nickel resin.

- Finally, the eluted fraction was subjected to dialysis to exchange the buffer solution with 50mM Tris-HCl, 300mM NaCl, and 1% sucrose (pH 8.0). Each protein concentration was measured using Bradford assay reagent (Thermo Fisher Scientific).

3. Preparation of chimeric ferritin protein

A mixed solution of Fn and Kps/Kpt-Fn protein at various molar ratios (expressed as Kps 2:10 when fused at a ratio of 2 mol of Kps-Fn to 10 mol of Fn, and expressed as Kps 2:10, using the same method as 2 mol of Kpt-Fn vs. 10 mol of Fn In the case of fusion in the ratio of Kpt 2:10), 1M HCl was added to adjust the pH to 2.0 to decompose ferritin into a monomer for 20 minutes, and then 1M NaOH was added to adjust the pH to 8.0 to merge 24 monomers ferritin. The chimeric Fn protein was reconstructed. Salts generated by the addition of HCl and NaOH were removed by dialysis for 24 hours with a buffer solution (50mM Tris-HCl, 300mM NaCl, pH 8.0 (TBS) and 1% sucrose) at 4°C. Subsequently, after dialysis, the monomers and rod-shaped oligomers were removed by filtration through an Amicon Ultra 100K centrifugal filtrate, and only spherical Fn proteins were obtained using size gradient chromatography. The obtained Fn protein was used as a template for the following silicification reaction. All proteins were stored in TBS buffer containing 1% sucrose to maintain protein stability at 4° C. before use.

4. Silica particles using ferritin protein as a template

4-1. Preparation of ferritin-based silica particles

Silicic acid was prepared by adding 1M TMOS (Tetramethyl orthosilicate) to a final concentration of 1mM 10 minutes before the reaction. A mixture of 40 μg/ml ferritin protein and 10 mM silicic acid was added to potassium phosphate buffer (pH 8.0) containing various concentrations of glycerol (0%, 10%, 20%, 30%, 40%, 50%) at room temperature. After shaking for 2 hours, Fn particles encapsulated with silica were obtained by centrifugation, and washed several times with distilled water.

4-2. Quantification of silica particles

Silica encapsulated Fn particles were dissolved in 1M NaOH and incubated at 95° C. for 5 minutes. A total of 20 μL of the diluted sample was added to each well of a 96-well plate containing 20 μL of 1 M HCl and 10 μL of distilled water to neutralize the pH value. In the subsequent step, 2% ammonium molybdate tetrahydrate, 5% oxalic acid, and 100 mM ascorbic acid were sequentially added in 50 μl each. Finally, the absorbance of the 200 µl solution was measured at a wavelength of 700 nm. A solution of sodium metasilicate nonhydrate was used to generate the Si standard curve.

4-3. Surface properties of silica particles

The silica precipitate was washed with distilled water, diluted with ethanol, and sputtered onto a silica wafer. Scanning electron microscope (SEM) images were taken on a Hitachi S-900 with an acceleration voltage of 2 kV. Samples were coated with platinum just before SEM observation in an argon atmosphere using an ion sputter system (Hitachi E-1030).

In addition, in order to measure the porosity and surface area of the silica particles, BET analysis was performed on 100 mg of silica particles formed by Kps-Fn, Kps 2:10, Kpt-Fn, and Kpt 2:10. Nitrogen adsorption isotherms were measured at 77K using ASAP 2020 (Micromeritics, GA, USA). The specific surface area of the prepared sample was determined by nitrogen adsorption data using the Brunauer-Emmett-Teller (BET) equation.

4-4. DNA adsorption and elution of silica particles

After mixing DNA (final concentration 60 ng/µl) and silica particles (final concentration 100 nM), the mixture was shaken at room temperature for 2 hours, and the silica particles were removed from the binding buffer by centrifugation. For DNA elution, 20 µl of purified water was added to the silica particles, and then incubated for 30 minutes under shaking conditions (200 rpm). After centrifugation, the silica particles were successively washed to elute the entire adsorbed DNA. The concentration of DNA in water was determined by quantifying the intensity of the stained DNA bands in gel electrophoresis with the ImageJ program.

4-5. Preparation of drug-supported ferritin-based silica particles and confirmation of drug release

Add 1 N HCl to a 1 mL reaction system in which Kps-Fn and Fn are mixed in a ratio of 6:6, adjust the pH to 2, react for 20 minutes, and react for 5 minutes by adding 100 μL of doxorubicin (Dox) at a concentration of 1 mg/mL. After that, 1 N NaOH was added to adjust the pH of the reaction solution to 8, followed by stirring in a refrigerating chamber for one day. After removing the precipitate through centrifugation, the supernatant was placed in a dialysis membrane to remove Dox that was not contained in ferritin. To the ferritin sample (Kps6:6(Dox)) carrying Dox, glycerol was added so that the final concentration was 40%, and the final TMOS concentration was 100 mM. After a silica formation reaction was performed for 2 hours, the formed silica was precipitated and the final product ( SiO ₂ /Kps6:6 (Dox)) was recovered. The amount of Dox released from the toxin-carrying chimeric ferritin Kps6:6 (Dox) without performing the silica reaction and the silica-encapsulated SiO ₂ /Kps6:6 (Dox) was compared.

Each 1mL sample is placed in a dialysis membrane (10K MWCO, Pierce), and then the dialysis membrane is placed in a 50 mL tube containing 10 mL of buffer (phosphate-citrate buffer, pH5.5 and pH7.4), and 150 at a constant temperature of 37℃. The shaking reaction was carried out at rpm. Whenever the amount of Dox released was checked, the buffer outside the dialysis membrane was recovered and replaced with a new buffer. The Dox concentration released from the sample was determined using a fluorescent microplate reader (λ485 / λInfinite F200 NanoQuant; TECAN) by comparison to the Dox standard curve in the corresponding buffer solution. The amount of Dox detected at each time point was calculated as the cumulative amount over time.

4-6. Dual drug delivery system

In order to confirm the applicability of the dual drug delivery system, mRFP protein was used as a model molecule. A pre-prepared Kpt6:6 (Dox) solution was added to a 50 mM sodium phosphate buffer containing mRFP and 20 mM hydrolyzed TMOS [the molar ratio of mRFP to Kpt6:6 (Dox) was 10 to 1 to 1 to 1 Until]. By stirring for 24 hours, mRFP was captured in a silicified shell of Kpt6:6 (Dox) (SiO ₂ (mRFP)/Kpt6:6 (Dox)). Unreacted mRFP and TMOS were removed by ultrafiltration over 5 times with PBS (pH 7.4) according to the manufacturer's instructions using an Amicon Ultra-0.5 apparatus (YM100).

The release profiles of mRFP and Dox from SiO ₂ (mRFP)/Kpt6:6 (Dox) were obtained by centrifugation at 14,000 × g daily for 8 days. The precipitate was redispersed in 1 mL of PBS. The amount of mRFP or Dox in the supernatant was monitored at λ590/λem 635 nm and λex 485/λ535 nm, respectively, using a fluorescent microplate reader (Infinite F200 NanoQuant; TECAN). The concentration of mRFP and Dox in the buffer was determined according to the standard curve for each molecule. When measuring the amount of Dox emitted into the supernatant with visible light, it was monitored at 550 nm using a UV / visible microplate reader (Infinite M200 NanoQuant; TECAN). The Dox concentration released from the sample was determined using a fluorescent microplate reader (λ485 / λ) by comparison with the Dox standard curve in the corresponding buffer solution. The amount of Dox detected at each time point was calculated as the cumulative amount over time.

[Experiment result]

Example 1. Characterization of the silica-forming peptide

1-1. Comparison of silica formation ability according to pH of three SFPs

As a result of confirming the silica-forming ability of each peptide by varying the pH of the solution in which each of the three SFPs (R5, Kps, Kpt) was mixed with a silica precursor (TMOS) in Table 1, all three peptides were high in silica at pH 7 and 8. Showed precipitation. R5 peptide showed the highest activity at pH 7.0 compared to Kps and Kpt. However, the silica was hardly precipitated at pH 6.0, and was completely inactive at pH 5.0. The Kpt peptide exhibited greater silica-forming ability than R5 and Kps at pH 5, 6 and 8 (Fig. 1).

1-2. Confirmation of SFP adsorption capacity and affinity of nickel resin

Histidine exhibits strong interaction with metal ions immobilized on the matrix by forming a coordination bond between the electron donor group on the histidine imidazole ring and the transition metal (nickel or cobalt) immobilized on the resin. The ability of the Kps, Kpt, and 6×His peptides to bind to the nickel resin was investigated.

The results of comparing peptide adsorption parameters for Ni- resin using Langmuir isotherms are shown in Table 4 below, and the isotherms are shown in FIG. 2.

Peptide Dissociation coefficient
K _d (μM) Maximum adsorption capacity q _max (μmoles/g) 6xHis 52.36 2238 Kps 125.5 1640 Kpt 55.91 1522

At neutral pH, the 6×His peptide showed the highest adsorption capacity (2238 μmoles/g) in nickel resin compared to the Kps and Kpt peptides. Kps contained 5 histidine residues but exhibited a slightly higher adsorption capacity value than Kpt with 6 histidine residues. The q _max of Kps was slightly higher than that of Kpt, but the K _d value indicating affinity was 125.5 μM, which was more than twice that of 55.91 μM Kpt, indicating that Kpt's affinity for nickel resin was higher than Kps. The 6xHis peptide K _d value was 52.36 μM, and the Kpt peptide showed similar affinity for 6xHis and nickel resin.

Example 2. Confirmation of ferritin-based silica particle formation

The SFP introduced at the amino terminal of ferritin was expressed in E. coli in a form exposed on the surface of the ferritin structure. R5-Fn was precipitated with ammonium sulfate, purified with phenyl sepharose resin, a hydrophobic resin, and purified again using SP-Sepharose resin, an ion exchange resin, and Kps-Fn and Kpt-Fn were used with nickel resin. A high purity fusion protein could be obtained by adding a purification step.

After purification of the protein, it was confirmed that ferritin formed through Native-PAGE formed a protein of 480 KDa or more in which 24 subunits were collected, but R5-Fn did not form such a ferritin structure (Fig. 3A). That is, the R5 sequence appears to interfere with the self-assembly of human ferritin. Compared to R5, Kps and Kpt have shorter amino acid sequences, can form silica, and are also easier to purify, so they have been shown to be useful in producing fusion proteins compared to R5. TEM images of Fn, Kps-Fn, and Kpt-Fn (FIG. 3B) also showed that the fusion protein and ferritin structure were the same, and thus it was confirmed that the Kpt and Kps peptides did not affect the ferritin structure formation.

Example 3. Ferritin-based silica particle size and dispersion degree control

3-1. Size control according to the ratio of Fn and SFP-Fn

It was confirmed that Kps-Fn had a higher silica-forming ability than Kpt-Fn and that the formed silica particle size was also larger (FIG. 4). Through this, it is assumed that there is a proportional relationship between the silica-forming ability and the silica particle size, and ferritin without SFP fusion has no silica-forming ability, and the size of silica particles can be adjusted by adjusting the silica-forming ability by varying the SFP density on the ferritin surface. Assuming, a strategy for controlling the size of silica particles according to the SFP density was established as shown in the schematic diagram of FIG. 5.

Specifically, the size by changing the ratio of Kps-Fn/Kpt-Fn and Fn subunits to 5:1 (10:2), 1:1 (6:6), and 1:5 (2:10) respectively Different bio-silica particles (100 ~ 500 nm) could be obtained (Table 5, Fig. 6).

Ratio of Kps/Kpt-Fn to Fn 6:0 (12:0) 5:1 (10:2) 3:3 (6:6) 1:5 (2:10) Peptides No./proteincage* 24 20 12 4 SiO ₂ /Kps chimera (nm) 513 290 250 150 SiO ₂ /Kpt chimera (nm) 350 150 100 72

^* Theoretically, the number of peptides present on the surface of the Fn chimeric cage

3-2. Controlling the degree of dispersion according to the concentration of glycerol in the reaction system

The silica particles formed by Kps-Fn or Kpt-Fn were agglomerated with each other, but 50% glycerol was added during the silica formation reaction to prevent agglomeration during the reaction, and dispersed silica particles were obtained (FIG. 7 ).

Example 4. Surface analysis of ferritin-based silica particles

The results of measuring the porosity and surface area of the silica particles are shown in Table 6. Nitrogen adsorption isotherm analysis SiO ₂ / Kps-Fn and SiO ₂ / Kps2: showed that the surface area of each of 10 and 403.18 492.09 m ² / g. The average pore size of SiO ₂ /Kps2:10 was 3.02 nm, which was larger than the average pore size of SiO ₂ /Kps-Fn (about 2.65 nm). It was confirmed that the bio-silica nanoparticles having a smaller size have a larger surface area, and this feature may provide a larger adhesion surface when biomolecules are bound. SiO ₂ / Kpt-Fn and SiO ₂ / Kpt2: surface area of 10 were 468.38 and 537.68 m ² / g as SiO ₂ / Kps-Fn and SiO ₂ / Kps2: were more surface area greater than 10. The average pore size of SiO ₂ /Kpt2:10 was 2.90 nm, and the average pore size of SiO ₂ /Kpt-Fn was increased by about 2.74 nm. It is believed that Kpt-Fn with a large surface area showed higher DNA binding ability than Kps-Fn. For comparison, a comparative analysis of commercially available non-porous 310 nm-sized silica particles showed that the surface area was 2.30 m ² /g and the average pore size was 69 nm. Since it is a non-porous particle, it is judged as a void between particles.

Sample S _BET (m ² /g) Pore size (nm) SiO ₂ (310 nm) 2.30 69.32 SiO ₂ /Kps-Fn 403.18 2.65 SiO ₂ /Kps2:10 492.09 3.02 SiO ₂ /Kpt-Fn 468.38 2.74 SiO ₂ /Kpt2:10 537.68 2.90

Example 5. Confirmation of DNA adsorption and elution of ferritin-based silica particles

Silica nanoparticles synthesized using Kps-Fn, Kpt-Fn and chimeric Fn as templates, as well as commercially available silica particles of 170 nm in diameter (aqueous suspension) and 310 nm (dry silica) of Bangs Laboratories Inc (Indiana, USA) The adsorption capacity of 700 bp DNA was compared under high concentration of potassium. As a result, when the surface density of Kps or Kpt on the chimeric template is low, bio-silica particles having a smaller size can be made, and as the size is smaller, the surface area increases. Thus, the advantage of increasing the surface area through comparison of DNA adsorption performance was confirmed (Fig. ). The bio-silica particles developed in the present invention showed better DNA adsorption performance than commercially available silica particles.

Example 6. Drug release of ferritin-based silica particles loaded with drugs

At pH 5.5, the amount of Dox emission increased and there was no difference due to silica coating. This means that the release of the drug carried inside ferritin is promoted by the acid and the silica coating does not interfere with the release of the drug by pH.

At pH 7.4, it was confirmed that the amount of Dox released was reduced, and the release rate was further reduced by the silica coating. It is judged that the diffusion rate is slowed by silica coating because the drug release is controlled only by diffusion. However, it can be seen that the rate of drug release gradually increases over time, which is because the silica is decomposed and the inhibition of drug release by the silica coating decreases (FIG. 9).

Example 7. Drug release of silica particles based on dual drug delivery system

A dual drug delivery system was demonstrated by in situ immobilization of mRFP molecules on the surface of Kpt6:6 (Dox) prepared in the same manner as SiO ₂ /Kps6:6 (Dox). Monomer RFP (mRFP) was used as the cargo molecular model and precipitated with the silica formed by Kpt6:6 (Dox).

The in vitro release profile of Dox and mRFP from SiO ₂ (mRFP) / Kpt6:6 (Dox) in PBS (pH 7.4) at 37° C. was obtained by centrifuging the amount of drug released for a specific time and then taking the supernatant, respectively, λex. It was measured at 485 / λ535 nm and λ590 / λ635 nm. The amount of mRFP released from SiO ₂ (mRFP)/Kpt6:6 (Dox) was about 27% on day 1, 50% after 2 days, and 75% after 4 days, and then slowly released (Fig. 10). The Dox release rate was about 2 times slower than that of mRFP. Ferritin silica particles with an inner core can be used as a dual drug delivery system in which two kinds of molecules can be loaded into different compartments and released at different rates, based on the above two results.

As described above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> Korea University Research and Buisness Foundation <120> Novel silica forming peptides, and Method for manufacturing silica particles using the same <130> DHP19-671-P1 <150> KR 1020190017806 <151> 2019-02-15 <160> 16 <170> KoPatentIn 3.0 <210> 1 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> silica forming peptide_Kps <400> 1 Lys Pro Ser His His His His His Thr Gly Ala Asn 1 5 10 <210> 2 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> silica forming peptide_Kpt <400> 2 Lys Pro Thr His His His His His His Asp Gly 1 5 10 <210> 3 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> silica forming peptide_R5 <400> 3 Ser Ser Lys Lys Ser Gly Ser Tyr Ser Gly Ser Lys Gly Ser Lys 1 5 10 15 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer_F-Fn <400> 4 catatgacga ccgcgtctac ctctcaagtg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer_R-Fn <400> 5 ccactgaggc tgttacttag cactgagctc 30 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer_F1-Kps <400> 6 actggtgcta acacgaccgc gtctac 26 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer_F2-Kps <400> 7 tcaccatcac catcacactg gtgctaac 28 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer_F3-Kps <400> 8 catatgaagc cgtctcacca tcaccatcac 30 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer_F1-Kpt <400> 9 catcatgatg gcagtacgac cgcgtctac 29 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer_F2-Kpt <400> 10 cccaccatca ccatcatcat gatggcagt 29 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer_F3-Kpt <400> 11 catatgaagc cgacccacca tcaccatc 28 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> gene_Kps <400> 12 aagccgtctc accatcacca tcacactggt gctaac 36 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> gene_Kpt <400> 13 aagccgaccc accatcacca tcatcatgat ggc 33 <210> 14 <211> 552 <212> DNA <213> Artificial Sequence <220> <223> gene_Fn <400> 14 atgacgaccg cgtctacctc tcaagtgcgt caaaactatc atcaggactc ggaagctgcc 60 atcaaccgcc aaatcaatct ggaactgtac gcaagctatg tgtacctgag catgtcttat 120 tactttgatc gtgatgacgt ggcactgaaa aactttgcta agtatttcct gcatcagtcg 180 cacgaagaac gcgaacatgc tgaaaaactg atgaagctgc agaatcaacg tggcggtcgc 240 attttcctgc aagatattaa aaagccggac tgcgatgact gggaaagtgg cctgaacgcg 300 atggaatgtg ccctgcatct ggaaaagaac gttaatcagt ccctgctgga actgcacaaa 360 ctggcaaccg ataagaacga cccgcatctg tgcgatttta ttgaaacgca ctacctgaat 420 gaacaagtga aagcgatcaa ggaactgggc gaccacgtta ccaatctgcg taaaatgggt 480 gccccggaat ctggtctggc tgaatacctg tttgataagc atacgctggg tgactccgac 540 aatgaatcgt ga 552 <210> 15 <211> 588 <212> DNA <213> Artificial Sequence <220> <223> gene_fusion protein_Kps-Fn <400> 15 atgaagccgt ctcaccatca ccatcacact ggtgctaaca cgaccgcgtc tacctctcaa 60 gtgcgtcaaa actatcatca ggactcggaa gctgccatca accgccaaat caatctggaa 120 ctgtacgcaa gctatgtgta cctgagcatg tcttattact ttgatcgtga tgacgtggca 180 ctgaaaaact ttgctaagta tttcctgcat cagtcgcacg aagaacgcga acatgctgaa 240 aaactgatga agctgcagaa tcaacgtggc ggtcgcattt tcctgcaaga tattaaaaag 300 ccggactgcg atgactggga aagtggcctg aacgcgatgg aatgtgccct gcatctggaa 360 aagaacgtta atcagtccct gctggaactg cacaaactgg caaccgataa gaacgacccg 420 catctgtgcg attttattga aacgcactac ctgaatgaac aagtgaaagc gatcaaggaa 480 ctgggcgacc acgttaccaa tctgcgtaaa atgggtgccc cggaatctgg tctggctgaa 540 tacctgtttg ataagcatac gctgggtgac tccgacaatg aatcgtga 588 <210> 16 <211> 588 <212> DNA <213> Artificial Sequence <220> <223> gene_fusion protein_Kpt-Fn <400> 16 atgaagccga cccaccatca ccatcatcat gatggcagta cgaccgcgtc tacctctcaa 60 gtgcgtcaaa actatcatca ggactcggaa gctgccatca accgccaaat caatctggaa 120 ctgtacgcaa gctatgtgta cctgagcatg tcttattact ttgatcgtga tgacgtggca 180 ctgaaaaact ttgctaagta tttcctgcat cagtcgcacg aagaacgcga acatgctgaa 240 aaactgatga agctgcagaa tcaacgtggc ggtcgcattt tcctgcaaga tattaaaaag 300 ccggactgcg atgactggga aagtggcctg aacgcgatgg aatgtgccct gcatctggaa 360 aagaacgtta atcagtccct gctggaactg cacaaactgg caaccgataa gaacgacccg 420 catctgtgcg attttattga aacgcactac ctgaatgaac aagtgaaagc gatcaaggaa 480 ctgggcgacc acgttaccaa tctgcgtaaa atgggtgccc cggaatctgg tctggctgaa 540 tacctgtttg ataagcatac gctgggtgac tccgacaatg aatcgtga 588

Claims (17)

A composition for synthesis of silica comprising at least one peptide selected from the group consisting of a peptide having an amino acid sequence of SEQ ID NO: 1 and a peptide having an amino acid sequence of SEQ ID NO: 2 and a silica precursor.
The method of claim 1,
The silica precursor is tetraethyl orthosilicate, tetramethyl orthosilicate, methyl triethoxysilane, ethyl triethoxysilane, phenyl triethoxysilane, dimethyl dimethoxysilane, dimethyl diethoxysilane, trimethylethoxysilane, triamino At least one selected from the group consisting of propyltriethoxysilane, titania tetraisopropoxide, titanium oxysulfate, titanium bisammonium lactate dihydroxide, titanium diisopropoxide bisacetylacetonate and tetraethyl germanium Characterized in, a composition for the synthesis of silica.
Silica synthesis method comprising the step of reacting a silica precursor with at least one peptide selected from the group consisting of a peptide having an amino acid sequence of SEQ ID NO: 1 and a peptide having an amino acid sequence of SEQ ID NO: 2.
The method of claim 3,
The reaction is characterized in that it is carried out in an aqueous solution of pH 5-8 under the conditions of room temperature and pressure, silica synthesis method.
A peptide comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; And
A fusion protein comprising at least one selected from the group consisting of ferritin and viral capsid proteins.
A composition for synthesizing silica particles comprising the fusion protein of claim 5 and a silica precursor.
(1) decomposing the fusion protein of claim 5 into a monomer in an acidic condition;
(2) combining the monomer into a core-shell structure under weak basic conditions; And
(3) Mixing and reacting a silica precursor with the structure; silica particle production method comprising a.
The method of claim 7,
The step (1) is characterized in that performed by mixing a fusion protein and a ferritin protein, a method for producing silica particles.
The method of claim 8,
The fusion protein and ferritin protein are characterized in that the mixture in a ratio of 1:1 to 5, silica particle production method.
The method of claim 7,
The step (1) is characterized in that it is carried out under the conditions of pH 2-3, silica particle production method.
The method of claim 7,
The step (2) is characterized in that it is carried out under the conditions of pH 7-9, silica particle production method.
The method of claim 7,
The step (2) is characterized in that it comprises the following steps (a) to (c), a method for producing silica particles:
(a) mixing the monomer and the drug;
(b) preparing a drug-carrying structure by combining the monomer into a core-shell structure under weak basic conditions; And
(c) separating the drug-carrying structure by removing the drug not supported in the structure and the monomer not forming the structure.
The method of claim 7,
Addition (3) step is characterized in that it is carried out in a solution containing glycerol, silica particle production method.
The method of claim 7,
The method further comprises a step of bonding the drug to the particle surface by supporting the silica particles prepared after step (3) on a drug.
The silica particles produced by the method of any one of claims 7 to 15.
(A) preparing a recombinant expression vector comprising a Kps gene consisting of a nucleotide sequence of SEQ ID NO: 12 or a Kpt gene consisting of a nucleotide sequence of SEQ ID NO: 13 and a gene encoding ferritin;
(B) preparing a transformant by introducing the expression vector into a host cell; And
(C) culturing the blood transducer; a method for producing a fusion protein of a silica-forming peptide and ferritin comprising.
The method of claim 16,
The method comprises the steps of crushing the transformant after step (c), removing fragments of the transformant through centrifugation, and mixing the obtained soluble fraction with a nickel resin to obtain a fusion protein bound to the nickel resin. A method for producing a fusion protein, characterized in that it further comprises.

Images