KR20200085238A - Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same - Google Patents

Abstract

The present invention provides recombinant influenza A virus and a vaccine composition for H5 serotype influenza virus belonging to clade 2.3.4.4B including the same. According to the present invention, a genetic recombination vaccine having a defense effect to highly pathogenic avian influenza virus is manufactured, thereby contributing to disease control through defense effect against H5 serotype highly pathogenic avian influenza virus introduced from overseas or generated in the country. Moreover, highly pathogenic genes are removed from a hemagglutinin (HA) segment portion, and thus the vaccine composition provides weak pathogenic properties, excellent safety, excellent proliferation properties in an egg, and excellent defensive ability in a chicken.

Description

Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same}

The present invention relates to a vaccine composition against the recombinant influenza A virus and H5 serotype influenza A virus belonging to clade 2.3.4.4B comprising the same.

Influenza virus is an RNA virus belonging to the family Orthomyxoviridae, and the serotypes are classified into three types: A, B, and C. Among them, type B and type C infections have been confirmed only in humans, and type A has been confirmed in humans, horses, pigs, and other mammals as well as various types of poultry and wild birds.

The serotype of influenza A virus is classified according to the types of two proteins on the surface of the virus: hemagglutinin (HA) and neuraminidase (NA), and 144 types (HA 16) according to the serotype. Species, NA 9 species). HA acts to attach the virus to somatic cells, and NA allows the virus to penetrate cells.

Avian influenza virus (AIV) is a virus belonging to type A, and according to the hemagglutinin (HA) and neuraminidase (NA) genes in the viral envelope, HA is divided into 16 types and NA is divided into 9 types. Low serotypes are diverse, and they are not characterized by cross-defense between different serotypes. Among the various serotypes of AIV, the highly pathogenic Avian Influenza (HPAI) that has occurred to date has been shown to be caused by the H5 or H7 serotype. Highly Pathogenic Avian Influenza (HPAI), the first scientifically identified, was caused by the H5N1 avian influenza virus in Scotland in 1959, and was subsequently used by H5 serotypes or H7 serotypes among AIV subtypes worldwide. HPAI occurred.

In Korea, since the first occurrence in 2003, the trend has occurred every year since 2014. Especially, from November, 2016 to June, 2017, 2 types (H5N6, H5N8) of HPAI occurred in total 419 cases (H5N6: 343 cases, H5N8: 76 cases), 3,800 As the astronomical direct and indirect expenses, such as killing tens of thousands, were the biggest damages in history. This had a huge impact not only in the domestic poultry industry, but also in all related industries due to shrinking consumption. In addition, HPAI has been continuously occurring in Southeast Asia, which is geographically close to Korea, from 2004 to the present. In particular, in Thailand and Vietnam, cases of human infection with H5N1 type HPAI have been continuously present, which is a concern. HPAI, as a rule, has a policy to eradicate infected animals in most countries, including Korea, except Mexico and Italy, which use the avian influenza vaccine. However, even when HPAI occurs at all times, it is impossible to insist on the policy of disposition as in the past due to direct and indirect expenses such as compensation for disposal of death, concerns about human circulation, and environmental problems. Therefore, while trying to eradicate and prevent recurrence of HPAI, there is a need to develop a vaccine strain that shows a protective effect against HPAI in case of an emergency that cannot be controlled by killing.

Among live vaccines against avian influenza, live virus vaccines are almost impossible to develop due to the nature of easily mutated viruses, and vaccines developed to date can be largely divided into proprietary vaccines and genetic recombinant vaccines. In Italy and Hong Kong in 1999 and 2003, the outbreak of highly pathogenic avian influenza was prolonged and spread across the country, and the vaccine against avian influenza was combined with the selective killing policy. Currently, in Italy and Hong Kong, the use of the vaccine against avian influenza is highly pathogenic avian influenza. It has received positive reviews that it was effective in controlling. Vaccines that have been positively evaluated in Italy (serum type A/H7N1) and Hong Kong (serum type A/H5N1) are all proprietary vaccines, but are heterogeneous serotype viruses with the same HA type but different NA types (serum type A/H7N3, This is a case where a serotoxin vaccine was prepared with serotype A/H5N2) to try to distinguish it from an outdoor infection during antibody testing. However, this proprietary vaccine cannot distinguish between a vaccine antibody and an outdoor infectious antibody using the Agar Gel Precipitation (AGP) test, which is the standard diagnostic method for avian influenza A, and the fluorescent antibody method for discriminating NA is a large-scale antibody. The biggest disadvantage is that it is not suitable for monitoring inspection. In addition, the currently developed poison vaccine is considered to be able to reduce the amount of virus released into feces during infection with highly pathogenic avian influenza, but does not completely prevent the spread of the disease.

Avian influenza vaccines that have been developed to date include an inactivated oil vaccine against the H5N2 serotype used in Mexico (Intervet Mexico, Mexico) and a genetic recombination vaccine against the H5 serotype based on chickenpox virus (H5 recombinant fowl pox-vectored AI vaccine; Merial Select, USA). However, avian influenza has various serotypes as described above, and since the serotypes are different, they cannot be protected. Development of vaccines used is required.

The present inventors have made extensive efforts to develop a genetic recombinant vaccine against the highly pathogenic influenza A virus. As a result, the present invention was completed by preparing the attenuated influenza A virus by deleting the tetra peptide in HA conferring the pathogenicity of the highly pathogenic influenza A virus and identifying its high stability, immunity and vaccine efficacy.

Accordingly, it is an object of the present invention to provide a method for producing H5N8 recombinant influenza A virus.

Another object of the present invention is to provide an H5N8 recombinant influenza A virus.

Another object of the present invention is to provide a method for producing H5N6 recombinant influenza A virus.

Another object of the present invention is to provide a recombinant H5N6 influenza A virus.

Another object of the present invention is to provide a vaccine composition against H5 serotype influenza A virus.

According to one aspect of the present invention, the present invention provides a method for preparing a H5N8 recombinant influenza A virus comprising the following steps:

(a) A recombinant plasmid by cloning a H5N8-type highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 1 and a H5N8-type high-pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2 into a vector, respectively, by cloning it into a vector. Preparing a;

(b) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (PB2) derived from the low-pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 preparing a recombinant plasmid by cloning each non-structural protein) into a vector;

(c) transfecting the recombinant plasmids of steps (a) and (b) into packaging cells; And

(d) obtaining H5N8 type recombinant influenza A virus from culture supernatant of packaging cells.

The present inventors have made extensive efforts to develop a genetic recombinant vaccine against the highly pathogenic influenza A virus. As a result, the attenuated influenza A virus was prepared by deleting the tetra peptide in HA conferring the pathogenicity of the highly pathogenic influenza A virus, and its high stability, immunity and vaccine efficacy were investigated.

The term'algae influenza' as used herein refers to an acute infectious disease of avian caused by avian influenza virus infection. The causative agent of avian influenza is influenza A virus.

As used herein, the term'influenza A virus' is a causative virus of a highly infectious respiratory disease commonly referred to as'flu' that occurs in animals and humans, and has an envelope with a fragmented genome consisting of single-stranded negative RNA fragments. RNA virus.

In the present specification, the term'recombinant influenza A virus' refers to a virus in which the RNA fragment of influenza A virus is recombined using genetic recombination technology. For example, a virus containing a genetic material produced by a combination of RNA fragments of at least two donor viruses (high pathogenic influenza A virus and low pathogenic influenza A virus).

In this specification, the term'high pathogenic influenza A virus' (i) 4-8 weeks old susceptible chickens inoculated into 8 chickens within 10 days of 6 or more deaths (75%); (Ii) Intravenous pathogenicity (IVPI), 10 to 4-8 weeks old susceptible chickens were injected intravenously with virus, and the clinical symptoms and mortality of the chickens were checked every 24 hours for 10 days, respiratory symptoms, depression , Diarrhea, blueness of the skin or crest, swelling of the head, and severity of neurological symptoms, and the sum of each symptom multiplied by the symptom number divided by 100) is 1.2 or more; (Iv) In the case of H5 or H7, which is low pathogenicity in chicken, it means that the amino acid sequence of the HA protein segment site is judged to be similar to high pathogenicity.

In the present specification, the term'low pathogenic influenza A virus' is higher than pathogenic influenza A virus, (i) 4-8 weeks old susceptible chickens, inoculated into 8 chickens within 2 days or less within 2 days (25%); (Ii) the intravenous pathogenicity index is less than 1.2; (I) In the case of H5 or H7, which is low pathogenicity in chicken, it means that the amino acid sequence of the HA protein segment site is determined to be different from the high pathogenicity.

In the present specification, the term'H5N8 influenza A virus' refers to an influenza A virus in which the antigen characteristic of the HA protein, which is the surface protein of the influenza A virus, is H5, and the antigen characteristic of the NA protein is N8.

The method for producing the H5N8 recombinant influenza A virus of the present invention will be described step by step.

Step (a): Preparation of a recombinant plasmid comprising HA and NA of the highly pathogenic influenza A virus, respectively

First, the recombinant plasmid was cloned into a vector by cloning H5N8-type highly pathogenic influenza A virus derived from the nucleotide sequence of SEQ ID NO: 1 (hemagglutinin) and H5N8-type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2 into a vector, respectively. To manufacture.

In the present specification, the term'nucleotide sequence' is interpreted to include a nucleotide sequence exhibiting substantial identity to the nucleotide sequence in addition to the above-mentioned sequence. The substantial identity above, when the nucleotide sequence of the present invention is aligned with any other sequence to the maximal correspondence, and the aligned sequence is analyzed using an algorithm commonly used in the art, at least 80% of phase Refers to a nucleotide sequence that exhibits homology, more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are known in the art. Various methods and algorithms for alignment can be found in Smith and Waterman, Adv. Appl. Math. 2:482 (1981) ; Needleman and Wunsch, J. Mol. Bio. 48:443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:237-44 (1988); Higgins and Sharp, CABIOS 5:151-3 (1989); Corpet et al. , Nuc. Acids Res. 16:10881-90 (1988); Huang et al. , Comp. Appl. BioSci. 8:155-65 (1992) and Pearson et al. , Meth. Mol. Biol. 24:307-31 (1994). NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al. , J. Mol. Biol. 215:403-10 (1990)) is accessible from the National Center for Biological Information (NCBI), etc. It can be used in conjunction with sequence analysis programs such as blastx, tblastn and tblastx. BLAST can be accessed through the BLAST page of the ncbi website. The sequence homology comparison method using this program can be found on the BLAST help page of the ncbi website.

The recombinant plasmid of step (a) comprises HA consisting of the nucleotide sequence of SEQ ID NO: 1 from H5N8 highly pathogenic influenza A virus and NA consisting of the nucleotide sequence of SEQ ID NO: 2.

According to an embodiment of the present invention, the H5N8 type highly pathogenic influenza A virus is A/chicken/Korea/Gimje2/2017 (H5N8) belonging to clade 2.3.4.4B.

A/chicken/Korea/Gimje2/2017(H5N8) host chickens with influenza A virus according to the nomenclature of influenza virus [subtype/origin host/separation region/separation sequence/separation year (type HA, NA)] It is a virus isolated in 2017 from Gimje, South Korea, which means that it has an antigen type of H5 and N8.

In the present specification, "clade" is a standard for classifying a group of H5 influenza based on phylogenetic characterization and sequence homology of the HA gene of H5 influenza, and each clade is an expert of WHO/OIE/FAO Defined by groups.

The H5N8-type highly pathogenic influenza A virus-derived HA consisting of the nucleotide sequence of SEQ ID NO: 1 is HA in which a high-pathogenicity gene is deleted.

According to an embodiment of the present invention, the HA derived from the H5N8 type highly pathogenic influenza A virus is HA in which Lys-Arg-Arg-Lys (KRRK) deleted at the carboxy terminal site of HA1 constituting HA.

HA of influenza A virus is a surface glycoprotein, and when influenza A virus is introduced into a cell, it interacts with a specific receptor on the cell surface. The HA is composed of subunits of HA1 and HA2, and an amino acid sequence (Arg-Arg-Arg-Lys-Lys, RRRKK) that causes high pathogenicity of the influenza A virus is present at the carboxyl terminal site of HA1.

The present invention attenuates the highly pathogenic influenza A virus by deleting the highly pathogenic inducing site of the HA1 region of the influenza A virus.

The NA derived from H5N8-type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2 is a surface glycoprotein of influenza A virus, between the receptor of the host cell and the virus particle so that the virus propagated from the infected cell is free to infect new cells. It serves to break the bond.

A recombinant plasmid is prepared by cloning a HA consisting of the nucleotide sequence of SEQ ID NO: 1 derived from the H5N8-type highly pathogenic influenza A virus and a nucleotide sequence of SEQ ID NO: 2 into a vector.

The term'vector' herein is a linear or circular DNA molecule composed of fragments encoding a polypeptide of interest operably linked to additional fragments provided for transcription of the vector. Such additional fragments include promoter and termination code sequences. The vector also includes one or more origins of replication, one or more selection markers, and the like. Vectors are generally derived from plasmid or viral DNA, or contain elements of both.

According to one embodiment of the invention, the vector is a v2pHW vector.

The v2pHW vector (Republic of Korea Patent No. 10-1323582) is a Vero cell (monkey-derived) of the human PolI promoter of the pHW2000 vector (Hoffmann E et al. Proc Natl Acad Sci USA 2000 23;97(11):6108-13). It is a vector substituted with the derived PolI promoter.

According to one embodiment of the invention, the recombinant plasmid consists of a first recombination plasmid comprising HA and a second recombination plasmid comprising NA.

Step (b): Preparation of a recombinant plasmid comprising PB2, PB1, PA, NP, M and NS of low pathogenic influenza A virus, respectively

Next, a recombinant plasmid was prepared by cloning the PB2, PB1, PA, NP, M, and NS derived from the low pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8, into vectors, respectively.

The recombinant plasmid of step (b) includes PB2, PB1, PA, NP, M and NS, respectively, consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 derived from the low pathogenic influenza A virus.

In one embodiment of the invention, the low pathogenic influenza A virus is A/PR/8/34 (H1N1).

Recombinant plasmids were prepared by cloning PB2, PB1, PA, NP, M, and NS derived from the low pathogenic influenza A virus, respectively, consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 of the low pathogenic influenza A virus into vectors.

According to one embodiment of the invention, the recombinant plasmid is a third recombination plasmid comprising PB2, a fourth recombination plasmid comprising PB1, a fifth recombination plasmid comprising PA, a sixth recombination plasmid comprising NP, M It is composed of a seventh recombination plasmid comprising and an eighth recombination plasmid comprising NS.

Step (c): Transfection into packaging cells

Next, the first to eighth recombination plasmids of steps (a) and (b) are transfected into packaging cells.

As used herein, the term'packaging cell' refers to a cell capable of producing a recombinant virus through a non-viral transfection method. For example, packaging cells are H5N8 type influenza A of genetic recombination in which HA, NA, PB2, PB1, PA, NP, M and NS proteins expressed from transfected first to eighth recombination plasmids are assembled. It can produce viruses.

According to one embodiment of the invention, the packaging cells are one or more cells selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells.

According to a specific embodiment of the invention, the packaging cells are 293T cells.

Step (d): Obtaining H5N8 type recombinant influenza A virus

Finally, the H5N8 recombinant influenza A virus is obtained from the culture supernatant of the packaging cells.

According to another aspect of the invention, the present invention (i) H5N8 type high pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1 virus derived HA (hemagglutinin);

(Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And

(iii) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (PB2) derived from the low-pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 A non-structural protein (H5N8) recombinant influenza A virus [rgAIV_Gimje2(H5N8)] containing the genome of eight negative-sense ssRNAs is provided.

Since the H5N8-type recombinant influenza A virus of the present invention is almost the same as the contents of the method for preparing the H5N8-type recombinant influenza A virus described above, the contents common to the two are omitted to avoid excessive complexity of the present specification.

According to another aspect of the invention, the present invention (i) H5N8 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 1 HA (hemagglutinin); (Ii) NA (neuraminidase) derived from H5N8 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 2; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 Provided is a vaccine composition against H5 serotype influenza A virus, including the H5N8 type recombinant influenza A virus, comprising the genome of eight negative-sense ssRNAs (non-structural proteins).

According to an embodiment of the present invention, the H5 serotype influenza A virus is an H5N8 influenza A virus belonging to clade 2.3.4.4B.

The term'vaccine composition' as used herein refers to a composition that positively affects the immune response of a subject. The vaccine composition provides the subject with a cellular immune response, such as a Cytotoxic T Lymphocyte (CTL) or humoral immune response, such as an enhanced systemic or local immune response caused by antibodies. The target of the vaccine composition is a bird, a person, a dog, a horse, a pig, a cat, and the like, but is not limited thereto.

The vaccine composition of the present invention comprises a pharmaceutically effective amount of the H5N8 recombinant influenza A virus of the present invention. The vaccine composition may further include a pharmaceutically acceptable carrier. The term "pharmaceutically effective amount" as used herein refers to an amount sufficient to achieve prophylactic, alleviating or therapeutic efficacy against a disease or pathological condition caused by a virus. Pharmaceutically acceptable carriers that may be included in the compositions of the present invention are those commonly used in formulation, such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, silicic acid Calcium, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto. It is not. The composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). The vaccine composition of the present invention may include other components, such as stabilizers, excipients, other pharmaceutically acceptable compounds or any other antigens or parts thereof. Vaccines can exist in the form of freeze-dried preparations or suspensions, all of which are common in the field of vaccine production.

The dosage form of the vaccine composition of the present invention may be in the form of an enteric-coated unit, inoculation for intraperitoneal, intramuscular or subcutaneous administration, aerosol spray, oral or intranasal use. It is also possible to administer with drinking water or edible pellets. The vaccine composition of the present invention can also be expressed in a single vaccine by expressing heterologous antigens and immunomodulatory molecules such as cytokines in the same recombinant, and as a “cocktail” comprising two or more viral vectors carrying different foreign genes or adjuvants. Can be administered. As used herein, the term “adjuvant” is generally any substance that increases the humoral or cellular immune response to an antigen (eg, alum, Freund's complete adjuvant, Freund's incomplete adjuvant, LPS, poly IC) , poly AU, etc.).

According to another aspect of the present invention, the present invention provides a method for preparing H5N6 recombinant influenza A virus comprising the following steps:

(a) A recombinant plasmid by cloning a H5N6 type highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 9 and a NA (neuraminidase) derived from a H5N6 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10 into a vector, respectively. Preparing a;

(b) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (non-matrix protein) derived from the low-pathogenic influenza A virus consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 -structuring a recombinant plasmid by cloning each structural vector) into a vector;

(c) transfecting the recombinant plasmids of steps (a) and (b) into packaging cells; And

(d) obtaining H5N6 recombinant influenza A virus from culture supernatant of packaging cells.

In the present specification, the term'H5N6 influenza A virus' refers to an influenza A virus in which the antigen characteristic of the HA protein, which is the surface protein of the influenza A virus, is H5 and the antigen characteristic of the NA protein is N6.

According to an embodiment of the present invention, the H5N6 type highly pathogenic influenza A virus is A/duck/Korea/H35/2017 (H5N6) belonging to clade 2.3.4.4B.

A/duck/Korea/H35/2017 (H5N6) is an influenza A virus and hosts ducks according to the nomenclature of influenza virus [subtype/origin host/separation area/separation sequence/separation year (type HA, type NA)] It means that the virus isolated in 2017 in Korea has antigenic forms of H5 and N6.

The H5N6 highly pathogenic influenza A virus-derived HA consisting of the nucleotide sequence of SEQ ID NO: 9 is HA in which a high pathogenicity-inducing gene is deleted.

According to an embodiment of the present invention, the HA derived from the H5N6 type highly pathogenic influenza A virus is HA in which Lys-Arg-Arg-Lys (KRRK) deleted at the carboxy terminal site of HA1 constituting HA.

According to another aspect of the invention, the present invention (i) H5N6 type high pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9 derived from HA (hemagglutinin);

(Ii) NA (neuraminidase) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10; And

(iii) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (PB2) derived from the low-pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 A non-structural protein, H5N6-type recombinant influenza A virus [rgAIV_H35(H5N6)], which contains the genome of eight negative-sense ssRNAs, is provided.

According to another aspect of the present invention, the present invention (i) H5N6 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9 HA (hemagglutinin); (Ii) NA (neuraminidase) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10; And (iii) low pathogenic influenza A virus-derived PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein) and NS, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 Provided is a vaccine composition against H5 serotype influenza A virus, including the recombinant H5N6 influenza A virus, which contains the genome of eight negative-sense ssRNAs (non-structural proteins).

According to an embodiment of the present invention, the H5 serotype influenza A virus is H5N6 influenza A virus belonging to clade 2.3.4.4B.

The method for preparing the recombinant H5N6 influenza A virus of the present invention, the vaccine composition for the H5N6 recombinant influenza A virus and the H5 serotype influenza A virus, is substantially the same as the contents of the H5N8 recombinant influenza A virus described above, and thus is common to both. The contents are omitted to avoid excessive complexity of the present specification.

The present invention provides a vaccine composition for a recombinant influenza A virus, a method for manufacturing the same, and an H5 serotype influenza A virus belonging to clade 2.3.4.4B including the same. The present invention may contribute to disease control through a protective effect against a H5 serotype highly pathogenic avian influenza outbreak, which is introduced from overseas or occurs in Korea, by preparing a genetic recombinant vaccine showing a protective effect on a highly pathogenic avian influenza virus. In addition, the vaccine composition is excellent in pathogenicity and safety, as well as the high pathogenicity of the HA segment is removed, and is excellent in proliferation in eggs (egg) and defense in chickens.

1A shows images after 72 hours of inoculation of a fetus inoculated with A/chicken/Korea/Gimje2/2017 (H5N8) (left) and rgAIV_Gimje2 (H5N8) vaccine strains (right).
Figure 1b shows images after 72 hours of inoculation of a fetus inoculated with A/duck/Korea/H35/2017 (H5N6) (left) and rgAIV_H35 (H5N6) vaccine strain (right).
Figure 2a shows the percentage of survival for 14 days after challenge with A/chicken/Korea/Gimje2/2017 (H5N8) of SPF chickens vaccinated or not vaccinated with the rgAIV_Gimje2 (H5N8) vaccine strain.
Figure 2b shows the percentage of survival for 14 days after the challenge of A/duck/Korea/H35/2017 (H5N6) of SPF chickens vaccinated or vaccinated with the rgAIV_H35 (H5N6) vaccine strain.
3A shows HI titers for 15 weeks after vaccination with rgAIV_Gimje2 (H5N8).
3B shows HI titers for 15 weeks after vaccination with rgAIV_H35 (H5N6) vaccine.

Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Throughout this specification, "%" used to indicate the concentration of a specific substance, unless otherwise specified, solids/solids (weight/weight)%, solids/liquids (weight/volume)%, and The liquid/liquid is (volume/volume) %.

Example

Example 1 Preparation of Attenuated H5N8 Recombinant Influenza A Virus Vaccine

1-1. Removal of HA gene (H5) of H5N8 highly pathogenic influenza A virus

RNA is extracted from the A/chicken/Korea/Gimje2/2017(H5N8) influenza virus using an RNA extration kit (iNtRON, Korea). To remove the highly pathogenic gene (KRRK) at the segment of the HA part, amplify two segments using overlapping primers shown in Table 1 below, and then use these two segments to amplify the HA gene through PCR Was amplified (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number HA1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGG 11 H26-MuCl-H5R CCTCTTGTTTCTCTTTGAGGACTATTTCTGAGCCC 12 H26-MuCl-H5F CTCAAAGAGAAACAAGAGGACTATTTGGAGCTATA 13 NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 14

1-2. Gene NA (N8) amplification of H5N8 highly pathogenic influenza A virus

After performing the experiment in the same manner as in Example 1-1 to make cDNA, NA (N8) was amplified through PCR using primers at the ends shown in Table 2 below (PCR conditions: 94°C 30 seconds, 57°C) 1 minute, 72°C 2 minutes/35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number N1-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGAG 15 N1-1413R GGGCCGCCGGGTTATTAGTAGAAACAAGGAGT 16

1-3. Vector cloning of H5N8 highly pathogenic influenza A virus

Genes HA and NA amplified using PCR in Examples 1-1 and 1-2 were conjugated to v2pHW (KCDC) with an In-Fusion HD Cloning kit (Takara, USA), and then E. coli, stella competent cells) and transformed with LB broth (Bio Science, Korea) for 18 hours in a 37°C shaking incubator, purified with Plasmid DNA purification Kit (iNtRON, Korea), and HA and NA Genes were obtained.

1-4. Vector cloning of low pathogenic influenza A/PR/8/34 (H1N1)

A/PR/8/34 (H1N1) virus (ATCC, USA) was subjected to the experiment in the same manner as Examples 1-1 to 1-3 above to list the PB2, PB1, PA, NP, M, NS genes. After amplification through PCR using the specific primers shown in 3 (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), in-Fusion HD Cloning kit (Takara) in v2pHW (KCDC) , USA), transformed with E. coli (E. coli, stella competent cells), and then cultured for 18 hours in a 37°C shaking incubator using LB broth (Bioscience, Korea). Purified with Plasmid DNA purification Kit (iNtRON, Korea) to obtain PB2, PB1, PA, NP, M and NS genes.

Primer name Base sequence (5'->3') Sequence number Phw-PB2-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTC 17 Phw-PB2-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGTCG 18 Phw-PB1-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGCA 19 Phw-PB1-2341R GGGCCGCCGGGTTATTAGTAGAAACAAGGCAT 20 Phw-PA-1F TCCGAAGTTGGGGGGGAGCGAAAGCAGGTA 21 Phw-PA-2233R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAC 22 Phw-NP-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 23 Phw-NP-1565R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTA 24 Phw-M-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGTA 25 Phw-M-1027R GGGCCGCCGGGTTATTAGTAGAAACAAGGTAG 26 Phw-NS-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGT 27 Phw-NS-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTG 28

1-5. Preparation of attenuated H5N8 type recombinant influenza A virus

The plasmids obtained in 1-3 and 1-4 in the above embodiment were cultured in 293T cells at 37° C., 5% CO ₂ , and 0.5 ul of each plasmid was used for Lipofectamine LTX and Plus Reagent (Lipofectamin LTX and Plus Reagent) , Invitrogen, USA) After 48 hours of inoculation (transfection), the supernatant was inoculated into 10 days old specific pathogen free (SPF) incubated eggs (10 ^5.0 EID ₅₀ /0.1 ml) and attenuated recombinant H5N8 serotype Virus strain (hereinafter referred to as rgAIV_Gimje2 (H5N8)) was obtained (Depository: Animal and Plant Quarantine Agency, deposit date March 28, 2018).

Example 2. Preparation of attenuated H5N6 type recombinant influenza A virus vaccine

2-1. Removal of HA gene (H5) of H5N6 highly pathogenic influenza A virus

RNA is extracted from the A/duck/Korea/H35/2017 (H5N6) influenza virus using an RNA extration kit (iNtRON, Korea). To remove the highly pathogenic gene (KRRK) of the segment of the HA part, amplify two segments using overlapping primers shown in Table 1 above, and then use these two segments to amplify the HA gene through PCR Was amplified (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), and was used as a material for the following experiment.

2-2. Gene NA (N6) amplification of H5N8 highly pathogenic influenza A virus

After performing the experiment in the same manner as in Example 2-1 to make cDNA, NA (N6) was amplified through PCR using primers at the ends shown in Table 4 below (PCR conditions: 94°C 30 seconds, 57°C) 1 minute, 72°C 2 minutes/35 times), and was used as a material for the following experiment.

Primer name Base sequence (5'->3') Sequence number N6-1F TCCGAAGTTGGGGGGGAGCAAAAGCAGGGTGAAAATG 29 N6-890R GGGCCGCCGGGTTATTAGTAGAAACAAGGGTGTTTT 30

2-3. Vector cloning of H5N6 highly pathogenic influenza A virus

Genes HA and NA amplified using PCR in Examples 2-1 and 2-2 were conjugated to v2pHW (KCDC) with an In-Fusion HD Cloning kit (Takara, USA), and then E. coli, stella competent cells) and transformed with LB broth (Bio Science, Korea) for 18 hours in a 37°C shaking incubator, purified with Plasmid DNA purification Kit (iNtRON, Korea), and HA and NA Genes were obtained.

2-4. Vector cloning of low pathogenic influenza A/PR/8/34 (H1N1)

In the A/PR/8/34 (H1N1) virus (ATCC, USA), PB2, PB1, PA, NP, M, and NS genes were tested in the same manner as in Examples 2-1 to 2-3 above. After amplification through PCR using the specific primers shown in 3 (PCR conditions: 94°C 30 seconds, 57°C 1 minute, 72°C 4 minutes/35 times), in-Fusion HD Cloning kit (Takara) in v2pHW (KCDC) , USA), transformed with E. coli (E. coli, stella competent cells), and then cultured for 18 hours in a 37°C shaking incubator using LB broth (Bioscience, Korea). Purified with Plasmid DNA purification Kit (iNtRON, Korea) to obtain PB2, PB1, PA, NP, M and NS genes.

2-5. Preparation of attenuated H5N6-type recombinant influenza A virus

The plasmids obtained in 2-3 and 2-4 in the above embodiment were cultured in 293T cells at 37° C., 5% CO ₂ , and 0.5 ul of each plasmid was used for Lipofectamine LTX and Plus Reagent (Lipofectamin LTX and Plus Reagent) , Invitrogen, USA) After 48 hours of transfection, attenuated recombinant H5N6 serotypes were inoculated by inoculation (10 ^5.0 EID ₅₀ /0.1ml) into 10 days old specific pathogen free (SPF) embryonated eggs. Virus strain (hereinafter referred to as rgAIV_H35 (H5N6)) was obtained (Depository: Animal and Plant Quarantine Agency, deposit date March 28, 2018).

Example 3. Preparation method of Zadok vaccine

RgAIV_Gimje2 (H5N8) stocks obtained from Examples 1 and 2 above (depository: Korea Veterinary Culture Collection, KVCC, deposit date: March 28, 2018, deposit number: VR1800010) and rgAIV_H35 (H5N6) stock (depository organization: Korea Veterinary Culture Collection, KVCC, Deposit Date: March 28, 2018, Deposit Number: VR1800018) were inoculated into 100 10-day-old SPF incubated eggs, respectively, and cultured in a 37°C incubator for 72 hours. After hatching the incubated eggs cultured for 72 hours at 4°C for 6 hours, urine is obtained. After concentrating the obtained urine to 1/10, the concentrated virus is inactivated with 0.01% formalin at 4°C for 12 hours.

Experimental Example

Experimental Example 1. Verification of elimination of the presence of highly pathogenic genes in the HA segment

In order to verify whether or not to remove the HA gene of rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) obtained in Examples 1 and 2, an experiment was performed as follows.

1-1. Verification by genetic analysis

The highly pathogenic avian influenza has a high pathogenic gene (RRRKK: AGA AGA AGA AAA AAG) at the HA protein segment, so that RRRKK is removed at the HA protein segment to develop a vaccine against poultry systemic organ infection and fatal disease. An attenuated vaccine strain should be developed.

After amplifying the HA gene by PCR according to the experimental method of Example 1-1 from the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine strains, cloning them into a v2pHW vector, and then Briddye Terminaor v3.1 Cycle Sequencing Kit (Bionix, Korea) After obtaining the base sequence with Applied Biosystems 3730XL DNA Analyzer using the CLC program (USA) was confirmed to remove the high pathogenic gene.

As a result of the experiment, as shown in Tables 5 and 6, it was confirmed that the highly pathogenic gene KRRK was removed from the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine strains.

Virus strain Amino acid sequence A/chicken/Korea/Gimje2/2017(H5N8) PLREKRRKR/GLF rgAIV_Gimje2(H5N8) PQRETR/GLF

Virus strain Amino acid sequence A/duck/Korea/H35/2017(H5N6) PLREKRRKR/GLF rgAIV_H35(H5N6) PQRETR/GLF

1-2. Inoculation into 10-day-old incubation eggs and verification

When a highly pathogenic avian influenza virus having the high pathogenic gene RRRKK is inoculated into a 10-day-old hatchery egg, the embryo is killed and the blood vessels are not visible during blacking by lanterns.

A highly pathogenic avian influenza virus and the attenuated rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine strains obtained in Examples 1 and 2 were inoculated into 10-day-old incubated eggs, respectively, and the status of fetal embryos was measured using lanterns after 72 hours. It was censored.

As shown in Figures 1a and 1b, the hatching eggs inoculated with the highly pathogenic avian influenza virus were blacked out by lanterns, and the blood vessels were hardly visible, whereas the hatched eggs inoculated with the attenuated rgAIV_Gimje2 (H5N8) or rgAIV_H35 (H5N6) vaccine strains Silver fetus did not die, it was possible to identify clear blood vessels.

Experimental Example 2. Safety and immunity verification of vaccine strains

To confirm the safety and immunity of the vaccine obtained in Example 3 against H5N8 type or H5N6 type highly pathogenic avian influenza virus, experiments were performed as follows using SPF chicken.

2-1. Safety test of rgAIV_Gimje2(H5N8) vaccine strain

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the H5N8 type highly pathogenic avian influenza vaccine efficacy assay. 10 ml of 6 week old SPF chickens were inoculated with 1 ml (500 ul/dose) rgAIV_Gimje2 (H5N8) avian influenza vaccine antigen (10 ^9.0 EID ₅₀ /0.1 ml). After 2 weeks of inoculation, serum was obtained to verify antibody titer by hemagglutination inhibition (HI). The 10 SPF chickens used as controls were inoculated with physiological saline to compare efficacy.

As a result, as shown in Table 7 below, all 10 SPF chickens vaccinated showed a hemagglutination inhibitory titer (HI) titer of 2 ⁷ or more, and did not show any special clinical symptoms such as death and weight loss. I could confirm.

No. Vaccinated individuals Control HI titer Death/immunization HI titer Death/immunization One 8 0/10 <1 0/10 2 9 <1 3 9 <1 4 4 <1 5 9 <1 6 10 <1 7 8 <1 8 11 <1 9 10 <1 10 9 <1

2-2. Safety test of rgAIV_H35(H5N6) vaccine strain

As a result of conducting an experiment for safety against the rgAIV_H35 (H5N6) vaccine strain in the same manner as in Experimental Example 2-1, as shown in Table 8 below, all 10 SPF chickens vaccinated with the hemagglutination inhibitory titer (HI) Titers showed 2 ⁷ or higher, and it was confirmed that there were no special clinical symptoms such as death or weight loss.

No. Vaccinated individuals Control HI titer Death/immunization HI titer Death/immunization One 6 0/10 <1 0/10 2 4 <1 3 9 <1 4 7 <1 5 9 <1 6 6 <1 7 9 <1 8 6 <1 9 8 <1 10 8 <1

Experimental Example 3. Validation of vaccine strain

In order to verify the efficacy of the rgAIV_Gimje2 (H5N8) and rgAIV_H35 (H5N6) vaccine antigens obtained in Example 3, an experiment was performed as follows.

10 6-week-old SPF chickens were inoculated with rgAIV_Gimje2 (H5N8) or rgAIV_H35 (H5N6) avian influenza vaccine antigen (10 ^9.0 EID ₅₀ /0.1 ml) in the biceps muscle of the right leg (10 ^9.0 EID ₅₀ /0.1 ml), and not vaccinated after 3 weeks to _{^{10 6 Egg Infectious dose (EID 50}} ) of the 10 animals with the control group that was determined 14 days survival by the nose attack inoculation.

3-1. Histological virus titer validation for rgAIV_Gimje2 (H5N8)

Virus titer (log ₁₀ EID ₅₀ /0, according to the experimental method of Experimental Example 3) was performed using swabs from the experimental group and the control group on the 3rd and 5th days after inoculation with 10 ⁶ Egg Infectious dose (EID ₅₀ ). 1 ml) was measured.

Group Sample Number of virus discharges/survival.
(Viral titer, log ₁₀ TCID ₅₀ /0.1ml, mean ± standard deviation) Survival/Total 3 days later 5 days later 7 days later 10 days later 14 days later Vaccination Pharynx 0/10 0/10 0/10 0/10 0/10 10/10 Total excretion steel 0/10 0/10 0/10 0/10 0/10 Control Pharynx 4/4
(3.9±0.5) 2/4
(3.3±0.7) 1/4
(2.7) 0/1 0/1 1/10 Total excretion steel 2/4
(1.5±0.4) 3/4
(3.5±1.2) 1/4
(3.3) 0/1 0/1

As a result, in the experimental group inoculated with the rgAIV_Gimje2 (H5N8) vaccine antigen (independent vaccine), the highly pathogenic H5N8 avian influenza virus was not detected in the pharyngeal swab sample, whereas the control group was confirmed to have detected a high titer virus in the pharyngeal swab sample. Table 9.

Therefore, it was confirmed that the rgAIV_Gimje2 (H5N8) poison vaccine of the present invention shows excellent defense against H5N8-type highly pathogenic influenza virus.

3-2. Histological virus titer validation for rgAIV_H35 (H5N6)

Virus titer (log ₁₀ EID ₅₀ /0,1) was performed using a swab from the experimental group and the control group on the 3rd and 5th days after inoculation with 10 ⁶ Egg Infectious dose (EID50) according to the experimental method of Experimental Example 3 above. ml) was measured.

Group Sample Number of virus discharges/survival.
(Viral titer, log ₁₀ TCID ₅₀ /0.1ml, mean ± standard deviation) Survival/Total 3 days later 5 days later 7 days later 10 days later 14 days later Vaccination Pharynx 0/10 0/10 0/10 0/10 0/10 10/10 Total excretion steel 0/10 0/10 0/10 0/10 0/10 Control Pharynx Death Death Death Death Death 0/10 Total excretion steel Death Death Death Death Death

As a result, in the experimental group inoculated with the rgAIV_H35 (H5N6) vaccine antigen (independent vaccine), the highly pathogenic H5N6 avian influenza virus was not detected in the pharyngeal swab sample, whereas the control group was confirmed to have detected a high titer virus in the pharyngeal swab sample. Table 10.

Therefore, it was confirmed that the rgAIV_H35 (H5N6) poison vaccine of the present invention exhibits excellent defense against H5N6 type highly pathogenic influenza virus.

Experimental Example 4. Verification of immunogenicity of vaccine strains

Since SPF chicken is a vaccine developed for use as an actual target animal, it was used for the high-pathogenic H5N8 avian influenza vaccine efficacy assay. 1 ml (500 ul/dose) of rgAIV_Gimje2 (H5N8) or rgAIV_H35 (H5N6) avian influenza vaccine antigen was obtained from 10-week-old 6-week-old SPF chicken biceps muscles to obtain serum for 15 weeks to induce antibody titer changes. It was verified by inhibition reaction (HI, hemagglutination inhibition).

The World Organization for Animal Health (OIE) is setting standards for poultry reduction as well as reduction of viral emissions if poultry is above 2 ⁷ in poultry.

4-1. Titer measurement of rgAIV_Gimje2(H5N8)

As shown in the experimental results of Figure 3a, it was confirmed that the antibody maintained a high titer of 2 ⁷ or more until 15 weeks after vaccination with rgAIV_Gimje2 (H5N8) (Table 11 and Figure 3a). 'Wpv' in Table 11 means'weeks post vaccination'.

- 2 wpv 3 wpv 8 wpv 12 wpv 16 wpv 20wpv 24wpv Titer 9.9 11.4 10.4 9.8 9.8 7.8 7.4

4-2. Titer measurement of rgAIV_H35(H5N6)

3B, it was confirmed that the antibody maintained a high titer of 2 ⁷ or more until 15 weeks after vaccination with rgAIV_H35 (H5N6) (Table 12 and FIG. 3B).

- 2 wpv 3 wpv 8 wpv 12 wpv 16 wpv 20wpv 24wpv Titer 8.6 10.0 9.1 8.1 7.7 7.8 7.9

<110> REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Recombinant Influenza A virus and Vaccine Composition for H5 Serotype Influenza A virus belonging to clade 2.3.4.4B comprising the same <130> PN180377D <160> 30 <170> KoPatentIn 3.0 <210> 1 <211> 1733 <212> RNA <213> Influenza A virus <400> 1 ttcactctgt caaaatggag aacatagtgc ttcttcttgc aatagttagc cttgttaaag 60 gtgatcagat ttgcattggt taccatgcaa acaactcgac agagcaagtt gacacgataa 120 tggaaaagaa cgtcactgtt acacatgccc aagacatact ggaaaaaaca cacaacggga 180 agctctgcga tctaaatggg gtgaagcctc tgattttaaa ggattgtagt gtagctggat 240 ggctcctcgg aaactcaatg tgcgacgaat tcatcagagt gccggaatgg tcttacatag 300 tggagagggc taacccagct aatgacctct gttacccagg gagcctcaat gactatgaag 360 aactgaaaca cctgttgagc agaataaatc attttgagaa gattctgatc atccccaaga 420 gttcttggcc caatcatgaa acatcattag gggtgagcgc agcttgtcca taccagggaa 480 cgccctcctt tttcagaaat gtggtatggc ttatcaaaaa gaacgatgca tacccaacaa 540 taaagataag ctacaataat accaatcggg aagatctctt gatactgtgg gggattcatc 600 attccaacaa tgcagaagag cagacaaatc tctataagaa cccaaccacc tatatttcag 660 ttggaacatc aacattaaac cagagattgg taccaaaaat ggctactaga tcccaagtaa 720 acgggcaacg gggaagaatg gacttcttct ggacaatttt aaaaccgaat gatgcaatcc 780 acttcgagag taatggaaat ttcattgctc cagaatatgc atacaaaatt gtcaagaaag 840 gggactcaac aattatgaaa agtgaagtgg aatatggcca ctgcaacacc aaatgtcaaa 900 ccccagtagg agcgataaac tctagtatgc cattccacaa tatacatcct ctcaccatcg 960 gggaatgccc caaatatgtg aagtcaaaca agttggtcct tgcgactggg ctcagaaata 1020 gtcctcaaag agaaacaaga ggactatttg gagctatagc aggttttata gagggaggat 1080 ggcagggaat ggttgatggt tggtatgggt accaccatag caatgagcag ggaagtgggt 1140 acgctgcaga caaagaatcc acccaaaagg caatagatgg agttaccaat aaggtcaact 1200 cgatcattga caaaatgaac actcaatttg aggcagttgg aagggagttt aataacttag 1260 aaaggaggat agagaatttg aacaagaaaa tggaagacgg attcctagat gtctggacct 1320 ataatgctga acttctagtt ctcatggaaa acgagaggac tctagatttc catgactcaa 1380 atgtcaagaa cctttacgac aaagccagac tgcagcttag ggataatgca aaggagctgg 1440 gtaacggttg tttcgagttc tatcacaaat gtgataatga atgtatggaa agtgtgagaa 1500 atgggacgta tgactaccct cagtattcag aagaagcaag attaaaaaga gaagaaataa 1560 gcggagtgaa attagaatca ataggaactt accaaatact gtcaatttat tcaacagtgg 1620 cgagttccct agcactggca atcatggtgg ctggtctatc tttatggatg tgctccaatg 1680 ggtcgttaca gtgcagaatt tgcatttaaa tttgtgagct cagattgtag tta 1733 <210> 2 <211> 1413 <212> RNA <213> Influenza A virus <400> 2 atgaatccaa atcagaaaat agtgaccgtt ggctccattt cattagggtt ggttgtattc 60 aatgttctac tgcatgccgt gagcatcata ttaatggtgt tagccctggg gaaaagtgaa 120 aacaatggaa tctgcaaggg aactatagta agggaatata atgaaacagt taggatagag 180 aaagtgactc aatggtacaa tactagtgta gtcgaatatg taccgcattg gaacgagggc 240 gcttatataa ataacaccga accaatatgt gatgtcaagg gctttgcacc tttttccaag 300 gacaacggga taagagttgg ctccagggga catatttttg tcataaggga gcctttcgtc 360 tcttgttcac ctgtagagtg cagaactttc ttcctcactc agggagctct actcaatgac 420 aaacactcaa atggaacagt gaaggataga agcccattca gaactctcat gagtgtcgaa 480 gtgggtcaat cacccaatgt atatcaagca aggtttgaag ctgtagcatg gtcagcaaca 540 gcctgtcatg atggcaagaa atggatgacg attggtgtaa cagggccaga ttctaaagca 600 gtagcagtag tccattacgg aggggtgcct actgatgttg ttaactcctg ggcgggagat 660 atattaagga ctcaggagtc atcttgtact tgcattcaag gtaattgtta ttgggtaatg 720 actgacggtc cagccaatag acaggcgcag tatagaatat acaaagcaaa tcaaggcaaa 780 ataattgacc aaacagatgt cagctttagt ggaggacata ttgaggaatg ttcttgttat 840 ccaaatgatg gtaaagtgga atgcgtgtgt agagacaact ggacgggaac taacaggcct 900 gtgctagtca tttcgcctga tctctcttac agggttgggt atttatgtgc aggattgccc 960 agtgacactc caagagggga agatgctcaa tttgtcggtt catgcactag tcccatggga 1020 aatcagggat atggcgtaaa aggtttcggg tttcgacagg gaactgatgt gtgggtgggg 1080 cggacaatta gtcgaacctc caggtcaggg tttgaaataa taaggataaa gaatggttgg 1140 acgcagacaa gcaaagaaca gattagaagg caggtggttg ttgataattt gaattggtcg 1200 ggatacagtg ggtctttcac tttaccagta gaattgtctg ggaggggatg tttagtcccc 1260 tgtttttggg tcgaaatgat cagaggcagg ccagaagaaa gaacaatctg gacctctagt 1320 agctccattg taatgtgtgg agttgatcat gaaattgccg attggtcatg gcacgatgga 1380 gctattcttc cctttgacat cgataagatg taa 1413 <210> 3 <211> 2313 <212> RNA <213> Influenza A virus <400> 3 tcaattatat tcaatatgga aagaataaaa gaactaagaa atctaatgtc gcagtctcgc 60 acccgcgaga tactcacaaa aaccaccgtg gaccatatgg ccataatcaa gaagtacaca 120 tcaggaagac aggagaagaa cccagcactt aggatgaaat ggatgatggc aatgaaatat 180 ccaattacag cagacaagag gataacggaa atgattcctg agagaaatga gcaaggacaa 240 actttatgga gtaaaatgaa tgatgccgga tcagaccgag tgatggtatc accactggct 300 gtgacatggt ggaataggaa tggaccaata acaaatacag ttcattatcc aaaaatctac 360 aaaacttatt ttgaaagagt cgaaaggcta aagcatggaa cctttggccc tgtccatttt 420 agaaaccaag tcaaaatacg tcggagagtt gacataaatc ctggtcatgc agatctcagt 480 gccaaggagg cacaggatgt aatcatggaa gttgttttcc ctaacgaagt gggagccagg 540 atactaacat cggaatcgca actaacgata accaaagaga agaaagaaga actccaggat 600 tgcaaaattt ctcctttgat ggttgcatac atgttggaga gagaactggt ccgcaaaacg 660 agattcctcc cagtggctgg tggaacaagc agtgtgtaca ttgaagtgtt gcatttgact 720 caaggaacat gctgggaaca gatgtatact ccaggagggg aagtgaggaa tgatgatgtt 780 gatcaaagct tgattattgc tgctaggaac atagtgagaa gagctgcagt atcagcagat 840 ccactagcat ctttattgga gatgtgccac agcacacaga ttggtggaat taggatggta 900 gacatcctta ggcagaaccc aacagaagag caagccgtgg atatatgcaa ggctgcaatg 960 ggactgagaa ttagctcatc cttcagtttt ggtggattca catttaagag aacaagcgga 1020 tcatcagtca agagagagga agaggtgctt acgggcaatc ttcaaacatt gaagataaga 1080 gtgcatgagg gatatgaaga gttcacaatg gttgggagaa gagcaacagc catactcaga 1140 aaagcaacca ggagattgat tcagctgata gtgagtggga gagacgaaca gtcgattgcc 1200 gaagcaataa ttgtggccat ggtattttca caagaggatt gtatgataaa agcagtcaga 1260 ggtgatctga atttcgtcaa tagggcgaat cagcgattga atcctatgca tcaactttta 1320 agacattttc agaaggatgc gaaagtgctt tttcaaaatt ggggagttga acctatcgac 1380 aatgtgatgg gaatgattgg gatattgccc gacatgactc caagcatcga gatgtcaatg 1440 agaggagtga gaatcagcaa aatgggtgta gatgagtact ccagcacgga gagggtagtg 1500 gtgagcattg accgtttttt gagaatccgg gaccaacgag gaaatgtact actgtctccc 1560 gaggaggtca gtgaaacaca gggaacagag aaactgacaa taacttactc atcgtcaatg 1620 atgtgggaga ttaatggtcc tgaatcagtg ttggtcaata cctatcaatg gatcatcaga 1680 aactgggaaa ctgttaaaat tcagtggtcc cagaacccta caatgctata caataaaatg 1740 gaatttgaac catttcagtc tttagtacct aaggccatta gaggccaata cagtgggttt 1800 gtaagaactc tgttccaaca aatgagggat gtgcttggga catttgatac cgcacagata 1860 ataaaacttc ttcccttcgc agccgctcca ccaaagcaaa gtagaatgca gttctcctca 1920 tttactgtga atgtgagggg atcaggaatg agaatacttg taaggggcaa ttctcctgta 1980 ttcaactata acaaggccac gaagagactc acagttctcg gaaaggatgc tggcacttta 2040 actgaagacc cagatgaagg cacagctgga gtggagtccg ctgttctgag gggattcctc 2100 attctgggca aagaggacaa gagatatggg ccagcactaa gcatcaatga actgagcaac 2160 cttgcgaaag gagagaaggc taatgtgcta attgggcaag gagacgtggt gttggtaatg 2220 aaacggaaac gggactctag catacttact gacagccaga cagcgaccaa aagaattcgg 2280 atggccatca attagtgtcg aatagtttaa aaa 2313 <210> 4 <211> 2313 <212> RNA <213> Influenza A virus <400> 4 gcaaaccatt tgaatggatg tcaatccgac cttacttttc ttaaaagtgc cagcacaaaa 60 tgctataagc acaactttcc cttatactgg agaccctcct tacagccatg ggacaggaac 120 aggatacacc atggatactg tcaacaggac acatcagtac tcagaaaagg gaagatggac 180 aacaaacacc gaaactggag caccgcaact caacccgatt gatgggccac tgccagaaga 240 caatgaacca agtggttatg cccaaacaga ttgtgtattg gaggcgatgg ctttccttga 300 ggaatcccat cctggtattt ttgaaaactc gtgtattgaa acgatggagg ttgttcagca 360 aacacgagta gacaagctga cacaaggccg acagacctat gactggactc taaatagaaa 420 ccaacctgct gcaacagcat tggccaacac aatagaagtg ttcagatcaa atggcctcac 480 ggccaatgag tctggaaggc tcatagactt ccttaaggat gtaatggagt caatgaacaa 540 agaagaaatg gggatcacaa ctcattttca gagaaagaga cgggtgagag acaatatgac 600 taagaaaatg ataacacaga gaacaatggg taaaaagaag cagagattga acaaaaggag 660 ttatctaatt agagcattga ccctgaacac aatgaccaaa gatgctgaga gagggaagct 720 aaaacggaga gcaattgcaa ccccagggat gcaaataagg gggtttgtat actttgttga 780 gacactggca aggagtatat gtgagaaact tgaacaatca gggttgccag ttggaggcaa 840 tgagaagaaa gcaaagttgg caaatgttgt aaggaagatg atgaccaatt ctcaggacac 900 cgaactttct ttcaccatca ctggagataa caccaaatgg aacgaaaatc agaatcctcg 960 gatgtttttg gccatgatca catatatgac cagaaatcag cccgaatggt tcagaaatgt 1020 tctaagtatt gctccaataa tgttctcaaa caaaatggcg agactgggaa aagggtatat 1080 gtttgagagc aagagtatga aacttagaac tcaaatacct gcagaaatgc tagcaagcat 1140 cgatttgaaa tatttcaatg attcaacaag aaagaagatt gaaaaaatcc gatcgctctt 1200 aatagagggg actgcatcat tgagccctgg aatgatgatg ggcatgttca atatgttaag 1260 cactgtatta ggcgtctcca tcctgaatct tggacaaaag agatacacca agactactta 1320 ctggtgggat ggtcttcaat cctctgacga ttttgctctg attgtgaatg cacccaatca 1380 tgaagggatt caagccggag tcgacaggtt ttatcgaacc tgtaagctac ttggaatcaa 1440 tatgagcaag aaaaagtctt acataaacag aacaggtaca tttgaattca caagtttttt 1500 ctatcgttat gggtttgttg ccaatttcag catggagctt cccagttttg gggtgtctgg 1560 gatcaacgag tcagcggaca tgagtattgg agttactgtc atcaaaaaca atatgataaa 1620 caatgatctt ggtccagcaa cagctcaaat ggcccttcag ttgttcatca aagattacag 1680 gtacacgtac cgatgccata gaggtgacac acaaatacaa acccgaagat catttgaaat 1740 aaagaaactg tgggagcaaa cccgttccaa agctggactg ctggtctccg acggaggccc 1800 aaatttatac aacattagaa atctccacat tcctgaagtc tgcctaaaat gggaattgat 1860 ggatgaggat taccaggggc gtttatgcaa cccactgaac ccatttgtca gccataaaga 1920 aattgaatca atgaacaatg cagtgatgat gccagcacat ggtccagcca aaaacatgga 1980 gtatgatgct gttgcaacaa cacactcctg gatccccaaa agaaatcgat ccatcttgaa 2040 tacaagtcaa agaggagtac ttgaggatga acaaatgtac caaaggtgct gcaatttatt 2100 tgaaaaattc ttccccagca gttcatacag aagaccagtc gggatatcca gtatggtgga 2160 ggctatggtt tccagagccc gaattgatgc acggattgat ttcgaatctg gaaggataaa 2220 gaaagaagag ttcactgaga tcatgaagat ctgttccacc attgaagagc tcagacggca 2280 aaaatagtga atttagcttg tccttcatga aaa 2313 <210> 5 <211> 2206 <212> RNA <213> Influenza A virus <400> 5 gtactgatcc aaaatggaag attttgtgcg acaatgcttc aatccgatga ttgtcgagct 60 tgcggaaaaa acaatgaaag agtatgggga ggacctgaaa atcgaaacaa acaaatttgc 120 agcaatatgc actcacttgg aagtatgctt catgtattca gattttcact tcatcaatga 180 gcaaggcgag tcaataatcg tagaacttgg tgatccaaat gcacttttga agcacagatt 240 tgaaataatc gagggaagag atcgcacaat ggcctggaca gtagtaaaca gtatttgcaa 300 cactacaggg gctgagaaac caaagtttct accagatttg tatgattaca aggagaatag 360 attcatcgaa attggagtaa caaggagaga agttcacata tactatctgg aaaaggccaa 420 taaaattaaa tctgagaaaa cacacatcca cattttctcg ttcactgggg aagaaatggc 480 cacaaaggca gactacactc tcgatgaaga aagcagggct aggatcaaaa ccagactatt 540 caccataaga caagaaatgg ccagcagagg cctctgggat tcctttcgtc agtccgagag 600 aggagaagag acaattgaag aaaggtttga aatcacagga acaatgcgca agcttgccga 660 ccaaagtctc ccgccgaact tctccagcct tgaaaatttt agagcctatg tggatggatt 720 cgaaccgaac ggctacattg agggcaagct gtctcaaatg tccaaagaag taaatgctag 780 aattgaacct tttttgaaaa caacaccacg accacttaga cttccgaatg ggcctccctg 840 ttctcagcgg tccaaattcc tgctgatgga tgccttaaaa ttaagcattg aggacccaag 900 tcatgaagga gagggaatac cgctatatga tgcaatcaaa tgcatgagaa cattctttgg 960 atggaaggaa cccaatgttg ttaaaccaca cgaaaaggga ataaatccaa attatcttct 1020 gtcatggaag caagtactgg cagaactgca ggacattgag aatgaggaga aaattccaaa 1080 gactaaaaat atgaagaaaa caagtcagct aaagtgggca cttggtgaga acatggcacc 1140 agaaaaggta gactttgacg actgtaaaga tgtaggtgat ttgaagcaat atgatagtga 1200 tgaaccagaa ttgaggtcgc ttgcaagttg gattcagaat gagtttaaca aggcatgcga 1260 actgacagat tcaagctgga tagagctcga tgagattgga gaagatgtgg ctccaattga 1320 acacattgca agcatgagaa ggaattattt cacatcagag gtgtctcact gcagagccac 1380 agaatacata atgaaggggg tgtacatcaa tactgccttg cttaatgcat cttgtgcagc 1440 aatggatgat ttccaattaa ttccaatgat aagcaagtgt agaactaagg agggaaggcg 1500 aaagaccaac ttgtatggtt tcatcataaa aggaagatcc cacttaagga atgacaccga 1560 cgtggtaaac tttgtgagca tggagttttc tctcactgac ccaagacttg aaccacataa 1620 atgggagaag tactgtgttc ttgagatagg agatatgctt ataagaagtg ccataggcca 1680 ggtttcaagg cccatgttct tgtatgtgag aacaaatgga acctcaaaaa ttaaaatgaa 1740 atggggaatg gagatgaggc gttgcctcct ccagtcactt caacaaattg agagtatgat 1800 tgaagctgag tcctctgtca aagagaaaga catgaccaaa gagttctttg agaacaaatc 1860 agaaacatgg cccattggag agtcccccaa aggagtggag gaaagttcca ttgggaaggt 1920 ctgcaggact ttattagcaa agtcggtatt caacagcttg tatgcatctc cacaactaga 1980 aggattttca gctgaatcaa gaaaactgct tcttatcgtt caggctctta gggacaacct 2040 tgaacctggg acctttgatc ttggggggct atatgaagca attgaggagt gcctgattaa 2100 tgatccctgg gttttgctta atgcttcttg gttcaactcc ttccttacac atgcattgag 2160 ttagttgtgg cagtgctact atttgctatc catactgtcc aaaaaa 2206 <210> 6 <211> 1537 <212> RNA <213> Influenza A virus <400> 6 tagataatca ctcactgagt gacatcaaaa tcatggcgtc tcaaggcacc aaacgatctt 60 acgaacagat ggagactgat ggagaacgcc agaatgccac tgaaatcaga gcatccgtcg 120 gaaaaatgat tggtggaatt ggacgattct acatccaaat gtgcaccgaa ctcaaactca 180 gtgattatga gggacggttg atccaaaaca gcttaacaat agagagaatg gtgctctctg 240 cttttgacga aaggagaaat aaataccttg aagaacatcc cagtgcgggg aaagatccta 300 agaaaactgg aggacctata tacaggagag taaacggaaa gtggatgaga gaactcatcc 360 tttatgacaa agaagaaata aggcgaatct ggcgccaagc taataatggt gacgatgcaa 420 cggctggtct gactcacatg atgatctggc attccaattt gaatgatgca acttatcaga 480 ggacaagagc tcttgttcgc accggaatgg atcccaggat gtgctctctg atgcaaggtt 540 caactctccc taggaggtct ggagccgcag gtgctgcagt caaaggagtt ggaacaatgg 600 tgatggaatt ggtcagaatg atcaaacgtg ggatcaatga tcggaacttc tggaggggtg 660 agaatggacg aaaaacaaga attgcttatg aaagaatgtg caacattctc aaagggaaat 720 ttcaaactgc tgcacaaaaa gcaatgatgg atcaagtgag agagagccgg aacccaggga 780 atgctgagtt cgaagatctc acttttctag cacggtctgc actcatattg agagggtcgg 840 ttgctcacaa gtcctgcctg cctgcctgtg tgtatggacc tgccgtagcc agtgggtacg 900 actttgaaag ggagggatac tctctagtcg gaatagaccc tttcagactg cttcaaaaca 960 gccaagtgta cagcctaatc agaccaaatg agaatccagc acacaagagt caactggtgt 1020 ggatggcatg ccattctgcc gcatttgaag atctaagagt attaagcttc atcaaaggga 1080 cgaaggtgct cccaagaggg aagctttcca ctagaggagt tcaaattgct tccaatgaaa 1140 atatggagac tatggaatca agtacacttg aactgagaag caggtactgg gccataagga 1200 ccagaagtgg aggaaacacc aatcaacaga gggcatctgc gggccaaatc agcatacaac 1260 ctacgttctc agtacagaga aatctccctt ttgacagaac aaccattatg gcagcattca 1320 atgggaatac agaggggaga acatctgaca tgaggaccga aatcataagg atgatggaaa 1380 gtgcaagacc agaagatgtg tctttccagg ggcggggagt cttcgagctc tcggacgaaa 1440 aggcagcgag cccgatcgtg ccttcctttg acatgagtaa tgaaggatct tatttcttcg 1500 gagacaatgc agaggagtac gacaattaaa gaaaaat 1537 <210> 7 <211> 1000 <212> RNA <213> Influenza A virus <400> 7 gtagatattg aaagatgagt cttctaaccg aggtcgaaac gtacgtactc tctatcatcc 60 cgtcaggccc cctcaaagcc gagatcgcac agagacttga agatgtcttt gcagggaaga 120 acaccgatct tgaggttctc atggaatggc taaagacaag accaatcctg tcacctctga 180 ctaaggggat tttaggattt gtgttcacgc tcaccgtgcc cagtgagcga ggactgcagc 240 gtagacgctt tgtccaaaat gcccttaatg ggaacgggga tccaaataac atggacaaag 300 cagttaaact gtataggaag ctcaagaggg agataacatt ccatggggcc aaagaaatct 360 cactcagtta ttctgctggt gcacttgcca gttgtatggg cctcatatac aacaggatgg 420 gggctgtgac cactgaagtg gcatttggcc tggtatgtgc aacctgtgaa cagattgctg 480 actcccagca tcggtctcat aggcaaatgg tgrcaacaac caatccacta atcagacatg 540 agaacagaat ggttttagcc agcactacag ctaaggctat ggagcaaatg gctggatcga 600 gtgagcaagc agcagaggcc atggaggttg ctattcgggc taggcaaatg gtgcaggcaa 660 tgagaaccat tgggactcat cctagctcca gtgctggtct gaaaaatgat cttcttgaaa 720 atttgcaggc ctatcagaaa cgaatggggg tgcagatgca acggttcaag tgatcctctc 780 attattgcct caartatcat tgggatcttg cacttgayat tgtggattct tgatcgtctt 840 tttttcaaat gcatttaccg tctctttaaa tacggtttga aaagagggcc ttctacggaa 900 ggagtgccaa agtctatgag ggaagaatat caaaaggaac agcagagtgc tgtggatgct 960 gacgatggtc attttgtcag catagagctg gagtaaaaaa 1000 <210> 8 <211> 861 <212> RNA <213> Influenza A virus <400> 8 tgacaaaaac ataatggatc caaacactgt gtcaagcttt caggtagatt gctttctttg 60 gcatgtccgc aaacgagttg cagaccaaga actaggtgat gccccattcc ttgatcggct 120 tcgccgagat cagaaatccc taagaggaag gggcagtact ctcggtctgg acatcaagac 180 agccacacgt gctggaaagc agatagtgga gcggattctg aaagaagaat ccgatgaggc 240 acttaaaatg accatggcct ctgtacctgc gtcgcgttac ctaactgaca tgactcttga 300 ggaaatgtca agggactggt ccatgctcat acccaagcag aaagtggcag gccctctttg 360 tatcagaatg gaccaggcga tcatggataa gaacatcata ctgaaagcga acttcagtgt 420 gatttttgac cggctggaga ctctaatatt gctaagggct ttcaccgaag agggagcaat 480 tgttggcgaa atttcaccat tgccttctct tccaggacat actgctgagg atgtcaaaaa 540 tgcagttgga gtcctcatcg gaggacttga atggaatgat aacacagttc gagtctctga 600 aactctacag agattcgctt ggagaagcag taatgagaat gggagacctc cactcactcc 660 aaaacagaaa cgagaaatgg cgggaacaat taggtcagaa gtttgaagaa ataagatggt 720 tgattgaaga agtgagacac aaactgaaga taacagagaa tagttttgag caaataacat 780 ttatgcaagc cttacatcta ttgcttgaag tggagcaaga gataagaact ttctcgtttc 840 agcttattta gtactaaaaa a 861 <210> 9 <211> 1783 <212> RNA <213> Influenza A virus <400> 9 tccgaagttg ggggggagca aaagcagggg ttcactctgt caaaatggag aacatagtgc 60 ttcttcttgc aatagttagc cttgttaaaa gtgatcagat ttgcattggt taccatgcaa 120 acaactcgac agagcaagtt gacacgataa tggaaaagaa cgtcactgtt acacatgccc 180 aagacatact ggagaaaaca cacaacggga agctctgcga tctaaatgga gtgaagcctc 240 tgattttaaa ggattgtagt gtagctggat ggctcctcgg aaacccaatg tgcgacgaat 300 tcatcagagt gccggaatgg tcttacatag tggagaggga taatccagct aatgacctct 360 gttacccagg gagcctcaat gactatgaag aactgaaaca cctgttgagc agaataaatc 420 attttgagaa gattctgatc atccccaaga gttcttggcc caatcatgaa acatcattag 480 gggtgagcgc agcttgtcca taccagggag cgccctcctt tttcagaaat gtggtatggc 540 ttatcaaaaa gaacgatgca taccccacaa taaagataag ctacaataat accaatcggg 600 aagatctctt gatactgtgg gggattcatc attccaacaa tgcagaagag cagacaaatc 660 tctataaaaa cccaaccacc tatatttcag ttggaacatc aacattaaac cagagattgg 720 taccaaaaat agctactaga tcccaagtaa acgggcaacg tggaagaatg gacttcttct 780 ggacaatttt gaaaccgaat gatgcaattc atttcgagag taatggaaat ttcattgctc 840 cagaatatgc atacaaaatt gtcaagaaag gggactcaac aattatgaaa agtggagtgg 900 aatatggcca ctgcaacacc aaatgtcaaa ccccagtagg agcgataaac tctagtatgc 960 cgttccacaa tatacatcct ctcaccattg gggaatgccc caaatacgtg aagtcaaaca 1020 agttggtcct tgcgactggg ctcagaaata gtcctcaaag agaaacaaga ggactatttg 1080 gagctatagc aggttttata gagggaggat ggcagggaat ggttgatggt tggtatggct 1140 accaccatat caatgagcag gggagtgggt acgctgcaga caaagagtcc acccaaaagg 1200 caatagatgg agttaccaat aaggtcaact cgatcattga caaaatgaac actcaatttg 1260 aggcagttgg aagggagttt aataacttag aaaggaggat agagaatttg aacaagaaaa 1320 tggaagacgg attcctagat gtctggacct ataatgctga acttctagtt ctcatggaaa 1380 acgagaggac tctagatttc catgactcaa atgtcaagaa cctttacgac aaagtcagac 1440 tgcagcttag ggataatgca aaggagctgg gtaacggttg tttcgaattc tatcacaaat 1500 gtgataatga atgtatggaa agtgtgagaa atgggacgta tgactaccct cagtactcag 1560 aagaagcaag attaaaaaga gaagaaataa gcggagttaa attagaatca ataggaactt 1620 accaaatact gccaatttat tcaacagtgg cgagttccct agcactggca atcatggtgg 1680 ctggtctatc tttatggatg tgctccaatg ggtcgttaca gtgcagaatt tgcatttaaa 1740 tttgtgagct cagattgtag ttaaaaacac ccttgtttct act 1783 <210> 10 <211> 1435 <212> RNA <213> Influenza A virus <400> 10 gaaaatgaat ccaaatcaga agataatatg catttcagcc acaggaatga cactatcggt 60 agtaagcctg ctaataggaa ttgccaattt aggcctaaac atcggacttc actataaggt 120 gggtgatgca ccaactgttg atatcccgag catgaatgaa accaactcaa ccacaacaat 180 aataaacaat aatactcaaa ataatttcac aaatatcact aacattataa taaacaaaga 240 ggaggaaaga atatttctaa acctgactaa gcctctatgt gaggtaaact catggcacat 300 tctatcgaag gacaatgcaa taagaatagg ggaggatgct catatactag tcacaaggga 360 gccctattta tcctgtgatc cgcaaagctg taggatgttt gctctgagcc aaggcacgac 420 actcagagga cggcatgcga acggaactat acatgacaga agcccattca gagctctcgt 480 gagctgggaa atgggtcaag cgcccagtcc atacaacgtt agggtcgaat gtataggatg 540 gtcaagcaca tcatgccacg atggcatatc aagaatgtcg atatgcatgt cggggccaaa 600 caacaatgcg tcagcagtgg tctggtacgg gggtaggcca gtaacagaaa tcccatcatg 660 ggcaggaaat attctcagaa ctcaggaatc agaatgcgtg tgtcataaag gggtctgtcc 720 agtagtcatg acagatggcc cagcaaatag tagagcagca actaagataa tttatttcaa 780 agaggggaag atacagaaaa ttgaagaatt gagagggaat gcccagcaca ttgaggaatg 840 ttcatgctat ggggcagcaa gggtaatcaa atgtgtgtgc agggacaatt ggaaaggggc 900 aaacagacca gtaatcacta tagatcctga aatgatgact cacacaagca agtatttgtg 960 ctcaagggta ttaaccgata caagtcgccc caatgatccc actagcggga actgtgatgc 1020 tccgataatg ggggagagcc cagatcctgg ggtgaagggg tttgcattct tggatggaga 1080 gaattcatgg cttggaagga caattagcaa agactccaga tcaggctacg aaatattaaa 1140 ggtcccaaat gcagaaactg atacccagtc agggccaaca tcacaccaga taattgtcaa 1200 caacccaaac tggtcgggat actcaggagc gttcatagac tattgggcaa acaaagagtg 1260 cttcaatcct tgtttttatg tggaactaat cagagggaga cccaaggaga gtagtgtact 1320 gtggacttca aatagcattg tagctctctg tggatccaaa gagcgattgg gatcatggtc 1380 ctggcacgat ggtgctgaga tcatctactt taagtaggaa taatttagga aaaaa 1435 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HA1F <400> 11 tccgaagttg ggggggagca aaagcagggg 30 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> H26-MuCl-H5R <400> 12 cctcttgttt ctctttgagg actatttctg agccc 35 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> H26-MuCl-H5F <400> 13 ctcaaagaga aacaagagga ctatttggag ctata 35 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> NS-890R <400> 14 gggccgccgg gttattagta gaaacaaggg tg 32 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> N1-1F <400> 15 tccgaagttg ggggggagca aaagcaggag 30 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> N1-1413R <400> 16 gggccgccgg gttattagta gaaacaagga gt 32 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-1F <400> 17 tccgaagttg ggggggagcg aaagcaggtc 30 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB2-2341R <400> 18 gggccgccgg gttattagta gaaacaaggt cg 32 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-1F <400> 19 tccgaagttg ggggggagcg aaagcaggca 30 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PB1-2341R <400> 20 gggccgccgg gttattagta gaaacaaggc at 32 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-1F <400> 21 tccgaagttg ggggggagcg aaagcaggta 30 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-PA-2233R <400> 22 gggccgccgg gttattagta gaaacaaggt ac 32 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1F <400> 23 tccgaagttg ggggggagca aaagcagggt 30 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NP-1565R <400> 24 gggccgccgg gttattagta gaaacaaggg ta 32 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1F <400> 25 tccgaagttg ggggggagca aaagcaggta 30 <210> 26 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-M-1027R <400> 26 gggccgccgg gttattagta gaaacaaggt ag 32 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-1F <400> 27 tccgaagttg ggggggagca aaagcagggt 30 <210> 28 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Phw-NS-890R <400> 28 gggccgccgg gttattagta gaaacaaggg tg 32 <210> 29 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> N6-1F <400> 29 tccgaagttg ggggggagca aaagcagggt gaaaatg 37 <210> 30 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> N6-890R <400> 30 gggccgccgg gttattagta gaaacaaggg tgtttt 36

Claims (9)

Method for preparing H5N6 recombinant influenza A virus comprising the following steps:
(a) A recombinant plasmid by cloning a H5N6 type highly pathogenic influenza A virus-derived HA (hemagglutinin) consisting of the nucleotide sequence of SEQ ID NO: 9 and a NA (neuraminidase) derived from a H5N6 type highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10 into a vector, respectively. Preparing a;
(b) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (non-matrix protein) derived from the low-pathogenic influenza A virus consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 -structuring a recombinant plasmid by cloning each structural vector) into a vector;
(c) transfecting the recombinant plasmids of steps (a) and (b) into packaging cells; And
(d) obtaining H5N6 recombinant influenza A virus from culture supernatant of packaging cells.
The method according to claim 1, wherein the H5N6 type highly pathogenic influenza A virus of step (a) is A/duck/Korea/H35/2017 (H5N6).
According to claim 1, H5N6 type H pathogenic influenza A virus-derived HA of the step (a) is H5N6 deleted by Lys-Arg-Arg-Lys located at the carboxy terminal site of HA1 constituting the HA, H5N6 Method for the production of a recombinant recombinant influenza A virus.
The method of claim 1, wherein the low pathogenic influenza A virus of step (b) is A/PR/8/34 (H1N1).
The method of claim 1, wherein the packaging cell of step (c) is a cell selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells, the method for producing H5N6 recombinant influenza A virus.
(Iv) HA (hemagglutinin) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9;
(Ii) a H5N6 type highly pathogenic virus-derived NA (neuraminidase) consisting of the nucleotide sequence of SEQ ID NO: 10; And
(iii) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (PB2) derived from the low-pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 containing 8 negative-sense ssRNAs of non-structural proteins,
Recombinant H5N6 influenza A virus.
The H5N6 type recombinant influenza A virus according to claim 6, wherein the H5N6 type highly pathogenic influenza A virus-derived HA is deleted of Lys-Arg-Arg-Lys located at the carboxy terminal site of HA1 constituting the HA.
(Iv) HA (hemagglutinin) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 9;
(Ii) NA (neuraminidase) derived from H5N6 highly pathogenic influenza A virus consisting of the nucleotide sequence of SEQ ID NO: 10; And
(iii) PB2 (polymerase B2), PB1 (polymerase B1), PA (polymerase A), NP (nucleocapsid), M (matrix protein), and NS (PB2) derived from the low-pathogenic influenza A virus, each consisting of the nucleotide sequences of SEQ ID NOs: 3 to 8 containing 8 negative-sense ssRNAs of non-structural proteins,
Vaccine composition for H5 serotype influenza A virus comprising H5N6 type recombinant influenza A virus.
9. The vaccine composition of claim 8, wherein the H5 serotype influenza A virus belongs to clade 2.3.4.4B.

Images